Naked-Eye and On-Site Detection of Staphylococcus aureus via DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain and Sample Preparation and Genome Extraction
2.2. Preparation of crRNA
2.3. Design of PCR, RAA Primers, Fluorescent Probes, and CatG4R Probes
2.4. DNAzyme Colorimetric Assay
2.5. Statistical Analysis
3. Results and Discussion
3.1. Principle and Feasibility Validation of DNAzyme-Assisted CRISPR/Cas12a for S. aureus Detection
3.1.1. Experimental Principle
3.1.2. Feasibility Study
3.2. Optimization of Assay Conditions for DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a
3.3. Sensitivity and Specificity Characterization of DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a
3.3.1. Sensitivity Characterization
3.3.2. Specific Characterization
3.4. Detection of Artificially Contaminated Dairy Products
3.4.1. Milk Sample Testing
3.4.2. Milk Beverage Sample Testing
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cosgrove, S.E.; Sakoulas, G.; Perencevich, E.N.; Schwaber, M.J.; Karchmer, A.W.; Carmeli, Y. Comparison of Mortality Associated with Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Bacteremia: A Meta-analysis. Clin. Infect. Dis. 2003, 36, 53–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, L.G.; Eells, S.J.; Taylor, A.R.; David, M.Z.; Ortiz, N.; Zychowski, D.; Kumar, N.; Cruz, D.; Boyle-Vavra, S.; Daum, R.S. Staphylococcus aureus colonization among household contacts of patients with skin infections: Risk factors, strain discordance, and complex ecology. Clin. Infect. Dis. 2012, 54, 1523–1535. [Google Scholar] [CrossRef] [Scilit]
- Linzner, N.; Loi, V.V.; Antelmann, H. The Catalase KatA Contributes to Microaerophilic H2O2 Priming to Acquire an Improved Oxidative Stress Resistance in Staphylococcus aureus. Antioxidants 2022, 11, 1793. [Google Scholar] [CrossRef] [Scilit]
- Silva, V.; Caniça, M.; Manageiro, V.; Verbisck, N.; Tejedor-Junco, M.T.; González-Martin, M.; Corbera, J.A.; Poeta, P.; Igrejas, G. Staphylococcus aureus and Methicillin-Resistant Coagulase-Negative Staphylococci in Nostrils and Buccal Mucosa of Healthy Camels Used for Recreational Purposes. Animals 2022, 12, 1255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Votintseva, A.A.; Fung, R.; Miller, R.R.; Knox, K.; Godwin, H.; Wyllie, D.H.; Bowden, R.; Crook, D.W.; Walker, A.S. Prevalence of Staphylococcus aureus protein A (spa) mutants in the community and hospitals in Oxfordshire. BMC Microbiol. 2014, 14, 63. [Google Scholar] [CrossRef] [Scilit]
- Kaito, C.; Sekimizu, K. Colony spreading in Staphylococcus aureus. J. Bacteriol. 2007, 189, 2553–2557. [Google Scholar] [CrossRef] [Scilit]
- Parfentjev, I.A.; Catelli Anna, R. Tolerance of Staphylococcus aureus to Sodium Chloride. J. Bacteriol. 1964, 88, 1–3. [Google Scholar] [CrossRef] [Scilit]
- Ridder, M.J.; Daly, S.M.; Hall, P.R.; Bose, J.L. Quantitative Hemolysis Assays. Methods Mol. Biol. 2021, 2341, 25–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, A.-M.; Kay, I.; Palladino, S. Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction. Diagn. Microbiol. Infect. Dis. 2005, 51, 13–17. [Google Scholar] [CrossRef] [Scilit]
- Dai, G.; Li, Z.; Luo, F.; Lu, Y.; Chu, Z.; Zhang, J.; Zhang, F.; Wang, Q.; He, P. Simultaneous electrochemical determination of nuc and mecA genes for identification of methicillin-resistant Staphylococcus aureus using N-doped porous carbon and DNA-modified MOF. Microchim. Acta 2021, 188, 39. [Google Scholar] [CrossRef] [Scilit]
- Ziegler, I.; Cajander, S.; Rasmussen, G.; Ennefors, T.; Molling, P.; Stralin, K. High nuc DNA load in whole blood is associated with sepsis, mortality and immune dysregulation in Staphylococcus aureus bacteraemia. Infect. Dis. 2019, 51, 216–226. [Google Scholar] [CrossRef] [Scilit]
- GB 29921-2021; National Food Safety Standard-Maximum Levels of Pathogenic Microorganisms in Prepackaged Foods. National Health Commission of the People’s Republic of China, State Administrationfor Market Regulation: Beijing, China, 2021.
- Ahmed, A.D.; Hiko, A.; Belina, D.; Gebremeskel, H.F.; Kebede, I.A. Identification and antimicrobial susceptibility profiles of Staphylococcus species isolated from raw cow milk, and swabs in smallholder dairy farms in Meta district, Eastern Ethiopia. BMC Microbiol. 2024, 24, 284. [Google Scholar] [CrossRef] [Scilit]
- Naeem, I.; Ismail, A.; Riaz, M.; Aziz, M.; Akram, K.; Shahzad, M.A.; Ameen, M.; Ali, S.; Oliveira, C.A.F. Aflatoxins in the rice production chain: A review on prevalence, detection, and decontamination strategies. Food Res. Int. 2024, 188, 114441. [Google Scholar] [CrossRef] [Scilit]
- Oniciuc, E.-A.; Nicolau, A.I.; Hernández, M.; Rodríguez-Lázaro, D. Presence of methicillin-resistant Staphylococcus aureus in the food chain. Trends Food Sci. Technol. 2017, 61, 49–59. [Google Scholar] [CrossRef] [Scilit]
- Du, R.; Yang, X.; Cheng, J.-H. Inhibition regulatory mechanism in Staphylococcus aureus under cold plasma oxidative stress. Food Biosci. 2025, 65, 106040. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Dou, L.; Zhang, Y.; Luo, L.; Yang, H.; Wen, K.; Yu, X.; Shen, J.; Wang, Z. A comprehensive review on the detection of Staphylococcus aureus enterotoxins in food samples. Compr. Rev. Food Sci. Food Saf. 2024, 23, e13264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amando, G.; Tonon, A.; Constantino, D.; Hidalgo, M.P.; Rampelotto, P.H.; Montagner, F. Understanding the Diurnal Oscillation of the Gut Microbiota Using Microbial Culture. Life 2023, 13, 831. [Google Scholar] [CrossRef] [Scilit]
- Lee, A.W.-T.; Chan, C.T.-M.; Wong, L.L.-Y.; Yip, C.-Y.; Lui, W.-T.; Cheng, K.-C.; Leung, J.S.-L.; Lee, L.-K.; Wong, I.T.-F.; Ng, T.T.-L.; et al. Identification of microbial community in the urban environment: The concordance between conventional culture and nanopore 16S rRNA sequencing. Front. Microbiol. 2023, 14, 1164632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szaleniec, J.; Gibała, A.; Hartwich, P.; Hydzik-Sobocińska, K.; Konior, M.; Gosiewski, T.; Szaleniec, M. Challenging the gold standard: Methods of sampling for microbial culture in patients with chronic rhinosinusitis. Eur. Arch. Oto-Rhino-Laryngol 2021, 278, 4795–4803. [Google Scholar] [CrossRef] [Scilit]
- Haiping, L.; Jiangyue, W.; Fanping, M.; Aifeng, L. Immunochromatographic assay for the detection of antibiotics in animal-derived foods: A review. Food Control 2021, 130, 108356. [Google Scholar] [CrossRef] [Scilit]
- Roda, A.; Mirasoli, M.; Roda, B.; Bonvicini, F.; Colliva, C.; Reschiglian, P. Recent developments in rapid multiplexed bioanalytical methods for foodborne pathogenic bacteria detection. Microchim. Acta 2012, 178, 7–28. [Google Scholar] [CrossRef] [Scilit]
- Zhou, C.; Fang, Z.; Zhao, C.; Mai, X.; Emami, S.; Taha, A.Y.; Sun, G.; Pan, T. Sample-to-Answer Robotic ELISA. Anal. Chem. 2021, 93, 11424–11432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, R.; Liu, X.; Xiong, Z.; Wang, G.; Ai, L. Research progress on detection of foodborne pathogens: The more rapid and accurate answer to food safety. Food Res. Int. 2024, 193, 114767. [Google Scholar] [CrossRef] [Scilit]
- Abudayyeh, O.O.; Gootenberg, J.S.; Konermann, S.; Joung, J.; Slaymaker, I.M.; Cox, D.B.T.; Shmakov, S.; Makarova, K.S.; Semenova, E.; Minakhin, L.; et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 2016, 353, aaf5573. [Google Scholar] [CrossRef] [Scilit]
- Horvath, P.; Barrangou, R. CRISPR/Cas, the Immune System of Bacteria and Archaea. Science 2010, 327, 167–170. [Google Scholar] [CrossRef] [Scilit]
- Zetsche, B.; Gootenberg, J.S.; Abudayyeh, O.O.; Slaymaker, I.M.; Makarova, K.S.; Essletzbichler, P.; Volz, S.E.; Joung, J.; van der Oost, J.; Regev, A.; et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 2015, 163, 759–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Shang, X.; Huang, X. Next-generation pathogen diagnosis with CRISPR/Cas-based detection methods. Emerg. Microbes Infect. 2020, 9, 1682–1691. [Google Scholar] [CrossRef] [Scilit]
- Tao, X.; Yue, L.; Tian, T.; Zhang, Y.; Zhou, X.; Song, E. Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy Transfer. Anal. Chem. 2024, 96, 9270–9277. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Li, M.; Qu, Z.; Liu, Y.; Lu, X.; Li, R.; Zou, L. Label-free fluorescence detection of mercury ions based on thymine-mercury-thymine structure and CRISPR-Cas12a. Food Res. Int. 2024, 180, 114058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.-Y.; Cheng, Q.-X.; Wang, J.-M.; Li, X.-Y.; Zhang, Z.-L.; Gao, S.; Cao, R.-B.; Zhao, G.-P.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Chen, X.; Zhang, M.; Wang, X.; Chen, Y.; Qian, C.; Wu, J.; Xu, J. Versatile detection with CRISPR/Cas system from applications to challenges. TrAC Trends Anal. Chem. 2021, 135, 116150. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhang, T.; Feng, J.; Cui, Y.; Zhang, L.; Wang, Y.; Cui, M.; Li, D.; Tai, H. Construction of “peptide-hemin/DNA” hybrid-complexes and their peroxidase activities. Chem. Commun. 2023, 59, 7811–7814. [Google Scholar] [CrossRef] [Scilit]
- Chiura, T.; Pham, M.N.; Baum, D.A.; Mak, P.J. Interactions between heme and G-quadruplex DNA involve the oxygen of guanine. J. Inorg. Biochem. 2025, 266, 112843. [Google Scholar] [CrossRef] [Scilit]
- Aiamsa-at, P.; Nonthakaew, N.; Phiwsaiya, K.; Senapin, S.; Chaijarasphong, T. CRISPR-based, genotype-specific detection of yellow head virus genotype 1 with fluorescent, lateral flow and DNAzyme-assisted colorimetric readouts. Aquaculture 2023, 574, 739696. [Google Scholar] [CrossRef] [Scilit]
- Xia, X.; Ma, B.; Zhang, T.; Lu, Y.; Khan, M.R.; Hu, Y.; Lei, C.; Deng, S.; He, Q.; He, G.; et al. G-Quadruplex-Probing CRISPR-Cas12 Assay for Label-Free Analysis of Foodborne Pathogens and Their Colonization In Vivo. ACS Sens. 2021, 6, 3295–3302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marvi, P.K.; Das, P.; Jafari, A.; Hassan, S.; Savoji, H.; Srinivasan, S.; Rajabzadeh, A.R. Multifunctional carbon dots in situ confined hydrogel for optical communication, drug delivery, pH sensing, nanozymatic activity, and UV shielding applications. Adv. Healthc. Mater. 2025, 146, 2403876. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Chen, X.; Wu, H.; Wang, Z.; Chen, X.; Niyato, D.; Huang, K. Integrated sensing and edge AI: Realizing intelligent perception in 6G. IEEE Commun. Surv. Tutor. 2026, 28, 2725–2770. [Google Scholar] [CrossRef] [Scilit]







| Sequence Name | Sequence (5′-3′) |
|---|---|
| Nuc-RAA-F | CTTATAGGGATGGCTATCAGTAATGTTTCG |
| Nuc-RAA-R | TCTATTTACGCCATTATCTGTTTGTGATGC |
| CatG4 | TGGGTAGGGCGGGTTGGGAAA |
| CatG4R | TTTCCCAACCCGCCCTACCCA |
| crRNA-M1 | GCAACTAGTAGCGAAAAAGAATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA-M2 | CTTAGACTTGAAACTACAACATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA-M3 | TTCCTGAGCTACTTAGACTTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA-M4 | TTTTCTACCATTTTTTTCGTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA-M5 | TCAGTTCTTTGACCTTTCTCATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA-M6 | TACCATTTTTCCATCAGCATATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTA |
| crRNA | UAAUUUCUACUAAGUGUAGAUGUUGUAGUUUCAAGUCUAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Liu, X.; Gao, R.; Wang, R.; Xiong, Z.; Wang, G.; Ai, L. Naked-Eye and On-Site Detection of Staphylococcus aureus via DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a. Foods 2026, 15, 579. https://doi.org/10.3390/foods15030579
Liu X, Gao R, Wang R, Xiong Z, Wang G, Ai L. Naked-Eye and On-Site Detection of Staphylococcus aureus via DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a. Foods. 2026; 15(3):579. https://doi.org/10.3390/foods15030579
Chicago/Turabian StyleLiu, Xinxin, Ruoxuan Gao, Ruotong Wang, Zhiqiang Xiong, Guangqiang Wang, and Lianzhong Ai. 2026. "Naked-Eye and On-Site Detection of Staphylococcus aureus via DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a" Foods 15, no. 3: 579. https://doi.org/10.3390/foods15030579
APA StyleLiu, X., Gao, R., Wang, R., Xiong, Z., Wang, G., & Ai, L. (2026). Naked-Eye and On-Site Detection of Staphylococcus aureus via DNAzyme-Assisted Colorimetric Bioassay for CRISPR/Cas12a. Foods, 15(3), 579. https://doi.org/10.3390/foods15030579

