Next Article in Journal
Characterization of Volatile Profile of Different Kiwifruits (Actinidia chinensis Planch) Varieties and Regions by Headspace-Gas Chromatography-Ion Mobility Spectrometry
Previous Article in Journal
Reviving Forgotten Foods: From Traditional Knowledge to Innovative and Safe Mediterranean Food Design
Previous Article in Special Issue
Combined Vacuum and Ascorbic Acid Treatment Enhances Texture and Antioxidant Capacity in Fresh-Cut Potatoes: Transcriptomic Elucidation of Glutathione Metabolism Mechanisms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 15
Issue 1
10.3390/foods15010153
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Vanillin Activates HuTGA1-HuNPR1/5-1 Signaling to Enhance Postharvest Pitaya Resistance to Soft Rot

by
Jian Xu
1,2,
Xinlin Liu
1,2,
Yilin He
1,
Jinhe Li
1,
Muhammad Muzammal Aslam
3,
Rui Li
1,2,* and
Wen Li
1,2
1
Key Laboratory for Quality Regulation of Tropical Horticultural Crops of Hainan Province, School of Tropical Agriculture and Forestry, Hainan University, Danzhou 571737, China
2
School of Breeding and Multiplication (Sanya Institute of Breeding and Multiplication), Hainan University, Sanya 572025, China
3
Institute of Forestry and Pomology, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100093, China
*
Author to whom correspondence should be addressed.
Foods 2026, 15(1), 153; https://doi.org/10.3390/foods15010153 (registering DOI)
Submission received: 29 November 2025 / Revised: 19 December 2025 / Accepted: 23 December 2025 / Published: 3 January 2026
(This article belongs to the Special Issue Technologies and Strategies to Improve the Quality and Extend the Shelf-Life of Post-Harvest Fruits and Vegetables)
Browse Figures
Versions Notes

Abstract

Fusarium oxysporum-induced soft rot severely threatens postharvest pitaya quality and storage life, and while vanillin shows promise in the disease management, its mechanisms for controlling pitaya decay remain incompletely understood. In this study, we systematically investigated the molecular mechanism by which vanillin inhibits soft rot in postharvest pitaya, employing physiological and biochemical characterization, bioinformatics analysis, and molecular biology techniques. Compared with control fruit on 10 d, vanillin treatment significantly reduced disease index and lesion area by 27.12% and 67.43%, respectively. Meanwhile, vanillin treatment delayed the degradation of total soluble solids (TSSs) and titratable acidity (TA) and promoted the accumulation of total phenolics and flavonoids. Additionally, vanillin enhanced the activities of defense-related enzymes, such as catalase (CAT), superoxide dismutase (SOD), phenylalanine ammonia-lyase (PAL), β-1,3-glucanase (GLU), chitinase (CHI), peroxidase (POD) and polyphenol oxidase (PPO), and increased antioxidant capacity, as evidenced by increased DPPH radical scavenging capacity and ascorbic acid content. This resulted in reduced oxidative damage, as indicated by decreased levels of malondialdehyde (MDA), H2O2 and O2•−. Yeast one-hybrid (Y1H), dual-luciferase reporter (DLR) and subcellular localization revealed that HuTGA1, a nuclear-localized transcriptional activator, specifically bound to the as-1 cis-acting element and activated expression of HuNPR1 and HuNPR5-1. Transient overexpression of HuTGA1 reduced reactive oxygen species (ROS) accumulation and upregulated related genes. These findings suggest that vanillin treatment might enhance pitaya resistance by activating the HuTGA1-HuNPR signaling module, providing insights into the molecular mechanisms underlying vanillin-induced resistance.

1. Introduction

Pitaya (Hylocereus undatus), a non-climacteric fruit native to Mexico and Central and South America, has gained global recognition for its vibrant appearance, unique flavor, and high economic value. Its cultivation has expanded to tropical and subtropical regions, including Vietnam and China [1]. However, pitaya production faces significant challenges from biotic and abiotic stresses, leading to substantial postharvest losses due to fruit decay. Soft rot, caused by Fusarium oxysporum (F. oxysporum), is a particularly devastating disease that threatens the sustainability and growth of the pitaya industry [2]. Therefore, developing effective and safe preservation strategies is essential to maintaining fruit quality and maximizing economic returns.
Various postharvest preservation techniques have been explored to maintain pitaya quality, including chemical treatments, controlled atmosphere storage, coating treatments, and cold storage [3,4,5]. However, these methods have limitations, including potential environmental and health risks associated with chemical fungicides, accumulation of coating materials in the human body, and sensory quality impairment. Additionally, cold storage is energy-intensive, and controlled atmosphere preservation requires specialized equipment [6,7,8]. These limitations highlight the need for green, safe, and sustainable alternatives [9]. Consequently, research focus has shifted towards exploring natural, pollution-free preservation strategies that can effectively maintain pitaya quality while minimizing environmental and health risks.
Exogenous vanillin application has been shown to effectively delay quality deterioration in various horticultural products. Vanillin exhibits broad-spectrum antifungal activity against pathogens such as Alternaria alternata in apples and Botrytis cinerea in tomatoes. Its mechanism of action involves disrupting cell membrane integrity, inducing lipid peroxidation, and modulating defense-related enzymes. In apples, vanillin activates enzymes such as phenylalanine ammonia-lyase (PAL), β-1,3-glucanase (GLU) and Chitinase (CHI), inhibiting pathogen growth and improving fruit quality [10]. Similarly, in tomatoes, vanillin inhibits mycelial growth and spore germination, suppresses pathogen-related enzyme activities, and delays postharvest disease onset [11].
Vanillin-based treatments have shown promise in extending the storage life of various fruits. For example, chitosan–vanillin coatings have been reported to suppress F. oxysporum fruit rot in tomato by inhibiting pathogen growth and inducing defense-related enzymes, ultimately reducing disease development and extending postharvest shelf life [12]. Similarly, in grapes, the combined application of vanillin with clove and lavender essential oils encapsulated in chitosan or alginate microcapsules effectively inhibited the mycelial growth and spore germination of Botrytis cinerea, preserved fruit firmness and intrinsic flavor attributes, and consequently improved the overall postharvest quality [13]. The efficacy of these treatments is attributed to the inhibition of pathogen growth, induction of defense-related enzymes, accumulation of antifungal metabolites, and maintenance of cellular homeostasis, revealing vanillin’s potential as a natural preservative for postharvest disease control.
Salicylic acid (SA) signaling pathway plays a crucial role in plant defense against pathogens, involving the translocation of NPR1 protein and its interaction with TGA transcription factors to activate pathogenesis-related (PR) genes [14]. TGA transcription factors, which belong to the basic leucine zipper (bZIP) family, are important regulators of plant growth, development, and responses to biotic and abiotic stresses [15]. Accumulating evidence indicates that TGA transcription factors play critical roles in plant disease resistance, although their functions vary depending on the plant species and pathogen. In banana, MaTGA8 enhances resistance to F. oxysporum through its interaction with MaNPR1 and MaNPR4 [16]. Similarly, ScTGA4 of sugarcane contributes to resistance against Xanthomonas albilineans by regulating the salicylic acid (SA) signaling pathway [17]. In potato, StTGA39 positively regulates the expression of StBAK1, thereby conferring resistance to bacterial wilt [18]. In grapevine, VvTGA8 mediates resistance to white rot by modulating SA pathway–related genes, including SlPR1 and SlPR2 [19]. In contrast, certain TGA transcription factors, such as CmTGA7 and CmTGA9, function as negative regulators and reduce resistance to Botrytis cinerea [15]. These findings highlight the complex and dual roles of TGA transcription factors in plant–pathogen interactions. However, their functional mechanisms in pitaya remain unclear and require further investigation. Vanillin, a naturally derived compound, exhibits both antimicrobial and resistance-inducing properties, making it a promising antagonist for postharvest disease control. It not only suppresses pathogen growth but also activates immune responses in fruits [15,20]. The molecular mechanisms of vanillin-enhanced resistance in pitaya, particularly the roles of the SA signaling pathway and TGA transcription factors, require further elucidation.
This study aims to explore vanillin’s role in enhancing pitaya resistance to Fusarium-induced soft rot, focusing on the regulatory function of HuTGA1. This study assessed vanillin’s effects on lesion expansion, antioxidant defense, antifungal metabolite accumulation, and PR gene expression, and validated HuTGA1’s role in fruit defense responses, providing insights into vanillin-induced resistance and sustainable disease management in tropical fruits.

2. Materials and Methods

2.1. Pitaya Fruit

Fresh pitaya fruit of “Jindu No. 1” were harvested at commercial maturity stage, corresponding to approximately 80% ripeness, with a predominantly or fully red pericarp and persistently green bracts. Fruits were meticulously selected following strict criteria, including uniform size, freedom from pest infestations and fungal/bacterial diseases, as well as the absence of physical damage. The selected fruits were subjected to a surface sterilization treatment using a 0.1% chloroform solution, followed by air-drying at room temperature. The pathogen used in this study was isolated by our research group from naturally infected pitaya fruit, following the method described by Ge et al. [21]. F. oxysporum (1 × 106 CFU mL−1) was cultured on PDA medium for 7 d and subsequently tested for pathogenicity on pitaya fruits. Vanillin (C8H8O3) of analytical grade was obtained from Macklin (204-456-2, Guangzhou, China). Approximately 200 pitaya fruits were randomly divided into two groups for further experimentation.
Pitaya fruits were immersed in vanillin (4 g L−1, 20 min) and sterile water (control), air-dried, and wound-inoculated with F. oxysporum (2 × 106 CFU mL−1; 25 µL at three epidermal sites using a sterile toothpick) as described by Ge et al. [21]. Fruits (six per unsealed polyethylene bag, 0.02 mm; 20 × 30 cm) were stored at 25 ± 0.5 °C and 90% RH for up to 10 d; disease symptoms and lesion area were recorded to 10 dpi. Samples were taken every 2 d; 2-cm-wide peel and pulp strips from the equatorial region were excised, snap-frozen in liquid nitrogen, and stored at −80 °C for analysis. All assays used three biological replicates, each of five fruits [22].

2.2. Determination of Fruit Quality Attributes

Postharvest decay was assessed at 0, 2, 4, 6, 8, and 10 d by counting fruits with visible symptoms; disease severity was scored using a six-level decay index (DI) based on the percentage of decayed area [23], and lesion area was calculated as S = 3.14 × (lesion diameter/2)2 from the mean of nine diameters [24]. Weight loss was determined on six fruits, calculated using the formula: weight loss (%) = (1 − M2/M1) × 100 with initial weight M1 and subsequent weights M2 recorded every 2 d [5,25].
Total soluble solids (TSS), titratable acidity (TA) and AsA were determined using 1 g of fresh fruit pulp for each analysis. TSS content was determined using a digital handheld refractometer (PAL-1, ATAGO, Tokyo, Japan). Three replicates were analyzed for each treatment group. TA was determined by titration with 0.1% NaOH to pH 7.5 using phenolphthalein (P991927, Macklin, Shanghai, China) as an indicator, after homogenization with 4 mL of deionized water, and expressed as % citric acid [25]. Ascorbic acid (AsA) was quantified by 2,6-dichlorophenolindophenol titration using 4 mL of 2% oxalic acid as the extraction solvent and expressed as mg 100 g−1 FW [26].
Malondialdehyde (MDA), total phenols (TP) and flavonoids (TF) were determined using 0.5 g of fresh fruit pulp for each analysis. MDA was assayed by the TBA method using 2.0 mL of 0.67% TBA solution, and measured at 450/532/600 nm, MDA content was expressed as μmol g−1 FW [27]. Total phenolic compounds and flavonoids were determined following the procedure described by Yang et al. [28] with slight modifications. Samples were extracted with 5 mL of 80% methanol, and the resulting extracts were used for analysis. TP content was measured at 760 nm using gallic acid as the standard, while TF content was determined at 510 nm using rutin as the standard. Results were expressed as mg g−1 FW.

2.3. Determination of Reactive Oxygen Species (ROS) Level and Defense-Related Enzyme Activities

ROS and antioxidant/defense enzymes were assayed from frozen peel. The rate of O2•− generation was measured following Tang et al. [27] using 0.5 g tissue homogenized in ice-cold phosphate buffer (1 mM EDTA, 0.3% Triton X-100, 2% PVP) and expressed as μmol min−1 g−1 FW; H2O2 was quantified using 0.5 g of peel tissue with a commercial kit (Nanjing Jiancheng Bioengineering Institute Co., Ltd., Nanjing, China) (Nanjing Jiancheng) against a standard curve. A 0.5 g of peel tissue was mixed with 2 mL of 0.2 mM DPPH dissolved in ethanol, and the absorbance was measured at 517 nm [29]. DPPH radical-scavenging activity was calculated as (%) = (1 − Sample absorbance/Control absorbance) × 100.
Crude enzyme extracts (0.5 g of peel tissue ground in liquid nitrogen) were used for the determination of the following enzyme activities. Catalase (CAT) activity was measured by monitoring H2O2 decomposition at 240 nm, and superoxide dismutase (SOD) activity was determined based on the inhibition of nitro blue tetrazolium (NBT) photoreduction at 560 nm, both enzyme activities were determined according to the method described by Yun et al. [30], using an extraction buffer containing 3.0 mL of 100 mmol/L phosphate buffer (pH 7.5) with 5 mmol/L DTT and 5% PVP. Peroxidase (POD) activity was determined in a 3.0 mL reaction system containing 50 mmol/L acetate buffer (pH 5.5), using guaiacol as the substrate and recording absorbance at 470 nm, while polyphenol oxidase (PPO) activity was assessed in the same buffer system, with catechol as the substrate and absorbance detected at 410 nm [22]. PAL was measured at 290 nm using L-phenylalanine in 3 mL of 50 mM borate buffer, pH 8.8 [31]. GLU activity was determined using laminarin as substrate and measuring absorbance at 540 nm after the DNS color reaction, while CHI activity was measured with colloidal chitin as substrate [27]. All enzyme activities were expressed as U g−1 FW, with three biological replicates per treatment.

2.4. Real-Time Quantitative PCR (RT-qPCR)

Total RNA was extracted from frozen pitaya peel tissues using the CTAB method, and its quality and purity were assessed using a NanoPhotometer N50 (Implen, Munich, Germany). First-strand cDNA was synthesized from 1 μg of total RNA, and qRT-PCR was performed using the HiScript II One Step qRT-PCR SYBR Green Kit (Nanjing Novezan Biotechnology Co., Ltd., Nanjing, China). The UBQ gene served as an internal reference, and relative expression levels were calculated using the 2−ΔΔCt method [31]. The primers are listed in Table 1. Data were visualized using GraphPad Prism 8 software.

2.5. Gene Cloning and Sequence Analysis

Genomic DNA was extracted from pitaya using the CTAB method, and the sequences of HuTGA and HuNPR genes were obtained from the pitaya genome database (http://www.pitayagenomic.com/) (accessed on 22 December 2025). Various bioinformatics analyses were performed, including cis-acting element analysis, multiple sequence alignment, phylogenetic tree construction, and motif analysis, using databases and tools such as PlantCARE: https://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 21 March 2025), ClustalW: http://www.genome.jp/tools-bin/clustalw (accessed on 25 March 2025), MEGA 11.0, and MEME Suite: https://meme-suite.org/meme/tools/meme (accessed on 26 March 2025).

2.6. Subcellular Localization of HuTGA1

The full-length coding sequence of HuTGA1 was PCR-amplified and cloned into the pCAMBIA1302 vector to generate a 35S: HuTGA1-GFP fusion construct. This construct, along with a 35S: GFP control vector, was introduced into Agrobacterium tumefaciens GV3101(TOLOBIO, Biotech Co., Ltd., Nanjing, China) and transiently expressed in tobacco cells. GFP fluorescence was then examined under a fluorescence microscope, and nuclear localization was confirmed using DAPI (Real Times Biotechnology, Beijing, China) staining as a reference marker.

2.7. Yeast One-Hybrid Assay (Y1H)

Y1H was conducted using the Matchmaker Gold Y1H System to investigate the interaction between HuTGA1 and the promoters of HuNPR1 and HuNPR5-1. The promoters were cloned upstream of the HIS reporter gene in the pHIS2 vector, generating pHIS2-HuNPR1pro and pHIS2-HuNPR5-1pro constructs. HuTGA1 was inserted into the pGADT7 vector to generate pGADT7-HuTGA1 [31]. Self-activation of the promoter constructs was assessed in yeast strain Y187(TOLOBIO, Biotech Co., Ltd., China), and interaction assays were performed by co-transforming Y187 cells with pGADT7-HuTGA1 and either pHIS2-HuNPR1pro or pHIS2-HuNPR5-1pro. Positive clones were selected on SD/-Trp/-Leu plates and subsequently evaluated for protein-DNA interactions on SD/-Trp/-Leu/-His medium containing 3-amino-1,2,4-triazole (3-AT). Positive and negative controls were included to validate the assay system, ensuring the reliability of the results.

2.8. Dual-Luciferase Reporter Assay

Dual-luciferase reporter assays were conducted to assess the transcriptional activation of HuNPR1 and HuNPR5-1 promoters by HuTGA1. The effector construct was generated by cloning the full-length CDS of HuTGA1 into the pGreen II 62-SK vector, while the reporter plasmids were produced by inserting the promoter regions of HuNPR1 and HuNPR5-1 into the pGreen II 0800-LUC vector [31]. Agrobacterium tumefaciens strain GV3101 was co-transformed with the effector and reporter plasmids and co-infiltrated into Nicotiana benthamiana leaves. Firefly and Renilla luciferase activities were measured 48 h post-infiltration using the Dual-Luciferase Reporter Assay System, and relative luciferase activity was calculated as the ratio of firefly to Renilla signals. This assay enabled the evaluation of HuTGA1’s ability to transcriptionally activate the HuNPR1 and HuNPR5-1 promoters.

2.9. Transient Overexpression of HuTGA1 in Pitaya Fruit

The full-length coding sequence of HuTGA1 was cloned into the pGreen II 62-SK vector to generate the SK-HuTGA1 construct, which was then transformed into Agrobacterium tumefaciens strain GV3101 [31]. An empty pGreen II 62-SK vector served as the negative control. Agrobacterial suspensions were adjusted to an OD600 of 0.8 and injected into the pericarp of pitaya fruit. The fruit was then incubated in darkness at 25 ± 1 °C with 90–95% relative humidity, and samples were harvested at 0, 4, and 8 d post-infiltration (dpi) for subsequent analyses. Each treatment consisted of three biological replicates, with four fruits per replicate, allowing for the assessment of HuTGA1’s role in pitaya fruit through transient overexpression.

2.10. Statistical Analysis

All experiments were conducted with three independent biological replicates. Data were analyzed using SPSS version 25.0 and subjected to one-way ANOVA at a significance level of p < 0.05. Pairwise comparisons between treatments were assessed using Student’s t-test. Normality and homogeneity of variances were verified using the Shapiro–Wilk and Levene’s tests, respectively. Correlation analyses were performed using OriginPro 2021, and graphs were generated using GraphPad Prism 9.5. Significance levels are indicated as (* p < 0.05, and ** p < 0.01).

3. Results

3.1. Vanillin Treatment Enhances Disease Resistance and Maintains the Quality of Pitaya Fruit During Storage

To evaluate the effects of vanillin treatment on the postharvest quality of pitaya, this study systematically monitored the physicochemical changes of fruits during storage (Figure 1A). Vanillin curtailed disease from 4 d onward: by 10 d, the decay index and lesion area were lower than the control by 27.12% and 67.43%, respectively (Figure 1B,C, p < 0.01).
Weight loss increased over time in both groups but rose more slowly with vanillin; at 8 and 10 d it was reduced by 36.68% and 37.54% versus control, respectively (Figure 2A, p < 0.01). Furthermore, vanillin treatment promoted the accumulation of TSS, with a peak content of 19.8% on 2 d, 1.5-fold the control (Figure 2B, p < 0.01). The AsA accumulated throughout storage and was higher with vanillin by 16.66% on 4 d and 33.34% on 8 d, respectively (Figure 2C, p < 0.01). Additionally, although TA declined overall, vanillin treatment attenuated this decrease, yielding 25% and 16.67% higher TA than the control on 4 d and 8 d, respectively (Figure 2D, p < 0.05). The control group showing 1.3 and 1.29-fold significantly higher MDA content on 6 d and 8 d, respectively, compared to the vanillin-treated group (Figure 2E, p < 0.01). Moreover, vanillin treatment increased total phenolics and flavonoids to 1.13 and 1.10-fold of the control on 6 d, respectively (Figure 2F,G, p < 0.01). Vanillin treatment significantly slowed quality decline during storage, reducing disease and physiological damage while preserving nutritional and secondary metabolite levels.

3.2. Vanillin Treatment Regulates Redox Balance and Enhances Defense Enzyme Activities in Pitaya Fruit

Our results demonstrated that vanillin treatment significantly affected the redox balance and defense enzyme system in pitaya fruit during storage. The H2O2 content increased continuously, but accumulation was markedly lower in the vanillin treatment group; by 10 d it reached 0.88 mmol g−1 FW in the control and 0.61 mmol g−1 FW in the vanillin treatment (Figure 3A, p < 0.01). Similarly, the production rate of O2•− declined in both groups, yet the vanillin treatment consistently maintained lower levels, being 1.54-fold lower than the control at 10 d (Figure 3B, p < 0.01). In contrast, DPPH radical scavenging activity increased throughout storage, with vanillin treatment maintaining higher values—1.13, 1.13, and 1.12-fold higher than the control at 4, 6, and 10 d, respectively (Figure 3C, p < 0.01).
Furthermore, vanillin treatment also influenced antioxidant enzymes. POD activity increased gradually in the treatment group but remained stable in the control; at 8 and 10 d it was 2.83 and 2.22-fold higher, respectively (Figure 3D, p < 0.01). SOD activity rose in both groups but was consistently higher under vanillin treatment, showing 7.47%, 3.65%, and 5.26% greater activity from 6 to 10 d (Figure 3E, p < 0.01). CAT activity declined overall but decreased more slowly with vanillin treatment; from 2 to 8 d it was 1.32, 1.31, 1.21 and 1.56-fold higher than in the control (Figure 3F, p < 0.01). Defense-related enzymes were also activated. PAL activity increased and peaked at 8 d at a level 2.2-fold higher than the control (Figure 3G, p < 0.01). PPO activity fluctuated, with the vanillin-treated group being 45.34% and 44.73% significantly higher than the control group on 8 d and 10 d, respectively (Figure 3H, p < 0.01). CHI activity first decreased then rose, reaching 16.69 U g−1 at 10 d, 7.37-fold higher than the control (Figure 3I, p < 0.01). GLU activity was likewise enhanced, peaking at 8 d at 2.34-fold higher than the control (Figure 3J, p < 0.01). Thus, Vanillin treatment enhanced antioxidant and defense enzyme activities, improved the resistance and disease tolerance of the pitaya fruit.

3.3. The Expression Patterns of Defense-Related Genes in Pitaya Treated with Vanillin

Vanillin treatment significantly affected the expression of antioxidant- and defense-related genes in pitaya fruit during storage. Overall, gene expression levels were higher under vanillin treatment than in the control, with most showing an upregulation trend over time. Antioxidant genes (HuSOD, HuAPX, HuCAT) were strongly induced. HuSOD expression peaked at 3.36-fold the control on 6 d and remained elevated thereafter (Figure 4B, p < 0.01). HuAPX reached 1.63-fold at 6 d before slightly declining (Figure 4C, p < 0.05). HuCAT exhibited a decline–increase pattern but maintained higher expression from 6 to 10 d, reaching 2.17-fold the control on 10 d (Figure 4D, p < 0.01). Vanillin treatment also promoted early activation of defense signaling genes (HuTGA1, HuNPR1, HuNPR5-1), which peaked at 4 d and were 6.78, 1.57, and 3.8-fold higher than the control, respectively (Figure 4A,E,F, p < 0.01). Pathogenesis-related genes (HuPR1, HuPR5) remained upregulated throughout storage; HuPR1 reached its maximum on 10 d (55.17% higher), while HuPR5 peaked on 8 d (61.09% higher) (Figure 4G,H, p < 0.05). Furthermore, vanillin treatment enhanced secondary metabolism-related genes (HuPAL, HuPPO, HuCHI). On 4 d, HuCHI and HuPAL were 2.93 and 4.93-fold higher than the control, and HuPPO was 1.61-fold higher on 10 d (Figure 4I–K, p < 0.01). Hu4CL and HuC4H were also induced, peaking on 4 and 10 d, respectively, both about 43.21% above the control (Figure 4L,M, p < 0.01). Overall, vanillin treatment upregulated multiple antioxidant (HuSOD, HuCAT, HuAPX) and defense-related (HuNPR1, HuPR5, HuPAL, HuCHI) genes, strengthening fruit antioxidant capacity and resistance, thus delaying quality deterioration.

3.4. Correlation Analysis Between Postharvest Disease Resistance, Antioxidant Traits, and TGA-NPR Interaction

Pearson correlation analysis was conducted to explore the relationship between postharvest resistance, antioxidant traits, and the TGA–NPR pathway (Figure 5). Significant positive correlations were observed among most antioxidant and defense-related parameters, especially between HuTGA1 and NPR signaling genes. HuTGA1 expression was positively correlated with HuNPR1, HuNPR5-1, and the downstream gene HuPR1, suggesting coordinated regulation of defense responses. It was also positively associated with phenylpropanoid pathway genes (HuPAL, HuC4H), implying a role in secondary metabolite synthesis. Antioxidant genes (HuSOD, HuCAT) were positively correlated with SOD and POD enzyme activities, indicating transcriptional control of enhanced antioxidant capacity under vanillin treatment. Similarly, defense-related enzyme activities (PAL, PPO, CHI) were positively correlated with HuTGA1 expression (p < 0.05). These correlation analyses revealed a close association of HuTGA1 with multiple antioxidant and defense-related traits, supporting its functional role as a key regulatory factor in postharvest resistance. The results provide insight into the molecular mechanisms underlying the enhanced disease resistance and antioxidant capacity of pitaya fruit treated with vanillin.

3.5. Phylogenetic, Motif, and Subcellular Localization Analysis of the HuTGA1 Gene

HuTGA1 was selected for in-depth characterization due to its pronounced differential expression, suggesting a potential involvement in the regulation of fruit quality and disease resistance. Phylogenetic analysis demonstrated that HuTGA1 shares a high degree of sequence similarity with TGA transcription factors from Arabidopsis thaliana, melon, and strawberry (Figure 6A,D). Motif analysis further revealed that several members of the HuTGA family, including HuTGA1, contain multiple conserved domains critical for DNA binding and transcriptional regulation (Figure 6B). Consistent with these findings, amino acid sequence alignment confirmed the conservation of these motifs, underscoring their potential functional significance (Figure 6C). Subcellular localization analysis was performed to further elucidate the function of HuTGA1. The control vector (35S::GFP) exhibited green fluorescence distributed throughout both the cytoplasm and nucleus of tobacco leaf cells, whereas the HuTGA1–GFP fusion protein displayed fluorescence exclusively within the nucleus (Figure 6E). These observations indicate that HuTGA1 is a nuclear-localized protein, consistent with the characteristic localization pattern of transcription factors.

3.6. HuTGA1 Positively Regulates HuNPR Genes to Enhance Disease Resistance in Pitaya Fruit

To test whether HuNPR genes are direct transcriptional targets of HuTGA1, cis-element prediction identified two and one putative TGA-binding motifs in the promoters of HuNPR1 and HuNPR5-1, respectively (Figure 7B), suggesting potential direct binding. Y1H assays confirmed this interaction: co-transformation of pHis-HuNPR5-1pro + HuTGA1-AD enabled growth on SD-His/Trp/Leu + 3-AT100 medium, while pHis-HuNPR1pro + HuTGA1-AD grew on SD-His/Trp/Leu + 3-AT210 (Figure 7A,D). No growth occurred in negative controls, verifying the specificity of the interaction.
Dual-luciferase reporter (DLR) assays in Nicotiana benthamiana leaves further supported transcriptional activation. Co-expression of HuTGA1 with HuNPR1pro or HuNPR5-1pro enhanced LUC/REN ratios by 2.53 and 2.22-fold, respectively (Figure 7C,E), confirming that HuTGA1 functions as a positive regulator of HuNPR1 and HuNPR5-1 expression.
Functional overexpression (OE-TGA1) in pitaya further validated its role. Compared with the control, OE-TGA1 fruits exhibited reduced lesion areas by 60.46% and 51.21% at 4 and 8 d post-inoculation, respectively (Figure 8B, p < 0.05). ROS analysis showed that H2O2 contents in OE-TGA1 fruits were 0.71- and 0.79-fold of those in the control at 4 d and 8 d, respectively, while O2•− production rates decreased by 8.93% and 11.13%, respectively (Figure 8C,D, p < 0.05). Expression profiling revealed that HuTGA1 overexpression upregulated key defense genes: HuTGA1 transcripts were 2.47 and 1.61-fold higher than the control at 4 and 8 d; HuNPR1 and HuNPR5-1 increased 1.89 and 1.95-fold, and HuPR1 reached 2.97-fold at 8 d (Figure 8E–H, p < 0.01).

4. Discussion

Developing safe, effective methods to control postharvest diseases like F. oxysporum-induced soft rot remains a key challenge in pitaya research. Our study shows that vanillin treatment significantly inhibits this disease, reducing disease index, lesion area and weight loss, while improving fruit firmness, titratable acidity, soluble solids, ascorbic acid content and DPPH radical scavenging activity. These findings are consistent with previous studies in tomato and citrus fruits [32,33]. Moreover, previous studies have demonstrated that vanillin exhibits synergistic effects when combined with other natural compounds, such as chitosan or taurine, enhancing its preservative and antioxidant properties [33,34]. In addition, the transient increase in TSS observed in the control treatment is most likely due to dehydration-induced concentration effects, followed by senescence-associated and pathogen colonization consumption processes.
Vanillin’s preservative mechanisms involve activating antioxidant systems and pathogenesis-related enzymatic pathways. Our results show that vanillin treatment elevates the activities of antioxidant enzymes (SOD, POD, CAT), thus maintaining ROS homeostasis. Enhanced ROS scavenging alleviated lipid peroxidation, as confirmed by reduced MDA accumulation. Amid oxidative stress and pathogen invasion, sustained high enzyme activities preserved fruit quality and inhibited pathogen growth. These results are consistent with previous studies [10,13]. Evidence also indicates that fruit defense responses to biotic/abiotic stress involve a complex interplay of antioxidant regulation, dynamic cellular changes, and associated defense mechanisms. At low concentrations, ROS can stimulate pathogenesis-related protein synthesis and promote cell wall cross-linking and lignification, thereby enhancing fungal resistance. However, excessive ROS accumulation—beyond scavenging capacity—induces oxidative damage, accelerates senescence, and impairs fruit quality and disease resistance [6,35]. Furthermore, SOD catalyzes the conversion of O2•− to H2O2, which is further decomposed into water by CAT and POD, thus mitigating oxidative stress. Moreover, coordinated PPO and POD activity promotes polyphenol polymerization into lignin and the formation of hydroxyproline-rich glycoproteins (HRGPs), creating a structural barrier that enhances fruit resistance to invading pathogens [22,36]. Multiple studies have demonstrated that exogenous treatments can effectively activate the antioxidant system, thereby delaying senescence and enhancing disease resistance in fruits. For instance, Du et al. [37] reported that Artemisia annua extract significantly increased the activities of SOD, POD, and CAT in pepper, while reducing H2O2 and MDA levels, thereby mitigating oxidative damage. Similarly, glycine betaine (GB) treatment elevated the activities of antioxidant enzymes, including SOD, CAT, APX, and POD, reducing ROS accumulation and preserving postharvest blueberry quality [38]. In litchi, application of a vanillin–taurine Schiff base (VTSB) not only delayed pericarp browning and weight loss but also lowered MDA content and electrolyte leakage, while maintaining higher levels of anthocyanins, TP, and antioxidant enzyme activities [39].
Moreover, vanillin treatment also activates the phenylpropanoid pathway, which was supported by the increased biosynthesis of antimicrobial compounds such as TP and TF [4,40]. Additionally, vanillin-induced upregulation of PPO and POD activities further promotes TP and TF oxidation and polymerization, enhancing lignin deposition and phenolic cross-linking to restrict pathogen penetration and slow lesion expansion. GLU and CHI hydrolyze major components of fungal cell walls, playing essential roles in defending against pathogen invasion [4,41]. Previous studies have shown that increased PAL, GLU, and CHI activities, along with the accumulation of phenolics and flavonoids, effectively enhance blueberry resistance to Botrytis cinerea [41]. This study shows that vanillin treatment significantly increases the activities of antioxidant enzymes (SOD, POD, CAT) and defense-related enzymes (PPO, GLU, PAL, CHI), along with the expression of their corresponding genes. Moreover, vanillin markedly promotes the accumulation of secondary metabolites (total phenolics, flavonoids), further boosting fruit antioxidant and defense capacity. These findings indicate that vanillin mitigates ROS accumulation and enhances pitaya resistance to pathogens by activating antioxidant and pathogenesis-related enzymatic pathways, thereby reducing postharvest soft rot incidence. Similarly, Chen et al. [42] reported that GABA treatment significantly upregulated the expression of phenylpropanoid metabolism-related genes (PAL, C4H, 4CL) and their enzymatic activities, while also boosting POD and PPO activities, thereby strengthening mango resistance to Colletotrichum gloeosporioides.
SA is a key mediator of plant immune responses, inducing systemic acquired resistance (SAR) and boosting disease resistance. NPR1, the primary SA receptor, is indispensable for SAR activation. TGA transcription factors—core regulators of the SA signaling cascade—coordinate plant stress and immune responses. Studies on kiwifruit and strawberry show that TGA genes respond to hormonal signals and pathogen infection, and their overexpression enhances disease resistance [39]. These findings highlight the critical role of TGA transcriptional activation in enhancing plant disease resistance. Our results show that vanillin treatment upregulates SA signaling-related defense genes (HuTGA1, HuNPR1, HuNPR5-1). HuTGA1, a nuclear-localized transcriptional activator, directly binds to and activates the promoters of HuNPR1 and HuNPR5-1, establishing a regulatory link between HuTGA1 and NPR genes. This mechanism aligns with previous studies demonstrating TGA transcription factors’ crucial role in plant immune response regulation [43,44]. Overall, our findings strongly demonstrate that vanillin enhances pitaya’s disease resistance and antioxidant capacity by activating the HuTGA1-NPR module, which regulates defense gene expression and activates antioxidant and pathogenesis-related enzymatic pathways (Figure 9). These results provide valuable insights for developing safe, effective strategies to control pitaya postharvest diseases.

5. Conclusions

In conclusion, vanillin treatment reduces soft rot and delays postharvest deterioration in pitaya by boosting antioxidant capacity, activating defense-related enzymes, and accumulating phenolics and flavonoids. HuTGA1, a vanillin-inducible transcriptional activator, regulates fruit defense responses by activating HuNPR1 and HuNPR5-1; its overexpression enhances ROS scavenging and upregulates defense genes. These findings indicate that vanillin enhances pitaya systemic resistance via the HuTGA1-HuNPR signaling module. Future research should focus on developing combined vanillin-based preservation systems with other substances or technologies and extending their application to postharvest storage of diverse fruits including pitaya.

Author Contributions

Conceptualization, J.X. and R.L.; methodology, J.X., Y.H. and X.L.; software, J.L.; validation, J.X., Y.H. and X.L.; formal analysis, J.X. and J.L.; investigation, J.X. and Y.H.; data curation, J.X. and X.L.; writing—original draft, J.X., X.L. and R.L.; writing—review and editing, M.M.A. and W.L.; visualization, J.X. and J.L.; supervision, R.L. and W.L.; project administration, R.L.; funding acquisition, R.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of China Youth Program (Grant No. 32302169), Natural Science Foundation of Hainan Province (Grant No. 324RC462), and the Open Fund of the Key Laboratory for Quality Regulation of Tropical Horticultural Crops of Hainan Province (HNZDSYS(2025)-10).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gu, J.; Zhu, Q.; Du, J.; Guo, J.; Wu, Y.; Yang, S.; Jiang, J. Enhancement of Nutritional and Flavor Properties of Red-Fleshed Pitaya Juice via Lacticaseibacillus paracasei Fermentation. Food Chem. 2025, 30, 102915. [Google Scholar] [CrossRef] [PubMed]
  2. Sarkar, P.C.; Pranta, G.K.; Mojumdar, M.U.; Mahmud, A.; Noori, S.R.H.; Chakraborty, N.R. UDCAD-DFL-DL: A Unique Dataset for Classifying and Detecting Agricultural Diseases in Dragon Fruits and Leaves. Data Brief 2025, 59, 111411. [Google Scholar] [CrossRef]
  3. Ali, A.; Zahid, N.; Manickam, S.; Siddiqui, Y.; Alderson, P.G.; Maqbool, M. Effectiveness of Submicron Chitosan Dispersions in Controlling Anthracnose and Maintaining Quality of Dragon Fruit. Postharvest Biol. Technol. 2013, 86, 147–153. [Google Scholar] [CrossRef]
  4. Hu, M.; Zhu, Y.; Liu, G.; Gao, Z.; Li, M.; Su, Z.; Zhang, Z. Inhibition on Anthracnose and Induction of Defense Response by Nitric Oxide in Pitaya Fruit. Sci. Hortic. 2019, 245, 224–230. [Google Scholar] [CrossRef]
  5. Xu, Y.; Cai, Z.; Ba, L.; Qin, Y.; Su, X.; Luo, D.; Shan, W.; Kuang, J.; Lu, W.; Li, L.; et al. Maintenance of Postharvest Quality and Reactive Oxygen Species Homeostasis of Pitaya Fruit by Essential Oil P-Anisaldehyde Treatment. Foods 2021, 10, 2434. [Google Scholar] [CrossRef] [PubMed]
  6. Ding, X.; Zhu, X.; Zheng, W.; Li, F.; Xiao, S.; Duan, X. BTH Treatment Delays the Senescence of Postharvest Pitaya Fruit in Relation to Enhancing Antioxidant System and Phenylpropanoid Pathway. Foods 2021, 10, 846. [Google Scholar] [CrossRef]
  7. Freitas, S.T.D.; Mitcham, E.J. Quality of Pitaya Fruit (Hylocereus undatus) as Influenced by Storage Temperature and Packaging. Sci. Agric. 2013, 70, 257–262. [Google Scholar] [CrossRef]
  8. Li, R.; Liu, Z.; Guo, J.; Xu, W.; Ning, X.; Li, X.; He, M.; Liu, Q. Active Chitosan Films Crosslinked by Vanillin-Derived Dialdehyde for Effective Fruit Preservation. Food Hydrocoll. 2025, 164, 111147. [Google Scholar] [CrossRef]
  9. Jing, J.; Zhang, H.; Xue, Y.; Zeng, K. Effects of INA on Postharvest Blue and Green Molds and Anthracnose Decay in Citrus Fruit. J. Integr. Agric. 2020, 19, 1396–1406. [Google Scholar] [CrossRef]
  10. Wang, X.; Zhang, X.; Sun, M.; Wang, L.; Zou, Y.; Fu, L.; Han, C.; Li, A.; Li, L.; Zhu, C. Impact of Vanillin on Postharvest Disease Control of Apple. Front. Microbiol. 2022, 13, 979737. [Google Scholar] [CrossRef]
  11. Yang, J.; Chen, Y.-Z.; Yu-Xuan, W.; Tao, L.; Zhang, Y.-D.; Wang, S.-R.; Zhang, G.-C.; Zhang, J. Inhibitory Effects and Mechanisms of Vanillin on Gray Mold and Black Rot of Cherry Tomatoes. Pestic. Biochem. Physiol. 2021, 175, 104859. [Google Scholar] [CrossRef]
  12. Safari, Z.S.; Ding, P.; Nakasha, J.J.; Yusoff, S.F. Controlling Fusarium oxysporum Tomato Fruit Rot under Tropical Condition Using Both Chitosan and Vanillin. Coatings 2021, 11, 367. [Google Scholar] [CrossRef]
  13. Sangsuwan, J.; Sutthasupa, S. Effect of Chitosan and Alginate Beads Incorporated with Lavender, Clove Essential Oils, and Vanillin against Botrytis Cinerea and Their Application in Fresh Table Grapes Packaging System. Packag. Technol. Sci. 2019, 32, 595–605. [Google Scholar] [CrossRef]
  14. Han, Q.; Tan, W.; Zhao, Y.; Yang, F.; Yao, X.; Lin, H.; Zhang, D. Salicylic Acid-activated BIN2 Phosphorylation of TGA3 Promotes Arabidopsis PR Gene Expression and Disease Resistance. EMBO J. 2022, 41, e110682. [Google Scholar] [CrossRef]
  15. Tian, M.; Dai, Y.; Noman, M.; Li, R.; Li, X.; Wu, X.; Wang, H.; Song, F.; Li, D. Genome-Wide Characterization and Functional Analysis of the Melon TGA Gene Family in Disease Resistance through Ectopic Overexpression in Arabidopsis thaliana. Plant Physiol. Biochem. 2024, 212, 108784. [Google Scholar] [CrossRef] [PubMed]
  16. Lin, P.; Dong, T.; Chen, W.; Zou, N.; Chen, Y.; Li, Y.; Chen, K.; Wang, M.; Liu, J. Expression Analysis of MaTGA8 Transcription Factor in Banana and Its Defence Functional Analysis by Overexpression in Arabidopsis. Int. J. Mol. Sci. 2021, 22, 9344. [Google Scholar] [CrossRef] [PubMed]
  17. Zhao, J.-Y.; Chen, J.; Shi, Y.; Fu, H.-Y.; Huang, M.-T.; Rott, P.C.; Gao, S.-J. Sugarcane Responses to Two Strains of Xanthomonas Albilineans Differing in Pathogenicity through a Differential Modulation of Salicylic Acid and Reactive Oxygen Species. Front. Plant Sci. 2022, 13, 1087525. [Google Scholar] [CrossRef] [PubMed]
  18. Tian, T.; Yu, R.; Suo, Y.; Cheng, L.; Li, G.; Yao, D.; Song, Y.; Wang, H.; Li, X.; Gao, G. A Genome-Wide Analysis of StTGA Genes Reveals the Critical Role in Enhanced Bacterial Wilt Tolerance in Potato During Ralstonia solanacearum Infection. Front. Genet. 2022, 13, 894844. [Google Scholar] [CrossRef]
  19. Li, T.; Yuan, L.; Yin, X.; Jiang, X.; Wei, Y.; Tang, X.; Li, N.; Liu, Q. The Grapevine Transcription Factor VvTGA8 Enhances Resistance to White Rot via the Salicylic Acid Signaling Pathway in Tomato. Agron. J. 2023, 13, 3054. [Google Scholar] [CrossRef]
  20. Liu, F.; Xi, M.; Liu, T.; Wu, X.; Ju, L.; Wang, D. The Central Role of Transcription Factors in Bridging Biotic and Abiotic Stress Responses for Plants’ Resilience. New Crops 2024, 1, 100005. [Google Scholar] [CrossRef]
  21. Ge, C.; You, W.; Li, R.; Li, W.; Shao, Y. Construction of the PG-deficient Mutant of Fusarium equiseti by CRISPR/Cas9 and Its Pathogenicity of Pitaya. J. Basic Microbiol. 2021, 61, 686–696. [Google Scholar] [CrossRef]
  22. Li, G.; Meng, F.; Wei, X.; Lin, M. Postharvest Dipping Treatment with BABA Induced Resistance against Rot Caused by Gilbertella persicaria in Red Pitaya Fruit. Sci. Hortic. 2019, 257, 108713. [Google Scholar] [CrossRef]
  23. Yan, R.; Xu, Q.; Dong, J.; Kebbeh, M.; Shen, S.; Huan, C.; Zheng, X. Effects of Exogenous Melatonin on Ripening and Decay Incidence in Plums (Prunus salicina L. Cv. Taoxingli) during Storage at Room Temperature. Sci. Hortic. 2022, 292, 110655. [Google Scholar] [CrossRef]
  24. Li, R.; Sheng, J.; Shen, L. Nitric Oxide Plays an Important Role in β-Aminobutyric Acid-Induced Resistance to Botrytis cinerea in Tomato Plants. Plant Pathol. J. 2020, 36, 121–132. [Google Scholar] [CrossRef]
  25. Wang, L.; Li, R.; Shi, X.; Wei, L.; Li, W.; Shao, Y. Ripening Patterns (off-Tree and on-Tree) Affect Physiology, Quality, and Ascorbic Acid Metabolism of Mango Fruit (Cv. Guifei). Sci. Hortic. 2023, 315, 111971. [Google Scholar] [CrossRef]
  26. Xu, J.; Zheng, Y.; Peng, D.; Shao, Y.; Li, R.; Li, W. Bacillus siamensis N-1 Improves Fruit Quality and Disease Resistance by Regulating ROS Homeostasis and Defense Enzyme Activities in Pitaya. Sci. Hortic. 2024, 329, 112975. [Google Scholar] [CrossRef]
  27. Tang, J.; Chen, H.; Lin, H.; Hung, Y.-C.; Xie, H.; Chen, Y. Acidic Electrolyzed Water Treatment Delayed Fruit Disease Development of Harvested Longans through Inducing the Disease Resistance and Maintaining the ROS Metabolism Systems. Postharvest Biol. Technol. 2021, 171, 111349. [Google Scholar] [CrossRef]
  28. Yang, W.; Guo, M.; Zhang, W.; Cheng, S.; Chen, G. Methyl salicylate and methyl jasmonate induce resistance to Alternaria tenuissima by regulating the phenylpropane metabolism pathway of winter jujube. Postharvest Biol. Technol. 2023, 204, 112440. [Google Scholar] [CrossRef]
  29. Yang, B.; Wang, J.; Zhao, M.; Liu, Y.; Wang, W.; Jiang, Y. Identification of Polysaccharides from Pericarp Tissues of Litchi (Litchi chinensis Sonn.) Fruit in Relation to Their Antioxidant Activities. Carbohydr. Res. 2006, 341, 634–638. [Google Scholar] [CrossRef]
  30. Yun, Z.; Gao, H.; Chen, X.; Chen, Z.; Zhang, Z.; Li, T.; Qu, H.; Jiang, Y. Effects of Hydrogen Water Treatment on Antioxidant System of Litchi Fruit during the Pericarp Browning. Food Chem. 2021, 336, 127618. [Google Scholar] [CrossRef]
  31. Wang, X.; Dou, Y.; Wang, Y.; Guo, P.; Gao, Y.; Li, J.; Shao, Y.; Li, W. Ethylene-Induced Postharvest ‘Guifei’ Mango Peel Coloration: Activation of the MiPAL1 Promoter by MiERF5 and the MiERF5-MiMYB7 Complex. Postharvest Biol. Technol. 2026, 232, 113999. [Google Scholar] [CrossRef]
  32. Konuk Takma, D.; Korel, F. Enhancement of Post-Harvest Quality of Fresh Mandarins with Alginate-Based Edible Coating Containing Natamycin and Vanillin. Appl. Fruit Sci. 2024, 66, 1921–1928. [Google Scholar] [CrossRef]
  33. Safari, Z.S.; Ding, P.; Juju Nakasha, J.; Yusoff, S.F. Combining Chitosan and Vanillin to Retain Postharvest Quality of Tomato Fruit during Ambient Temperature Storage. Coatings 2020, 10, 1222. [Google Scholar] [CrossRef]
  34. Javed, H.U.; Liu, R.; Li, C.; Zhong, S.; Lai, J.; Hasan, M.; Shu, X.; Zeng, L.-Y. Preparation of Vanillin-Taurine Antioxidant Compound, Characterization, and Evaluation for Improving the Post-Harvest Quality of Litchi. Antioxidants 2023, 12, 618. [Google Scholar] [CrossRef]
  35. Tian, S.; Qin, G.; Li, B. Reactive Oxygen Species Involved in Regulating Fruit Senescence and Fungal Pathogenicity. Plant Mol. Biol. 2013, 82, 593–602. [Google Scholar] [CrossRef]
  36. Sofo, A.; Dichio, B.; Xiloyannis, C.; Masia, A. Effects of Different Irradiance Levels on Some Antioxidant Enzymes and on Malondialdehyde Content during Rewatering in Olive Tree. Plant Sci. 2004, 166, 293–302. [Google Scholar] [CrossRef]
  37. Du, T.; Zhu, W.; Zhang, C.; Liang, X.; Shu, Y.; Zhou, J.; Zhang, M.; He, Y.; Tu, J.; Feng, Y. Bacteriostatic Activity and Resistance Mechanism of Artemisia Annua Extract Against Ralstonia solanacearum in Pepper. Plants 2025, 14, 651. [Google Scholar] [CrossRef] [PubMed]
  38. Zhang, Y.; Kou, X.; Zhang, G.; Luo, D.; Cao, S. Exogenous Glycine Betaine Maintains Postharvest Blueberry Quality by Modulating Antioxidant Capacity and Energy Metabolism. LWT 2024, 212, 116976. [Google Scholar] [CrossRef]
  39. Hou, S.; Tsuda, K. Salicylic Acid and Jasmonic Acid Crosstalk in Plant Immunity. Essays Biochem. 2022, 66, 647–656. [Google Scholar] [PubMed]
  40. Zhang, S.; Wang, Q.; Guo, Y.; Kang, L.; Yu, Y. Carbon Monoxide Enhances the Resistance of Jujube Fruit against Postharvest Alternaria Rot. Postharvest Biol. Technol. 2020, 168, 111268. [Google Scholar] [CrossRef]
  41. Wang, H.; Kou, X.; Wu, C.; Fan, G.; Li, T. Methyl Jasmonate Induces the Resistance of Postharvest Blueberry to Gray Mold Caused by Botrytis cinerea. J. Sci. Food Agric. 2020, 100, 4272–4281. [Google Scholar] [CrossRef]
  42. Chen, Y.; Gong, D.; Li, M.; Gao, Z.; Sun, J.; Yang, Y.; Zhang, H.; Pan, Y.; Zhang, Z.; Hu, M. γ-Aminobutyric Acid Enhances Resistance in Postharvest Mango Fruits to Colletotrichum gloeosporioides by Activating Related Defense Mechanisms. Physiol. Mol. Plant Pathol. 2024, 134, 102422. [Google Scholar] [CrossRef]
  43. Feng, J.; Cheng, Y.; Zheng, C. Expression Patterns of Octoploid Strawberry TGA Genes Reveal a Potential Role in Response to Podosphaera aphanis Infection. Plant Biotechnol. J. Rep. 2020, 14, 55–67. [Google Scholar] [CrossRef]
  44. Liu, W.; Zhao, C.; Liu, L.; Huang, D.; Ma, C.; Li, R.; Huang, L. Genome-Wide Identification of the TGA Gene Family in Kiwifruit (Actinidia chinensis spp.) and Revealing Its Roles in Response to Pseudomonas syringae Pv. Actinidiae (Psa) Infection. Int. J. Biol. Macromol. 2022, 222, 101–113. [Google Scholar] [CrossRef] [PubMed]
Foods 15 00153 g001
Figure 1. Effects of vanillin treatment on pathogenicity during pitaya storage. Changes in fruit appearance (A), decay index (B) and area of lesion (C) of pitaya fruit after inoculation at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (** p < 0.01).
Figure 1. Effects of vanillin treatment on pathogenicity during pitaya storage. Changes in fruit appearance (A), decay index (B) and area of lesion (C) of pitaya fruit after inoculation at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (** p < 0.01).
Foods 15 00153 g001
Foods 15 00153 g002
Figure 2. Effects of vanillin treatment on quality attributes of pitaya fruit during storage. Changes in weight loss (A) and contents of total soluble solids (TSS) (B), ascorbic acid (C), titratable acidity (D), malondialdehyde (MDA) (E), total phenolics (F) and flavonoids (G) of pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Figure 2. Effects of vanillin treatment on quality attributes of pitaya fruit during storage. Changes in weight loss (A) and contents of total soluble solids (TSS) (B), ascorbic acid (C), titratable acidity (D), malondialdehyde (MDA) (E), total phenolics (F) and flavonoids (G) of pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Foods 15 00153 g002
Foods 15 00153 g003
Figure 3. Effect of vanillin treatment on ROS levels and the activity of defense-related enzymes during pitaya fruit storage. Changes in H2O2 content (A), O2•− generation rate (B) and DPPH scavenging rate (C), activities of peroxidase (POD) (D), superoxide dismutase (SOD) (E), catalase (CAT) (F), phenylalanine ammonia-lyase (PAL) (G), polyphenol oxidase (PPO) (H), chitinase (CHI) (I) and β-1,3-glucanase (GLU) activity (J) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Figure 3. Effect of vanillin treatment on ROS levels and the activity of defense-related enzymes during pitaya fruit storage. Changes in H2O2 content (A), O2•− generation rate (B) and DPPH scavenging rate (C), activities of peroxidase (POD) (D), superoxide dismutase (SOD) (E), catalase (CAT) (F), phenylalanine ammonia-lyase (PAL) (G), polyphenol oxidase (PPO) (H), chitinase (CHI) (I) and β-1,3-glucanase (GLU) activity (J) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Foods 15 00153 g003
Foods 15 00153 g004
Figure 4. Effect of vanillin treatment on disease resistance gene expression during pitaya fruit storage. Relative expressions of HuTGA1 (A), HuSOD (B), HuAPX (C), HuCAT (D), HuNPR1 (E), HuNPR5-1 (F), HuPR1 (G), HuPR5 (H), HuPAL (I), HuPPO (J), HuCHI (K), Hu4CL (L) and HuC4H (M) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Figure 4. Effect of vanillin treatment on disease resistance gene expression during pitaya fruit storage. Relative expressions of HuTGA1 (A), HuSOD (B), HuAPX (C), HuCAT (D), HuNPR1 (E), HuNPR5-1 (F), HuPR1 (G), HuPR5 (H), HuPAL (I), HuPPO (J), HuCHI (K), Hu4CL (L) and HuC4H (M) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Foods 15 00153 g004
Foods 15 00153 g005
Figure 5. Correlation analysis between decay index, lesion area, ROS accumulation, enzyme activities and gene expressions.
Figure 5. Correlation analysis between decay index, lesion area, ROS accumulation, enzyme activities and gene expressions.
Foods 15 00153 g005
Foods 15 00153 g006
Figure 6. Phylogenetic, motif, and subcellular localization analyses of TGA transcription factors in pitaya. Phylogenetic tree of TGA transcription factors from Hylocereus undulatus britt and Arabidopsis thaliana HuTGA1 are highlighted in star (A). Motif analysis of TGA family transcription factors, showing the distribution and significance (p-value) of conserved motifs (Motifs 1 and 2) (B). Sequence logos represent the conserved amino acid sequences of each motif. Multiple sequence alignment of HuTGA family proteins, highlighting conserved motifs, and the identical amino acid regions are highlighted in yellow (C). Phylogenetic tree showing the relationship of HuTGA transcription factors with homologs from other species, highlighting the evolutionary placement of HuTGA1 (D). Subcellular localization of GFP-tagged HuTGA1 in tobacco epidermal cells. GFP fluorescence indicates nuclear localization (E). Scale bars = 10 μm.
Figure 6. Phylogenetic, motif, and subcellular localization analyses of TGA transcription factors in pitaya. Phylogenetic tree of TGA transcription factors from Hylocereus undulatus britt and Arabidopsis thaliana HuTGA1 are highlighted in star (A). Motif analysis of TGA family transcription factors, showing the distribution and significance (p-value) of conserved motifs (Motifs 1 and 2) (B). Sequence logos represent the conserved amino acid sequences of each motif. Multiple sequence alignment of HuTGA family proteins, highlighting conserved motifs, and the identical amino acid regions are highlighted in yellow (C). Phylogenetic tree showing the relationship of HuTGA transcription factors with homologs from other species, highlighting the evolutionary placement of HuTGA1 (D). Subcellular localization of GFP-tagged HuTGA1 in tobacco epidermal cells. GFP fluorescence indicates nuclear localization (E). Scale bars = 10 μm.
Foods 15 00153 g006
Foods 15 00153 g007
Figure 7. Functional analysis of HuTGA1 in regulating HuNPR1 and HuNPR5-1 expression. Constructs used in the yeast one-hybrid assay (A). Schematic representation of the HuNPR1 and HuNPR5-1 promoter, showing TGA-binding sites (B). Schematic representation of the dual-luciferase reporter assay constructs used to assess the transactivation of the HuNPR1 and HuNPR5-1 promoters by HuTGA1 (C). Y1H assay for the interaction of HuTGA1 with the as-1 motif and with promoters of HuNPR1 and HuNPR5-1 (D). Activation ability of HuTGA1 in regulating HuNPR1 and HuNPR5-1 (E). Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between two groups at the corresponding sampling point (** p < 0.01).
Figure 7. Functional analysis of HuTGA1 in regulating HuNPR1 and HuNPR5-1 expression. Constructs used in the yeast one-hybrid assay (A). Schematic representation of the HuNPR1 and HuNPR5-1 promoter, showing TGA-binding sites (B). Schematic representation of the dual-luciferase reporter assay constructs used to assess the transactivation of the HuNPR1 and HuNPR5-1 promoters by HuTGA1 (C). Y1H assay for the interaction of HuTGA1 with the as-1 motif and with promoters of HuNPR1 and HuNPR5-1 (D). Activation ability of HuTGA1 in regulating HuNPR1 and HuNPR5-1 (E). Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between two groups at the corresponding sampling point (** p < 0.01).
Foods 15 00153 g007
Foods 15 00153 g008
Figure 8. Transient overexpression of HuTGA1 in pitaya fruit. Phenotypic diagram of pitaya after infection (A). Changes in area of lesion (B), H2O2 content (C) and O2•− generation rate (D), relative expressions of HuTGA1 (E), HuNPR1 (F), HuNPR5-1 (G) and HuPR1 (H) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Figure 8. Transient overexpression of HuTGA1 in pitaya fruit. Phenotypic diagram of pitaya after infection (A). Changes in area of lesion (B), H2O2 content (C) and O2•− generation rate (D), relative expressions of HuTGA1 (E), HuNPR1 (F), HuNPR5-1 (G) and HuPR1 (H) in pitaya fruit during storage at 25 °C. Vertical bars represent the standard error of the mean, and the asterisks indicate a significant difference between the two groups at the corresponding sampling point (* p < 0.05, ** p < 0.01).
Foods 15 00153 g008
Foods 15 00153 g009
Figure 9. Proposed model illustrating the regulatory role of HuTGA1 in VA-induced disease resistance against F. oxysporum in pitaya fruit.
Figure 9. Proposed model illustrating the regulatory role of HuTGA1 in VA-induced disease resistance against F. oxysporum in pitaya fruit.
Foods 15 00153 g009
Table 1. Sequence of primers for the RT-qPCR gene of pitaya.
Table 1. Sequence of primers for the RT-qPCR gene of pitaya.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
Nonexpressor of Pathogenesis-Related genes 1 (HuNPR1)GACAGACGAAAGGAGCTTGGCCACAGCATAGTGGAGAGCA
Pathogenesis-Related protein 1 (HuPR1)GCTCGAGCTTCCCCTAGTTTGCCCAAAGCTTAACAGCATC
Pathogenesis-Related protein 5 (HuPR5)GCGGATACACTCCACCAAGTTGCAGGGAAGGGTAAGAGTG
TGACG motif-binding factor 1 (HuTGA1)CTACGAGGACTACTACAGCGTAGATGAGGTGGAAGATGG
Nonexpressor of Pathogenesis-Related genes 5-1 (HuNPR5-1)TCAAGTCTCCATCGTCCCTCAGCACCCTCATCACAT
Polyphenol Oxidase (HuPPO)TGTCAGGAGGCCAAAGAAGTCCTGCATATTCGGCTTTGAT
Chitinase (HuCHI)CAGTCCTGGTCCCAATGCTCCTTCTGCCATTTGATCGCGG
Peroxidase (HuPOD)CCATCCCAAATCGCACTATAATCGGTCCTCAGCATGAAAT
Phenylalanine Ammonia-Lyase (HuPAL)AAGGAACTTCGGCTATCCCGACTCCTCCCCAGGAGACTTC
Cinnamate 4-Hydroxylase (HuC4H)AAGTTGAAGCTCCCACCAGGCTGGCCCATCCTAAGCAACA
4-Coumarate: CoA Ligase (Hu4CL)TCTTCAAATCACGCCTCCCCGTTGGAGATGAGACAGGGGC
Catalase (HuCAT)TGCATCCAATACAGGGGAACTGTTTGGCTTGAATGCGTGGA
Superoxide Dismutase (HuSOD)ACGCTCCGAGAATCTATCCACTTTGCACGTACAGTAGGGGA
Ascorbate Peroxidase (HuAPX)AAGGAACGCAACCCTTCCAAAACCTCTGCCATGGGAAACC
Ubiquitin (HuUBQ)TGAATCATCCGACACCATTCCTCTTCTTAGCACCACC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, J.; Liu, X.; He, Y.; Li, J.; Aslam, M.M.; Li, R.; Li, W. Vanillin Activates HuTGA1-HuNPR1/5-1 Signaling to Enhance Postharvest Pitaya Resistance to Soft Rot. Foods 2026, 15, 153. https://doi.org/10.3390/foods15010153

AMA Style

Xu J, Liu X, He Y, Li J, Aslam MM, Li R, Li W. Vanillin Activates HuTGA1-HuNPR1/5-1 Signaling to Enhance Postharvest Pitaya Resistance to Soft Rot. Foods. 2026; 15(1):153. https://doi.org/10.3390/foods15010153

Chicago/Turabian Style

Xu, Jian, Xinlin Liu, Yilin He, Jinhe Li, Muhammad Muzammal Aslam, Rui Li, and Wen Li. 2026. "Vanillin Activates HuTGA1-HuNPR1/5-1 Signaling to Enhance Postharvest Pitaya Resistance to Soft Rot" Foods 15, no. 1: 153. https://doi.org/10.3390/foods15010153

APA Style

Xu, J., Liu, X., He, Y., Li, J., Aslam, M. M., Li, R., & Li, W. (2026). Vanillin Activates HuTGA1-HuNPR1/5-1 Signaling to Enhance Postharvest Pitaya Resistance to Soft Rot. Foods, 15(1), 153. https://doi.org/10.3390/foods15010153

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop