Efficacy and Molecular Mechanisms of Nystatin Against Botrytis cinerea on Postharvest Table Grape
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pathogen Culture
2.2. Fruit
2.3. Reagent
2.4. In Vivo Assessment of Pathogenicity
2.5. In Vitro Inhibitory Effect of Nystatin Against B. cinerea
2.6. Cell Viability Analysis
2.7. Measurement of Malondialdehyde (MDA) Content, Electrical Conductivity, and Cellular Leakage
2.8. RNA Sequencing
2.9. RT-qPCR Analysis
2.10. Statistical Analysis
3. Results
3.1. Nystatin Effectively Suppressed the Occurrence of Gray Mold on Table Grapes
3.2. Nystatin Inhibited the Development of B. cinerea In Vitro
3.3. Nystatin Impaired the Cell Viability of B. cinerea
3.4. Nystatin Treatment Had an Impact on the Production of MDA, Electrical Conductivity, and Cellular Leakage in B. cinerea
3.5. Transcriptome Analysis of B. cinerea Following Nystatin Treatment
3.6. Application of Nystatin Down-Regulated the Expression of Genes Associated with Autophagy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mengal, H.S.; Abro, M.A.; Jatoi, G.H.; Nawab, L.; Poussio, G.B.; Ahmed, N.; Zehri, A.Q.; Ali, A. Efficacy of different fungicides, botanical extracts and bio-control agents against Cladosporium cladosporioides, the causal agent of Cladosporium rot in grapes. Acta Ecol. Sin. 2020, 40, 300–305. [Google Scholar] [CrossRef]
- Shin, M.H.; Kim, J.H.; Choi, H.W.; Keum, Y.S.; Chun, S.C. Effect of thymol and linalool fumigation on postharvest diseases of table grapes. Mycobiology 2014, 42, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Solairaj, D.; Guillaume Legrand, N.N.; Yang, Q.; Zhang, H. Isolation of pathogenic fungi causing postharvest decay in table grapes and in vivo biocontrol activity of selected yeasts against them. Physiol. Mol. Plant Pathol. 2020, 110, 101478. [Google Scholar] [CrossRef]
- Stocco, A.F.; Diaz, M.E.; Rodríguez Romera, M.C.; Mercado, L.A.; Rivero, M.L.; Ponsone, M.L. Biocontrol of postharvest Alternaria decay in table grapes from Mendoza province. Biol. Control 2019, 134, 114–122. [Google Scholar] [CrossRef]
- Tsioka, A.; Psilioti Dourmousi, K.; Poulaki, E.G.; Papoutsis, G.; Tjamos, S.E.; Gkizi, D. Biocontrol strategies against Botrytis cinerea in viticulture: Evaluating the efficacy and mode of action of selected winemaking yeast strains. Lett. Appl. Microbiol. 2024, 77, ovae026. [Google Scholar] [CrossRef]
- Jiang, L.; Dumlao, M.C.; Donald, W.A.; Steel, C.C.; Schmidtke, L.M. Rapid in-field volatile sampling for detection of Botrytis cinerea infection in wine grapes. Molecules 2023, 28, 5227. [Google Scholar] [CrossRef]
- Valverde, J.M.; Guillen, F.; Martinez-Romero, D.; Castillo, S.; Serrano, M.; Valero, D. Improvement of table grapes quality and safety by the combination of modified atmosphere packaging (MAP) and eugenol, menthol, or thymol. J. Agric. Food Chem. 2005, 53, 7458–7464. [Google Scholar] [CrossRef]
- Zhang, J.Q.; Meng, D.; Xia, X.S.; Sun, Y.M.; Zhao, L.N.; Zhou, X.H.; Wang, Y. Profiling the secretomes of Penicillium expansum reveals that a serine carboxypeptidase (PeSCP) is required for the fungal virulence on apple fruit. Physiol. Mol. Plant Pathol. 2022, 122, 101897. [Google Scholar] [CrossRef]
- Sholberg, P.L.; Reynolds, A.G.; Gaunce, A.P. Fumigation of table grapes with acetic acid to prevent postharvest decay. Plant Dis. 1996, 80, 1425–1428. [Google Scholar] [CrossRef]
- Chen, D.G.; Chen, T.; Chen, Y.; Zhang, Z.Q.; Li, B.Q.; Tian, S.P. Bio-source substances against postharvest diseases of fruits: Mechanisms, applications and perspectives. Postharvest Biol. Technol. 2023, 198, 112240. [Google Scholar] [CrossRef]
- Palou, L.; Ali, A.; Fallik, E.; Romanazzi, G. GRAS, plant- and animal-derived compounds as alternatives to conventional fungicides for the control of postharvest diseases of fresh horticultural produce. Postharvest Biol. Technol. 2016, 122, 41–52. [Google Scholar] [CrossRef]
- Phornphisutthimas, S.; Sudtachat, N.; Bunyoo, C.; Chotewutmontri, P.; Panijpan, B.; Thamchaipenet, A. Development of an intergeneric conjugal transfer system for rimocidin-producing Streptomyces rimosus. Lett. Appl. Microbiol. 2010, 50, 530–536. [Google Scholar] [CrossRef] [PubMed]
- Van Wezel, G.P.; Mcdowall, K.J. The regulation of the secondary metabolism of Streptomyces: New links and experimental advances. Nat. Prod. Rep. 2011, 28, 1311–1333. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.H.; Luo, D.; Shu, D.; Zhong, J.; Tan, H. Development of an intergeneric conjugal transfer system for xinaomycins-producing Streptomyces noursei Xinao-4. Int. J. Mol. Sci. 2014, 15, 12217–12230. [Google Scholar] [CrossRef]
- Zheng, X.Q.; Cheng, Q.X.; Yao, F.; Wang, X.Z.; Kong, L.X.; Cao, B.; Xu, M.; Lin, S.J.; Deng, Z.X.; Chooi, Y.H.; et al. Biosynthesis of the pyrrolidine protein synthesis inhibitor anisomycin involves novel gene ensemble and cryptic biosynthetic steps. Proc. Natl. Acad. Sci. USA 2017, 114, 4135–4140. [Google Scholar] [CrossRef]
- Shen, J.F.; Kong, L.X.; Li, Y.; Zheng, X.Q.; Wang, Q.; Yang, W.N.; Deng, Z.X.; You, D.L. A LuxR family transcriptional regulator AniF promotes the production of anisomycin and its derivatives in Streptomyces hygrospinosus var. beijingensis. Synth. Syst. Biotechno. 2019, 4, 40–48. [Google Scholar] [CrossRef]
- Zhang, K.P.; Moshsin, A.; Dai, Y.C.; Chen, Z.B.; Zhuang, Y.P.; Chu, J.; Guo, M.J. Combinatorial eEffect of ARTP mutagenesis and ribosome engineering on an industrial strain of Streptomyces albus S12 for enhanced biosynthesis of salinomycin. Front. Bioeng. Biotechnol. 2019, 7, 212. [Google Scholar] [CrossRef]
- Batuman, O.; Britt-Ugartemendia, K.; Kunwar, S.; Yilmaz, S.; Fessler, L.; Redondo, A.; Chumachenko, K.; Chakravarty, S.; Wade, T. The use and impact of antibiotics in plant agriculture: A review. Phytopathology 2024, 114, 885–909. [Google Scholar] [CrossRef]
- Cheng, Y.J.; Lee, F.W.; Tsai, Y.S.; Kuan, Y.C. Tanespimycin and rapamycin exhibit antifungal activity against Colletotrichum gloeosporioides and enhance mango resistance to anthracnose via differentially modulating heat shock response. Postharvest Biol. Technol. 2023, 204, 112474. [Google Scholar] [CrossRef]
- Ma, D.Y.; Ji, D.C.; Zhang, Z.Q.; Li, B.Q.; Qin, G.Z.; Xu, Y.; Chen, T.; Tian, S.P. Efficacy of rapamycin in modulating autophagic activity of Botrytis cinerea for controlling gray mold. Postharvest Biol. Technol. 2019, 150, 158–165. [Google Scholar] [CrossRef]
- He, C.; Zhang, Z.Q.; Li, B.Q.; Xu, Y.; Tian, S.P. Effect of natamycin on Botrytis cinerea and Penicillium expansum—Postharvest pathogens of grape berries and jujube fruit. Postharvest Biol. Technol. 2019, 151, 134–141. [Google Scholar] [CrossRef]
- Zhao, Y.; Qin, X.J.; Wang, Z.J.; Jin, Q.; Wang, X.N.; Chen, S.S.; Luo, X.D. Amphotericin B and 5-flucytosine as fungicides against Penicillium italicum for citrus fruit rot. Postharvest Biol. Technol. 2022, 193, 112058. [Google Scholar] [CrossRef]
- Kim, J.D.; Kang, J.E.; Kim, B.S. Postharvest disease control efficacy of the polyene macrolide lucensomycin produced by Streptomyces plumbeus strain CA5 against gray mold on grapes. Postharvest Biol. Technol. 2020, 162, 111115. [Google Scholar] [CrossRef]
- Arikan, S.; Ostrosky-Zeichner, L.; Lozano-Chiu, M.; Paetznick, V.; Gordon, D.; Wallace, T.; Rex, J.H. In vitro activity of nystatin compared with those of liposomal nystatin, amphotericin B, and fluconazole against clinical Candida isolates. J. Clin. Microbiol. 2002, 40, 1406–1412. [Google Scholar] [CrossRef] [PubMed]
- Meade, R.H. Drug therapy reviews: Clinical pharmacology and therapeutic use of antimycotic drugs. Am. J. Pharm. 1979, 36, 1326–1334. [Google Scholar] [CrossRef]
- Jayawardena-Thabrew, H.; Warris, A.; The PASOAP Group; Ferreras-Antolin, L. Nystatin is commonly prescribed as prophylaxis in children beyond the neonatal age. Med. Mycol. 2023, 61, myac097. [Google Scholar] [CrossRef]
- Semis, R.; Nahmias, M.; Lev, S.; Frenkel, M.; Segal, E. Evaluation of antifungal combinations of nystatin-intralipid against Aspergillus terreus using checkerboard and disk diffusion methods. J. Mycol. Med. 2015, 25, 63–70. [Google Scholar] [CrossRef]
- Kim, H.J.; Son, J.S.; Kwon, T.Y. Antifungal effect of a dental tissue conditioner containing nystatin-loaded alginate microparticles. J. Nanosci. Nanotechnol. 2018, 18, 848–852. [Google Scholar] [CrossRef]
- Balef, S.S.H.; Hosseini, S.S.; Asgari, N.; Sohrabi, A.; Mortazavi, N. The inhibitory effects of carvacrol, nystatin, and their combination on oral candidiasis isolates. BMC Res. Notes 2024, 17, 104. [Google Scholar] [CrossRef]
- Powell, L.C.; Adams, J.Y.M.; Quoraishi, S.; Py, C.; Oger, A.; Gazze, S.A.; Francis, L.W.; von Ruhland, C.; Owens, D.; Rye, P.D.; et al. Alginate oligosaccharides enhance the antifungal activity of nystatin against candidal biofilms. Front. Cell Infect. Microbiol. 2023, 13, 1122340. [Google Scholar] [CrossRef]
- Amselem, J.; Cuomo, C.A.; van Kan, J.A.L.; Viaud, M.; Benito, E.P.; Couloux, A.; Coutinho, P.M.; de Vries, R.P.; Dyer, P.S.; Fillinger, S.; et al. Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet. 2011, 7, e1002230. [Google Scholar] [CrossRef] [PubMed]
- Williamson, B.; Tudzynski, B.; Tudzynski, P.; van Kan, J.A.L. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef] [PubMed]
- Li, G.J.; Chen, Y.; Zhang, Z.Q.; Li, B.Q.; Chen, T.; Tian, S.P. 2,3-Butanedione suppresses gray mold of postharvest fruit by activating the autophagy of Botrytis cinerea. Postharvest Biol. Technol. 2022, 193, 112057. [Google Scholar] [CrossRef]
- Schumacher, J. How light affects the life of Botrytis. Fungal Genet. Biol. 2017, 106, 26–41. [Google Scholar] [CrossRef]
- Huang, X.H.; Liu, W.; Dong, F.Q.; Xu, Y.; Tian, S.P.; Chen, T. Sapindus mukorossi saponins inhibit gray mold on strawberry fruit by impairing membrane integrity and organellar homeostasis of Botrytis cinerea. Postharvest Biol. Technol. 2024, 207, 112594. [Google Scholar] [CrossRef]
- Cui, X.M.; Ma, D.Y.; Liu, X.Y.; Zhang, Z.Q.; Li, B.Q.; Xu, Y.; Chen, T.; Tian, S.P. Magnolol inhibits gray mold on postharvest fruit by inducing autophagic activity of Botrytis cinerea. Postharvest Biol. Technol. 2021, 180, 111596. [Google Scholar] [CrossRef]
- Zhang, S.; Wang, J.Y.; Sun, H.M.; Yang, J.; Zhao, J.J.; Wang, Y. Inhibitory effects of hinokitiol on the development and pathogenicity of Colletotrichum gloeosporioides. World J. Microbiol. Biotechnol. 2023, 39, 356. [Google Scholar] [CrossRef]
- Zhang, X.K.; Li, G.J.; Zhang, Z.Q.; Tian, S.P. 3-Octanol controls gray mold on postharvest fruit by inducing autophagy of Botrytis cinerea. Postharvest Biol. Technol. 2023, 205, 112525. [Google Scholar] [CrossRef]
- Sun, Y.Y.; Wang, Y.; Xu, Y.; Chen, T.; Li, B.Q.; Zhang, Z.Q.; Tian, S.P. Application and mechanism of benzyl-isothiocyanate, a natural antimicrobial agent from cruciferous vegetables, in controlling postharvest decay of strawberry. Postharvest Biol. Technol. 2021, 180, 111604. [Google Scholar] [CrossRef]
- Zhou, L.L.; Tang, R.K.; Li, X.J.; Tian, S.P.; Li, B.Q.; Qin, G.Z. N(6)-methyladenosine RNA modification regulates strawberry fruit ripening in an ABA-dependent manner. Genome Biol. 2021, 22, 168. [Google Scholar] [CrossRef]
- Woo, J.; Jung, S.; Kim, S.; Li, Y.; Chung, H.; Roubtsova, T.V.; Zhang, H.; Caseys, C.; Kliebenstein, D.; Kim, K.N.; et al. Attenuation of phytofungal pathogenicity of Ascomycota by autophagy modulators. Nat. Commun. 2024, 15, 1621. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.T.; Chang, A.N.; Han, L.T.; Guo, J.S.; Li, Y.H.; Liu, T.B. Autophagy regulates fungal virulence and sexual reproduction in Cryptococcus neoformans. Front. Cell Dev. Biol. 2020, 8, 374. [Google Scholar] [CrossRef] [PubMed]
- Gabler, G.M.; Smilanick, J.H.; Mansour, M.; Ramming, D.W.; Mackey, B.E. Correlations of morphological, anatomical and chemical features of grape berries with resistance to Botrytis cinerea. Phytopathology 2003, 93, 1263–1273. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Saito, S.; Xiao, C.L. Postharvest application of natamycin to control gray mold in table grapes. Postharvest Biol. Technol. 2024, 210, 112777. [Google Scholar] [CrossRef]
- Bolard, J. How do the polyene macrolide antibiotics affect the cellular membrane properties? Biochim. Biophys. Acta 1986, 864, 257–304. [Google Scholar] [CrossRef]
- Récamier, K.S.; Hernández-Gómez, A.; González-Damián, J.; Ortega-Blake, I. Effect of Membrane Structure on the Action of Polyenes: I. Nystatin Action in Cholesterol- and Ergosterol-Containing Membranes. J. Membr. Biol. 2010, 237, 31–40. [Google Scholar] [CrossRef]
- Song, J.X.; Zhou, J.W.; Zhang, L.; Li, R.P. Mitochondria-mediated azole drug resistance and fungal pathogenicity: Opportunities for Therapeutic Development. Microorganisms 2020, 8, 1574. [Google Scholar] [CrossRef]
- Demuyser, L.; Swinnen, E.; Fiori, A.; Herrera-Malaver, B.; Vestrepen, K.; Van Dijck, P. Mitochondrial cochaperone Mge1 is involved in regulating susceptibility to fluconazole in Saccharomyces cerevisiae and Candida species. mBio 2017, 8, e00201-17. [Google Scholar] [CrossRef]
- Tian, S.P.; Torres, R.; Ballester, A.R.; Li, B.Q.; Vilanova, L.; González-Candelas, L. Molecular aspects in pathogen-fruit interactions: Virulence and resistance. Postharvest Biol. Technol. 2016, 122, 11–21. [Google Scholar] [CrossRef]
- Li, H.; Tian, S.P.; Qin, G.Z. NADPH oxidase is crucial for the cellular redox homeostasis in fungal pathogen Botrytis cinerea. Mol. Plant Microb. Interact. 2019, 32, 1508–1516. [Google Scholar] [CrossRef]
- Dou, Y.; Dhanasekaran, S.; Ngea, G.L.N.; Yang, Q.Y.; Zhang, X.Y.; Zhao, L.N.; Wang, K.L.; Zhang, H.Y. Transcriptome analysis provides insights into potential mechanisms of epsilon-poly-L-lysine inhibiting Penicillium expansum invading apples. Postharvest Biol. Technol. 2024, 207, 112622. [Google Scholar] [CrossRef]
- Zhou, T.; Pan, J.J.; Wang, J.J.; Yu, Q.R.; Zhang, P.C.; Lai, T.F. Inhibitory properties of cinnamon bark oil against postharvest pathogen Penicillium digitatum in vitro. J. Fungi 2024, 10, 249. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Q.; Wu, X.X.; Lu, Y.Q.; Fu, H.M.; Liu, S.Q.; Zhao, J.; Long, C.A. Ferric chloride controls citrus anthracnose by inducing the autophagy activity of Colletotrichum gloeosporioides. J. Fungi 2023, 9, 230. [Google Scholar] [CrossRef]
- Gutierrez-Gongora, D.; Geddes-McAlister, J. Peptidases: Promising antifungal targets of the human fungal pathogen, Cryptococcus neoformans. Facets 2022, 7, 319–342. [Google Scholar] [CrossRef]
- Levin, E.; Kishore, A.; Ballester, A.R.; Raphael, G.; Feigenberg, O.; Liu, Y.; Norelli, J.; Gonzalez-Candelas, L.; Wisniewski, M.; Droby, S.; et al. Identification of pathogenicity-related genes and the role of a subtilisin-related peptidase S8 (PePRT) in authophagy and virulence of Penicillium expansum on apples. Postharvest Biol. Technol. 2019, 149, 209–220. [Google Scholar] [CrossRef]
- Samanovic, M.I.; Darwin, K.H. Game of ’somes: Protein destruction for Mycobacterium tuberculosis pathogenesis. Trends Microbiol. 2016, 24, 26–34. [Google Scholar] [CrossRef]
- Liu, T.B.; Xue, C. The ubiquitin-proteasome system and F-box proteins in pathogenic fungi. Mycobiology 2011, 39, 243–248. [Google Scholar] [CrossRef]
- Lecker, S.H.; Goldberg, A.L.; Mitch, W.E. Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J. Am. Soc. Nephrol. 2006, 17, 1807–1819. [Google Scholar] [CrossRef]
- Han, L.T.; Wu, Y.J.; Liu, T.B. The F-box protein Fbp1 regulates virulence of Cryptococcus neoformans through the putative zinc-binding protein Zbp1. Front. Cell. Infect. Microbiol. 2021, 11, 794661. [Google Scholar] [CrossRef]
- Miguel-Rojas, C.; Hera, C. The F-box protein Fbp1 functions in the invasive growth and cell wall integrity mitogen-activated protein kinase (MAPK) pathways in Fusarium oxysporum. Mol. Plant Pathol. 2016, 17, 55–64. [Google Scholar] [CrossRef]
- Liu, T.B.; Xue, C. Fbp1-mediated ubiquitin-proteasome pathway controls Cryptococcus neoformans virulence by regulating fungal intracellular growth in macrophages. Infect. Immun. 2014, 82, 557–568. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.J.; Xue, C.Y. More than just cleaning: Ubiquitin-mediated proteolysis in fungal pathogenesis. Front. Cell. Infect. Microbiol. 2021, 11, 774613. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.J.; Wang, Y.N.; Avina, S.L.; Walter, J.; Xue, C.Y. Multiple F-box proteins collectively regulate cell development and pathogenesis in the human pathogen Cryptococcus neoformans. J. Fungi 2022, 8, 1259. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.L.; Hu, Y.L.; Yin, Z.X.; Gao, Q.R.; Zhang, Y.Q.; Chan, F.Y. Zeng, G.S.; Weng, L.X.; Wang, L.H.; Wang, Y. Candida albicans ubiquitin and hHeat shock factor-type transcriptional factors are involved in 2-dodecenoic acid-mediated inhibition of hyphal growth. Microorganisms 2020, 8, 75. [Google Scholar] [CrossRef]
- Yang, M.; Ismayil, A.; Liu, Y.L. Autophagy in plant-virus interactions. Annu. Rev. Virol. 2020, 7, 403–419. [Google Scholar] [CrossRef]
- Liu, X.H.; Xu, F.; Snyder, J.H.; Shi, H.B. Lu, J.P.; Lin, F.C. Autophagy in plant pathogenic fungi. Semin. Cell Dev. Biol. 2016, 57, 128–137. [Google Scholar] [CrossRef]
- Zhang, H.H.; Li, Y.R.; Lai, W.Y.; Huang, K.; Li, Y.L.; Wang, Z.H.; Chen, X.F.; Wang, A.R. SsATG8 and SsNBR1 mediated-autophagy is required for fungal development, proteasomal stress response and virulence in Sclerotinia sclerotiorum. Fungal Genet. Biol. 2021, 157, 103632. [Google Scholar] [CrossRef]
- Liu, N.; Lian, S.; Li, B.H.; Ren, W.C. The autophagy protein BcAtg2 regulates growth, development and pathogenicity in the gray mold fungus Botrytis cinerea. Phytopathol. Res. 2022, 4, 3. [Google Scholar] [CrossRef]
- Ren, W.C.; Liu, N.; Sang, C.W.; Shi, D.Y.; Zhou, M.G.; Chen, C.J.; Qin, Q.M.; Chen, W.C. The autophagy gene BcATG8 regulates the vegetative differentiation and pathogenicity of Botrytis cinerea. Appl. Environ. Microbiol. 2018, 84, 11. [Google Scholar] [CrossRef]
- Ren, W.C.; Zhang, Z.H.; Shao, W.Y.; Yang, Y.L.; Zhou, M.G.; Chen, C.J. The autophagy-related gene BcATG1 is involved in fungal development and pathogenesis in Botrytis cinerea. Mol. Plant Pathol. 2017, 18, 238–248. [Google Scholar] [CrossRef]
- Sumita, T.; Izumitsu, K.; Tanaka, C. A serine/threonine kinase gene BcATG1 is involved in conidiation and sclerotial development in Botrytis cinerea. Mycoscience 2016, 57, 107–117. [Google Scholar] [CrossRef]
- Saitoh, H.; Fujisawa, S.; Ito, A.; Mitsuoka, C.; Berberich, T.; Tosa, Y.; Asakura, M.; Takano, Y.; Terauchi, R. SPM1 encoding a vacuole-localized protease is required for infection-related autophagy of the rice blast fungus Magnaporthe oryzae. FEMS Microbiol. Lett. 2009, 300, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.Q.; Xie, J.T.; Fu, Y.P.; Jiang, D.H.; Chen, T.; Cheng, J.S. The subtilisin-like protease Bcser2 affects the sclerotial formation, conidiation and virulence of Botrytis cinerea. Int. J. Mol. Sci. 2020, 21, 603. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.K.; Chen, Y.; Chen, T.; Li, B.Q.; Tian, S.P. Plumbagin controls fungal postharvest pathogens by affecting metabolism and inducing autophagy. Postharvest Biol. Technol. 2024, 212, 112904. [Google Scholar] [CrossRef]
Gene Name | Primer F (5′–3′) | Primer R (5′–3′) |
---|---|---|
Bcap1 | GAGCCCACTAAACCTGGACC | CTGGGACTTCACCGTTCTCC |
Bcboa3 | TTCAGCTCGGCTCAGTCTTG | TTTGCGGATCTGGCTCTGTT |
Bcbot4 | GCTCGTCACCAAGAACCAGA | CATGAGCCGTCATCTCCTCC |
Bcser2 | GTCATCGAAGAGGTCCGCAA | TCTGTGGGAGATACGAGCCA |
Bcpks13 | GCCAAAAACCGTTGCCATCT | CAGTCCATGGAGTTGGGCAT |
Bcbrn1 | AGGATGTCACCGAGGAGGAA | ACTCCCTTAGCCTGACCAGT |
Bcscd1 | CCCAACATCTTCTCGGTGCT | GGCATGACTGTGACCCTTCA |
BcppoA90 | TATCTCCGCACAATCGTCGG | CACATTGGTTCCCGACTCCA |
Bcsod2 | ACCTTGTTGGACGGTGTTGT | CAAGCTGCTCTGGACACTGA |
Bccat2 | AAGGCAAACCCATCAAACGC | ACCGTGCCAGTATTGATGGG |
Bcpex10 | CCTGGAAGTTCCGCAGTTCT | GGAATGGGGAATAGCCGAGG |
Bcprx5 | GGCATTTGCTGAACCCATGG | CGGGTATCTCGTCAGCACTC |
BcATG2 | AGTGGATGTGCAGTTGAGGG | TCTAGCCCCTGGTTCTTCGA |
BcATG3 | ACGAAGATGGTTGGCTGAGG | CATCGTCTTCTCTCTCGCCC |
BcATG8 | ACGAGCACCCATTCGAGAAG | TGTCGATAGTGGCGATGTCG |
BcATG9 | GCGCTTCCAAAGAAAGCACA | TGGCTGCGTCATCTTGATGT |
BcATG13 | ACCACGAAGACCAAGTCGAC | ACTTGACCTTCGAGCGTGAG |
BcATG14 | GTAGACCTGAGGTTGATGAACAC | ATCTCTGCAGGCAACCGAACAG |
BcYkt6 | AATATCCAGCCCTCGTTGCC | TGAGGGTTGGGGTTGAATCG |
BcVti1 | AGACCGAAGCTCCCAGAGAT | TTGGTAGCCATCCTACGGGA |
BcVps19 | AGTAATCGAAGCGGCGGTAG | GGTTGAGTGAGTTGCCGAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Zhang, S.; Wang, J.; He, F.; Wei, H.; Chen, D.; Wang, Y. Efficacy and Molecular Mechanisms of Nystatin Against Botrytis cinerea on Postharvest Table Grape. Foods 2024, 13, 3624. https://doi.org/10.3390/foods13223624
Wu Y, Zhang S, Wang J, He F, Wei H, Chen D, Wang Y. Efficacy and Molecular Mechanisms of Nystatin Against Botrytis cinerea on Postharvest Table Grape. Foods. 2024; 13(22):3624. https://doi.org/10.3390/foods13223624
Chicago/Turabian StyleWu, Yingying, Shen Zhang, Jingyi Wang, Fan He, Haocheng Wei, Dongxiao Chen, and Ying Wang. 2024. "Efficacy and Molecular Mechanisms of Nystatin Against Botrytis cinerea on Postharvest Table Grape" Foods 13, no. 22: 3624. https://doi.org/10.3390/foods13223624
APA StyleWu, Y., Zhang, S., Wang, J., He, F., Wei, H., Chen, D., & Wang, Y. (2024). Efficacy and Molecular Mechanisms of Nystatin Against Botrytis cinerea on Postharvest Table Grape. Foods, 13(22), 3624. https://doi.org/10.3390/foods13223624