Selection of Key Genes for Apricot Kernel Oil Synthesis Based on Transcriptome Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Extraction and Sequencing of Apricot Kernel Total RNA
2.3. Splicing Assembly of Apricot Kernel Transcriptome Data
2.4. Annotation of Gene Function
2.5. Pathway Analysis of Differentially Expressed Genes
2.6. Determination of AKO Content and Fatty Acid Fractions
2.7. qRT-PCR of Candidate Genes for AKO Synthesis
3. Results
3.1. Transcriptome Data Analysis and Assembly
3.2. Visualization of Expression Differences
3.3. WGCNA and Hub Gene Selection
3.4. The AKO Content and Fatty Acid Components
3.4.1. Difference in the AKO Content
3.4.2. Differences in Fatty Acid Composition
3.5. Expression Patterns of Candidate Genes for AKO Synthesis
3.6. Correlation Analysis
4. Discussion
4.1. Patterns of Oil Accumulation and Fatty Acid Composition in AKO
4.2. Biosynthesis of Apricot Kernel Oil
4.3. Key Genes of AKO Biosynthesis
5. Conclusions
- (1)
- The oil accumulation of apricot kernel shows an ‘S’-type accumulation pattern, and the fatty acid fractions in the maturity stage are mainly oleic acid and linoleic acid, which can be converted into each other.
- (2)
- Transcriptome sequencing was analyzed to obtain 17,411 differentially expressed genes. These were screened and analyzed by WGCNA and divided into seven modules. Five Hub genes were obtained by constructing a co-expression network in the pink module.
- (3)
- The significant differential expression of three key enzymes for fatty acid synthesis (Accase, FATA, and FATB), three key enzymes for TAG synthesis (PDAT2, GPAT5, and DGAT1), and three families of transcription factors (LEC2, FUS3, and ABI3) was screened and verified.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, C.; Sun, J.; Pu, X.; Shi, X.; Cheng, W.; Wang, B. Volatile compounds analysis and biomarkers identification of four native apricot (Prunus armeniaca L.) Cultivars grown in Xinjiang region of China. Foods 2022, 11, 2297. [Google Scholar] [CrossRef] [PubMed]
- Moustafa, K.; Cross, J. Production, pomological and nutraceutical properties of apricot. J. Food Sci. Technol. 2019, 56, 12–23. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.J.; Zhang, Q.A. Valorization of the under-utilized apricot kernels protein based on the rheology and texture properties of dough. LWT-Food Sci. Technol. 2022, 169, 114019. [Google Scholar] [CrossRef]
- Maryam, A.; Fatemeh, F.; Hassan, R.; Seyed, M.M.F. Analgesic effect of apricot kernel oil on neuropathic pain in rats. Heliyon 2024, 10, e34988. [Google Scholar] [CrossRef]
- Rodrigo, M.P.; Kim, F.; Arturo, L.V.; Edward, C.Y.; Cory, L.N.; Maurice, M.M. The accumulation of oleosins determines the size of seed oil bodies in Arabidopsis. Plant Cell 2006, 18, 1961–1974. [Google Scholar] [CrossRef]
- Lim, G.H.; Singhal, R.; Kachroo, A.; Kachroo, P. Fatty acid and lipid mediated signaling in plant defense. Annu. Rev. Phytopathol. 2017, 55, 505–536. [Google Scholar] [CrossRef] [PubMed]
- Salas, J.J.; Ohlrogge, J.B. Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases. Arch. Biochem. Biophys. 2002, 403, 25–34. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Shen, W.; Kazachkov, M.; Chen, G.; Chen, Q.; Carlsson, A.S.; Stymne, S.; Weselake, R.J.; Zou, J. Metabolic interactions between the lands cycle and the Kennedy pathway of glycerolipid synthesis in Arabidopsis developing seeds. Plant Cell 2012, 24, 4652–4669. [Google Scholar] [CrossRef]
- He, Y.Q.; Wu, Y. Oil body biogenesis during Brassica napus embryogenesis. J. Integr. Plant Biol. 2009, 51, 792–799. [Google Scholar] [CrossRef]
- Deng, S.; Mai, Y.; Shui, L.; Niu, J. WRINKLED1 transcription factor orchestrates the regulation of carbon partitioning for C18:1 (oleic acid) accumulation in Siberian apricot kernel. Sci. Rep. 2019, 9, 2693. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Wang, J.; Wang, G.; Dong, F.; Nie, P.; Xue, X. Transcriptome and metabolome analysis of flavonol synthesis in apricot fruits. Front. Plant Sci. 2023, 14, 1187551. [Google Scholar] [CrossRef]
- Xu, M.; Zhou, W.; Geng, W.; Zhao, S.; Pan, Y.; Fan, G.; Zhang, S.; Wang, Y.; Liao, K. Transcriptome analysis insight into ethylene metabolism and pectinase activity of apricot (Prunus armeniaca L.) development and ripening. Sci. Rep. 2021, 11, 13569. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Zhu, X.; Bai, H.; Wang, C.; Gou, N.; Zhang, Y.; Chen, C.; Yin, M.; Wang, L.; Wu, Y.T. Comparative anatomical and transcriptomics reveal the larger cell size as a major contributor to larger fruit size in apricot. Int. J. Mol. Sci. 2023, 24, 8748. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Feng, C.; Li, W.; Qu, Z.; Zeng, M.; Xi, W. Transcriptional regulatory networks controlling taste and aroma quality of apricot (Prunus armeniaca L.) fruit during ripening. BMC Genom. 2019, 20, 45. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Gong, Q.; Ni, X.; Zhou, Y.; Gao, Z. UFGT: The key enzyme associated with the petals variegation in Japanese apricot. Front. Plant Sci. 2017, 8, 108. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, Q.; Li, W.; Zhang, S.; Xi, W. Identification of key genes and regulators associated with carotenoid metabolism in apricot (Prunus armeniaca) fruit using weighted gene coexpression network analysis. BMC Genom. 2019, 20, 876. [Google Scholar] [CrossRef]
- Niu, J.; An, J.; Wang, L.; Fang, C.; Ha, D.; Fu, C.; Qiu, L.; Yu, H.; Zhao, H.; Hou, X.; et al. Transcriptomic analysis revealed the mechanism of oil dynamic accumulation during developing Siberian apricot (Prunus sibirica L.) seed kernels for the development of woody biodiesel. Biotechnol. Biofuels 2015, 8, 29. [Google Scholar] [CrossRef]
- Dang, Y.; Li, W.; Miao, X.; Xiu, Y.; Lin, S.Z. Cloning of oleosin gene psole4 from Prunus sibirica and its regulatory function analysis for oil accumulation. Biotechnol. Bull. 2022, 38, 151–161. (In Chinese) [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Shaik, R.; Ramakrishna, W. Genes and co-expression modules common to drought and bacterial stress responses in Arabidopsis and rice. PLoS ONE 2013, 8, e77261. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Zhu, B.; Cai, J.; Li, P.; Wang, L.; Dai, H.; Qiu, L.; Yu, H.; Ha, D.; Zhao, H.; et al. Selection of reference genes for gene expression studies in siberian apricot (Prunus sibirica L.) germplasm using quantitative real-time PCR. PLoS ONE 2014, 9, e103900. [Google Scholar] [CrossRef]
- Cherif, A.O.; Aderrabba, M.; Moussa, F.; Ben, M.M. Fatty acids profile in three cultivars of Tunisian apricot oilseeds (Prunus armeniaca L.): Impact of maturity. Nat. Prod. Res. 2024, 8, 1–17. [Google Scholar] [CrossRef]
- Matthaus, B.; Özcan, M.M.; Juhaimi, A.F. Fatty acid composition and tocopherol content of the kernel oil from apricot varieties (Hasanbey, Hacihaliloglu, Kabaasi and Soganci) collected at different harvest times. Eur. Food Res. Technol. 2016, 242, 221–226. [Google Scholar] [CrossRef]
- Ma, Y.X.; Wang, S.X.; Liu, X.J.; Yu, H.Y.; Yu, D.; Li, G.T.; Wang, L.B. Oil content, fatty acid composition and biodiesel properties among natural provenances of Siberian apricot (Prunus sibirica L.) from China. GCB Bioenergy 2020, 13, 112–132. [Google Scholar] [CrossRef]
- Deng, P.; Cui, B.; Zhu, H.L.; Buangurn, P.; Zhang, D.; Li, Y.M.; Zhao, F.; Zhao, Z. Accumulation pattern of amygdalin and prunasin and its correlation with fruit and kernel agronomic characteristics during apricot (Prunus armeniaca L.) kernel development. Foods 2021, 10, 397. [Google Scholar] [CrossRef]
- Stryjecka, M.; Kiełtyka-Dadasiewicz, A.; Michalak, M.; Rachoń, L.; Głowacka, A. Chemical composition and antioxidant properties of oils from the seeds of five apricot (Prunus armeniaca L.) cultivars. J. Oleo Sci. 2019, 68, 729–738. [Google Scholar] [CrossRef]
- Kostadinović, V.S.; Catalin, M.A.; Mitrev, S.; Gulaboski, R.; Brühl, L.; Mirhosseini, H.; Silaghi-Dumitrescu, R.; Matthäus, B. Bioactive compounds and “in vitro” antioxidant activity of some traditional and non-traditional cold-pressed edible oils from Macedonia. J. Food Sci. Technol. 2018, 55, 1614–1623. [Google Scholar] [CrossRef] [PubMed]
- Kodad, O.; Socias, I.; Company, R. Variability of oil content and of major fatty acid composition in almond (Prunus amygdalus Batsch) and its relationship with kernel quality. J. Agric. Food Chem. 2008, 56, 4096–4101. [Google Scholar] [CrossRef]
- Saini, R.K.; Keum, Y.S. Omega-3 and omega-6 polyunsaturated fatty acids: Dietary sources, metabolism, and significance—A review. Life Sci. 2018, 203, 255–267. [Google Scholar] [CrossRef]
- Liu, Q.; Siloto, R.M.P.; Lehner, R.; Stone, S.J.; Weselake, R.J. Acyl-CoA: Diacylglycerol acyltransferase: Molecular biology, biochemistry and biotechnology. Prog. Lipid Res. 2012, 51, 350–377. [Google Scholar] [CrossRef] [PubMed]
- Hamid, Z.; Akbar, A.; Kamran, K.; Achakzai, J.K.; Wong, L.S.; Sadiq, M.B. Unlocking the therapeutic and antimicrobial potential of Prunus armeniaca L. Seed kernel oil. Int. J. Food Sci. 2024, 2024, 5589506. [Google Scholar] [CrossRef]
- Karaboğa, I.; Ovalı, M.A.; Yılmaz, A.; Alpaslan, M. Gastroprotective effect of apricot kernel oil in ethanol-induced gastric mucosal injury in rats. Biotech. Histochem. Off. Publ. Biol. Stain. Comm. 2018, 93, 601–607. [Google Scholar] [CrossRef] [PubMed]
- Barron, E.J.; Stumpf, P.K. Fat metabolism in higher plants. XIX. The biosynthesis of triglycerides by avocado-mesocarp enzymes. Biochim. Biophys. Acta 1962, 60, 329–337. [Google Scholar] [CrossRef] [PubMed]
- Bates, P.D.; Durrett, T.P.; Ohlrogge, J.B.; Pollard, M. Analysis of Acyl fluxes through multiple pathways of triacylglycerol synthesis in developing soybean embryos. Plant Physiol. 2009, 150, 55–72. [Google Scholar] [CrossRef]
- Fan, R.S. Cloning and Function Analysis of Genes Related to Lipid Biosynthesis in Idesia polycarpa; Northwest A&F University: Xianyang, China, 2021; (In Chinese). [Google Scholar] [CrossRef]
- Shi, S.Y.; Ding, X.N.; Wang, Z.C.; Guo, X.F.; Zhang, G.N.; Hu, Y.H.; Shi, G.A. Grain oil quality formation and metabolism-related genes difference expression of Paeonia suffruticosa cv. ’Fengdan’ grown at different altitudes. Chin. J. Appl. Ecol. 2022, 33, 29872996. (In Chinese) [Google Scholar] [CrossRef]
- Somers, D.A.; Keith, R.A.; Egli, M.A.; Marshall, L.C.; Gengenbach, J.W.; Gronwald, D.L. Wyse Gengenbach BG, Gronwald JW, Wyse DL. Expression of the Acc1 gene-encoded acetyl-coenzyme a carboxylase in developing maize (Zea mays L.) kernels. Plant Physiol. 1993, 101, 1097–1101. [Google Scholar] [CrossRef] [PubMed]
- Jing, F.; Zhao, L.; Yandeau-Nelson, M.D.; Nikolau, B.J. Two distinct domains contribute to the substrate acyl chain length selectivity of plant acyl-ACP thioesterase. Nat. Commun. 2018, 9, 860. [Google Scholar] [CrossRef] [PubMed]
- Saha, S.; Enugutti, B.; Rajakumari, S.; Rajasekharan, R. Cytosolic triacylglycerol biosynthetic pathway in oilseeds. Molecular cloning and expression of peanut cytosolic diacylglycerol acyltransferase. Plant Physiol. 2006, 141, 1533–1543. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, G.; Truksa, M.; Snyder, C.L.; Shah, S.; Weselake, R.J. Glycerol-3-phosphate acyltransferase 4 is essential for the normal development of reproductive organs and the embryo in Brassica napus. J. Exp. Bot. 2014, 65, 4201–4215. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.L.; Noyer, S.B.; Hobbs, D.H.; Kang, J.L.; Wen, Y.C.; Krachtus, D.; Hills, M.J. Expression pattern of diacylglycerol acyltransferase-1, an enzyme involved in triacylglycerol biosynthesis, in Arabidopsis thaliana. Plant Mol. Biol. 2003, 52, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Banas, A.; Dahlqvist, A.; Stahl, U.; Lenman, M.; Stymne, S. The involvement of phospholipid: Diacylglycerol acyltransferases in triacylglycerol production. Biochem. Soc. Trans. 2000, 28, 703–705. [Google Scholar] [CrossRef]
- Hyun, U.K.; Kyeong-Ryeol, L.; Young, S.G.; Jin, H.J.; Mi-Chung, S.; Jong, B.K. Endoplasmic reticulum-located pdat1-2 from castor bean enhances hydroxy fatty acid accumulation in transgenic plants. Plant Cell Physiol. 2011, 52, 983–993. [Google Scholar] [CrossRef]
Gene Name | Primer-S | Primer-A |
---|---|---|
ACCase | ATCAAGGCAACGGCAGGA | CCGCTCTCCAAAGTGAACAAC |
FATA | GGAAGAGCAACAAGTAAGTGGGT | CTATTGTTAGGCTCTGGAAAGGC |
FATB | GTCTTCCGCCAAAACTTCTCA | ATCTCCCAATAGCCCAGCAG |
PDAT2 | CAAGTGAAAGAACCTGTGAAGTATG | TCTGATGCTTTGCCTGCTTAG |
GPAT2.2 | TGGACAAACACACAGTAGAGCA | AGTAGAGGAACTTTAGAGCACCC |
GPAT3.1 | ATCCAACAAGAACCGCACG | ACACCACAAAGGGAACAAATACAC |
GPAT3.3 | TTGTGTTACTCTGGTCCTGCC | GGTTTGGTCTTGTGGGGTTA |
GPAT5 | ACCCTGACCAACCAAAAGCA | CCAAGACTATCCGAATGAAGGC |
GPAT8 | CTGACGCTGCCCGCTTAT | TGCAGTTGACCGCCACG |
DGAT1 | GATGCCGTGCCCAGTTC | AACCCTTTCGAACACATGCT |
LPAAT3 | GTTACTCTGGTCCTGCCTACTTG | TCCTTGGTTTGGTCTTGTGG |
MCAT | CTGTATCTGGTGGTGTGAAAGGA | TTCTTGGTGTTCTGATCTGTGTTG |
EAR | AGGGCATTTATCGCTGGTGT | TGTTCAGAGCAGGCACCCA |
EAR-1 | TCTCACATCTCAGCAACACAGC | TCAATAGGCAATCCTGGCAA |
LEC2 | AGTTGGAGGTGGGAGATTGC | GTGTTGGCGTCAGCGTAGTTA |
FUS3 | CCCACAATGGCAATGGATGA | AGAGTCATTTGAGAAGGTGGTGGT |
ABI3-1 | CGAGGAGTGAAGGTACGGCA | CTGAGACTGAGGAAGGTGACGAA |
ABI3-2 | GATGACGACCACCAGCAATTA | TGACCTCAGCCACTCCAAGA |
ABI3-3 | CACTTCCCTCCTCTCCCTGAT | CGCATCAACCGCCTTATCA |
Day After Flowering | Oil Content (Average ± Standard Error) | |
---|---|---|
WX-1 | SK-1 | |
17 | 0.0583 ± 0.0105 g | 0.0524 ± 0.0076 h |
24 | 0.0972 ± 0.0122 f | 0.0638 ± 0.001 gh |
31 | 0.1284 ± 0.0021 e | 0.085 ± 0.0124 fg |
38 | 0.1306 ± 0.0073 e | 0.0961 ± 0.0069 f |
45 | 0.1527 ± 0.0128 e | 0.129 ± 0.0079 e |
52 | 0.2969 ± 0.0123 d | 0.249 ± 0.012 d |
59 | 0.4616 ± 0.0115 c | 0.361 ± 0.0121 c |
66 | 0.5517 ± 0.0074 b | 0.4697 ± 0.0087 b |
73 | 0.6074 ± 0.0042 a | 0.5063 ± 0.0089 a |
80 | 0.5911 ± 0.0043 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, D.; Zhao, Z. Selection of Key Genes for Apricot Kernel Oil Synthesis Based on Transcriptome Analysis. Foods 2025, 14, 568. https://doi.org/10.3390/foods14040568
Zhang D, Zhao Z. Selection of Key Genes for Apricot Kernel Oil Synthesis Based on Transcriptome Analysis. Foods. 2025; 14(4):568. https://doi.org/10.3390/foods14040568
Chicago/Turabian StyleZhang, Dan, and Zhong Zhao. 2025. "Selection of Key Genes for Apricot Kernel Oil Synthesis Based on Transcriptome Analysis" Foods 14, no. 4: 568. https://doi.org/10.3390/foods14040568
APA StyleZhang, D., & Zhao, Z. (2025). Selection of Key Genes for Apricot Kernel Oil Synthesis Based on Transcriptome Analysis. Foods, 14(4), 568. https://doi.org/10.3390/foods14040568