Effects of Efficient Ethylene Remover on the Lignification of Fresh Faba Bean (Vicia faba L.) during Storage
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection and Preparation
2.2. Weight Loss
2.3. Color
2.4. Hardness
2.5. Respiration Rate
2.6. Vitamin C (VC)
2.7. Lignin, Total Phenols, Flavonoids
2.8. Activities of the Phenylalanine-Ammonia-Lyase (PAL)
2.9. Activities of Cinnamyl Alcohol Dehydrogenase (CAD), Cinnamic Acid-4-Hydroxylase (4CL), Cinnamic Acid 4-Hydroxylase (C4H)
2.10. RNA Extraction and Transcriptomics Detection
2.11. Statistical Analysis
3. Results and Discussion
3.1. Physiological Indicators of Bean Pods Following Different Treatments
3.2. Inhibition of Stimulated Metabolites by HEER
3.3. Inhibition of Four Terminal Key Enzymes by HEER
3.4. Modulation of q-PCR by HEER
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bouabid, S.; Jemai, L.; Zoghlami Khélil, A. Evaluation of the breeding system of two Vicia narbonensis L. accessions from East Mediterranean region. J. Euro. Mediterr. Environ. Integr. 2019, 4, 14. [Google Scholar] [CrossRef] [Scilit]
- Sharan, S.; Zanghelini, G.; Pernin, A.; Descharles, N.; Zotzel, J.; Bonerz, D.; Aschoff, J.; Maillard, M.N.; Saint-Eve, A. Flavor of fava bean (Vicia faba L.) ingredients: Effect of processing and application conditions on odor-perception and headspace volatile chemistry. Food Res. Int. 2022, 159, 111582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Etemadi, F.; Hashemi, M.; Barker, A.V.; Zandvakili, O.R.; Liu, X. Agronomy, Nutritional Value, and Medicinal Application of Faba Bean (Vicia faba L.). Hortic. Plant J. 2019, 5, 170–182. [Google Scholar] [CrossRef] [Scilit]
- Akkad, R.; Buchko, A.; Johnston, S.P.; Han, J.; House, J.D.; Curtis, J.M. Sprouting improves the flavour quality of faba bean flours. Food Chem. 2021, 364, 130355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, M.; Zhang, J.; Tschaplinski, T.J.; Tuskan, G.A.; Chen, J.G.; Muchero, W. Regulation of Lignin Biosynthesis and Its Role in Growth-Defense Tradeoffs. Front. Plant Sci. 2018, 9, 1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, G.; Li, Z.; Zhang, X.; Wang, R.; Yangn, S. Expression Analysis of Lignin-Associated Genes in Hard End Pear (Pyrus pyrifolia Whangkeumbae) and Its Response to Calcium Chloride Treatment Conditions. J. Plant Growth Regul. 2015, 34, 251–262. [Google Scholar] [CrossRef] [Scilit]
- Ge, H.; Zhang, J.; Zhang, Y.J.; Li, X.; Yin, X.-R.; Grierson, D.; Chen, K.-S. EjNAC3 transcriptionally regulates chilling-induced lignification of loquat fruit via physical interaction with an atypical CAD-like gene. Exp. Bot. 2017, 68, 5129–5136. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Su, X.; Jin, Q.; Li, G.; Sun, Y.; Abdullah, M.; Cai, Y.; Lin, Y. iTRAQ-Based Identification of Proteins Related to Lignin Synthesis in the Pear Pollinated with Pollen from Different Varieties. Molecules 2018, 23, 548. [Google Scholar] [CrossRef] [Scilit]
- Jia, N.; Liu, J.; Tan, P.; Liu, J.; Tan, P.; Sun, Y.; Lv, Y.; Liu, J.; Sun, J.; Huang, Y.; et al. Citrus sinensis MYB Transcription Factor CsMYB85 Induce Fruit Juice Sac Lignification Through Interaction With Other CsMYB Transcription Factors. Front. Plant Sci. 2019, 10, 213. [Google Scholar] [CrossRef] [Scilit]
- Luo, Z.; Xu, X.; Yan, B. Accumulation of lignin and involvement of enzymes in bamboo shoot during storage. Eur. Food Res. Technol. 2008, 226, 635–640. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Suo, J.; Xuan, L.; Ding, M.; Zhang, H.; Song, L.; Ying, Y. Bamboo shoot-lignification delay by melatonin during low temperature storage. Postharvest Biol. Technol. 2019, 156, 110933. [Google Scholar] [CrossRef] [Scilit]
- Xie, G.; Yang, C.; Fei, Y.; Ma, L. Physiological and proteomic analyses of 1-MCP treatment on lignification in fresh common bean (Phaseolus vulgaris L) during storage. Postharvest Biol. Technol. 2020, 160, 111041. [Google Scholar] [CrossRef] [Scilit]
- Palou, L.X.; Crisosto, C.H.; Garner, D.; Basinal, L.M.l. Effect of continuous exposure to exogenous ethylene during cold storage on postharvest decay development and quality attributes of stone fruits and table grapes. Postharvest Biol. Technol. 2003, 27, 243–254. [Google Scholar] [CrossRef] [Scilit]
- Álvarez-Hernández, M.H.; Martínez-Hernández, G.B.; Avalos-Belmontes, F.; Castillo-Campohermoso, M.A.; Contreras-Esquivel, J.C.; Artés-Hernández, F. Potassium Permanganate-Based Ethylene Scavengers for Fresh Horticultural Produce as an Active Packaging. Food Eng. Rev. 2019, 11, 159–183. [Google Scholar] [CrossRef] [Scilit]
- Hu, B.; Sun, D.-W.; Pu, H.; Wei, Q. Recent advances in detecting and regulating ethylene concentrations for shelf-life extension and maturity control of fruit: A review. Trends Food Sci. Technol. 2019, 91, 66–82. [Google Scholar] [CrossRef] [Scilit]
- Tzeng, J.H.; Weng, C.H.; Huang, J.W.; Shiesh, C.-C.; Lin, Y.-H.; Lin, Y.-T. Application of palladium-modified zeolite for prolonging post-harvest shelf life of banana. Sci. Food Agric. 2019, 99, 3467–3474. [Google Scholar] [CrossRef] [Scilit]
- Gaikwad, K.K.S.; Singh, S.Y. Ethylene scavengers for active packaging of fresh food produce. Environ. Chem. Lett. 2020, 18, 269–284. [Google Scholar] [CrossRef] [Scilit]
- Xie, G.-F.; Wang, Y.-B.; Huang, Z.-D.; Zhang, M.-S. Quality attributes of fresh common bean during storage as postharvest treatment with 1-MCP. Int. J. Food Prop. 2020, 23, 1711–1721. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Xu, X.; Xue, S.; Gong, D.; Wang, B.; Zheng, X.; Xie, P.; Bi, Y.; Prusky, D. Preharvest multiple sprays with chitosan promotes the synthesis and deposition of lignin at wounds of harvested muskmelons. Int. J. Biol. Macromol. 2022, 206, 167–174. [Google Scholar] [CrossRef] [Scilit]
- Tokala, V.Y.; Singh, Z.; Kyaw, P.N. Postharvest fruit quality of apple influenced by ethylene antagonist fumigation and ozonized cold storage. Food Chem. 2021, 341, 128293. [Google Scholar] [CrossRef] [Scilit]
- Sang, Y.; Yang, W.; Liu, Y.; Zhang, W.; Guo, T.; Shen, P.; Tang, Y.; Guo, M.; Chen, G. Influences of low temperature on the postharvest quality and antioxidant capacity of winter jujube (Zizyphus jujuba Mill. cv. Dongzao). LWT 2022, 154, 112876. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.-X.; Wang, Y.; Chen, F.-H.; He, F.; Wu, G.-B.; Zhang, S.; Lin, H.-T. Exogenous nitric oxide inhibits the respiratory metabolism of postharvest wax apple fruit and its role in the delayed cottony softening. Sci. Hortic. 2023, 317, 112043. [Google Scholar] [CrossRef] [Scilit]
- Wani, S.M.; Gull, A.; Ahad, T.; Malik, A.R.; Ganaie, T.A.; Masoodi, F.A.; Gani, A. Effect of gum Arabic, xanthan and carrageenan coatings containing antimicrobial agent on postharvest quality of strawberry: Assessing the physicochemical, enzyme activity and bioactive properties. Int. J. Biol. Macromol. 2021, 183, 2100–2108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, J.K.; Jiang, W.B.; Zhao, Y.M. Experiment Guidance of Postharvest Physiology and Biochemistry of Fruits and Vegetables; China Light Industry Press: Beijing, China, 2013. [Google Scholar]
- Zhang, Y.-L.; Cui, Q.-L.; Wang, Y.; Shi, Y.; Liu, Y.-P.; Liu, J.-L.; Nie, G.-W. Effect of carboxymethyl chitosan-gelatin-based edible coatings on the quality and antioxidant properties of sweet cherry during postharvest storage. Sci. Hortic. 2021, 289, 110462. [Google Scholar] [CrossRef] [Scilit]
- Liang, C.; Cui, X.; Sun, C.; Ye, S.; Huang, N.; Chen, R.; Zhang, A.; Yang, Y.; Gong, H.; Sun, S.; et al. Synergistic and antagonistic effects of preharvest salicylic acid and postharvest 1-methylcyclopropene treatments on the storage quality of apricot. Food Chem. 2023, 405, 134764. [Google Scholar] [CrossRef] [Scilit]
- Sampathkumar, A. Mechanical feedback-loop regulation of morphogenesis in plants. Development 2020, 147, dev177964. [Google Scholar] [CrossRef] [Scilit]
- Swaminathan, S.; Lionetti, V.; Zabotina, O.A. Plant Cell Wall Integrity Perturbations and Priming for Defense. Plants 2022, 11, 3539. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Pei, H.; Jiao, J.; Jin, M.; Li, H.; Zhu, Q.; Ma, Y.; Rao, J. 1-Methylcyclopropene treatment followed with ethylene treatment alleviates postharvest chilling injury of ‘Xuxiang’ kiwifruit during low-temperature storage. Food Control 2021, 130, 108340. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.; Wu, Y.; Wei, X.; Huang, Z.; Mao, L. Ethylene promotes ABA biosynthesis by repressing the expression of miR161 in postharvest strawberry fruit. Postharvest Biol. Technol. 2023, 199, 112302. [Google Scholar] [CrossRef] [Scilit]
- Cai, C.; Xu, C.; Li, X.; Ferguson, I.; Chen, K. Accumulation of lignin in relation to change in activities of lignification enzymes in loquat fruit flesh after harvest. Postharvest Biol. Technol. 2006, 40, 163–169. [Google Scholar] [CrossRef] [Scilit]
- Lv, H.; Guo, S.; Wu, Z.; Nan, X.; Zhu, M.; Mao, K. Postharvest quality and metabolism changes of daylily flower buds treated with hydrogen sulfide during storage. Postharvest Biol. Technol. 2024, 212, 112890. [Google Scholar] [CrossRef] [Scilit]
- Cai, S.; Zhang, Z.; Wang, J.; Fu, Y.; Zhang, Z.; Khan, M.R.; Cong, X. Effect of exogenous melatonin on postharvest storage quality of passion fruit through antioxidant metabolism. LWT 2024, 194, 115835. [Google Scholar] [CrossRef] [Scilit]
- Janjarasskul, T.; Suppakul, P. Active and intelligent packaging: The indication of quality and safety. Crit. Rev. Food Sci. Nutr. 2018, 58, 808–831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dea, A.; Bender, I.; Tanel, K.; Kaart, T.; Roasto, M.; Heinonen, M.; Luik, A.; Püssa, T. Changes in Polyphenols Contents and Antioxidant Capacities of Organically and Conventionally Cultivated Tomato (Solanum lycopersicum L.) Fruits during Ripening. Int. J. Anal. Chem. 2017, 1, 2367453. [Google Scholar]
- Saltveit, M.E. Effect of 1-methylcyclopropene on phenylpropanoid metabolism, the accumulation of phenolic compounds, and browning of whole and fresh-cut ‘iceberg’ lettuce. Postharvest Biol. Technol. 2004, 34, 75–80. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.-Y.; Jiang, W.-B. Lignin Deposition and Effect of Postharvest Treatment on Lignification of Green Asparagus (Asparagus officinalis L.). Plant Growth Regul. 2006, 48, 187–193. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Fang, X.; Han, Y.; Han, Y.; Liu, R.; Chen, H.; Gao, H. Analysis of lignin metabolism in water bamboo shoots during storage. Postharvest Biol. Technol. 2022, 192, 111989. [Google Scholar] [CrossRef] [Scilit]
- Gong, K.; Chen, L.; Li, X.; Liu, K. Lignin accumulation and biosynthetic enzyme activities in relation to postharvest firmness of fresh waxy corn. Mol. Med. Rep. 2017, 42, e13333. [Google Scholar] [CrossRef] [Scilit]
- Lwin, W.W.; Pongprasert, N.; Boonyaritthongchai, P.; Wongs-Aree, C.; Srilaong, V. Synergistic effect of vacuum packaging and cold shock reduce lignification of asparagus. J. Food Biochem. 2020, 44, e13479. [Google Scholar] [CrossRef] [Scilit]
- Shan, L.L.; Li, X.; Wang, P.; Cai, C.; Zhang, B.; Sun, C.-D.; Zhang, W.-S.; Xu, C.J.; Ferguson, I.; Chen, K.-S. Characterization of cDNAs associated with lignification and their expression profiles in loquat fruit with different lignin accumulation. Planta 2008, 227, 1243–1254. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Jiang, H.; Cao, J.; Jiang, W. UV-C treatment controls brown rot in postharvest nectarine by regulating ROS metabolism and anthocyanin synthesis. Postharvest Biol. Technol. 2021, 180, 111613. [Google Scholar] [CrossRef] [Scilit]
- Hou, X.; Shao, F.; Ma, Y.; Lu, S. The phenylalanine ammonia-lyase gene family in Salvia miltiorrhiza: Genome-wide characterization, molecular cloning and expression analysis. Mol. Biol. Rep. 2013, 40, 4301–4310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soltani, B.M.; Ehlting, J.; Hamberger, B.R.; Douglas, C.J. Multiple cis-regulatory elements regulate distinct and complex patterns of developmental and wound-induced expression of Arabidopsis thaliana 4CL gene family members. Planta 2006, 224, 1226–1238. [Google Scholar] [CrossRef] [Scilit]
- Halpin, C.; Knight, M.E.; Foxon, G.A.; Campbell, M.M.; Boudet, A.M.; Boon, J.J.; Chabbert, B.; Tollier, M.-T.; Schuch, W. Manipulation of lignin quality by downregulation of cinnamyl alcohol dehydrogenase. Plant J. 1994, 6, 339–350. [Google Scholar] [CrossRef] [Scilit]
- Mustafa, M.A.; Ali, A.; Seymour, G.; Tucker, G. Delayed pericarp hardening of cold stored mangosteen (Garcinia mangostana L.) upon pre-treatment with the stress hormones methyl jasmonate and salicylic acid. Sci. Hortic. 2018, 230, 107–116. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Zhu, N.; Zhu, C.; Wu, D.; Chen, K. Morphology and cell wall composition changes in lignified cells from loquat fruit during postharvest storage. Postharvest Biol. Technol. 2019, 157, 110975. [Google Scholar] [CrossRef] [Scilit]
- Qi, X.; Ji, Z.; Lin, C.; Li, S.; Liu, J.; Kan, J.; Zhang, M.; Jin, C.; Qian, C. Nitric oxide alleviates lignification and softening of water bamboo (Zizania latifolia) shoots during postharvest storage. Food Chem. 2020, 332, 127416. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.-H.; Huh, G.-H. Overexpression of cinnamyl alcohol dehydrogenase gene from sweetpotato enhances oxidative stress tolerance in transgenic Arabidopsis. Vitr. Cell. Dev. Biol.-Plant 2019, 55, 172–179. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Suo, J.; Han, Y.; Liang, C.; Jin, M.; Zhang, Z.; Rao, J. The effect of 1-methylcyclopropene, methyl jasmonate and methyl salicylate on lignin accumulation and gene expression in postharvest ‘Xuxiang’ kiwifruit during cold storage. Postharvest Biol. Technol. 2017, 124, 107–118. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Li, W.; Wang, H.; Du, J.; Zahang, Y.; Li, D.; Wang, J.; Zhou, Q.; Pang, P.; Tang, Y.l. 1-MCP delays ripening and maintains postharvest quality of nectarines by regulating transcriptional and metabolic responses. Sci. Hortic. 2024, 330, 113083. [Google Scholar] [CrossRef] [Scilit]
- Toscano, S.; Ferrante, A.; Leonardi, C.; Romano, D. PAL activities in asparagus spears during storage after ammonium sulfate treatments. Postharvest Biol. Technol. 2018, 140, 34–41. [Google Scholar] [CrossRef] [Scilit]
- Vanholme, R.; De Meester, B.; Ralph, J.; Boerjan, B. Lignin biosynthesis and its integration into metabolism. Curr. Opin. Biotechnol. 2019, 56, 230–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trabucco, G.M.; Matos, D.A.; Lee, S.J.; Saathoff, A.J.; Priest, H.D.; Mockler, T.C.; Sarath, G.; Hazen, S.P. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon. BMC Biotechnol. 2013, 13, 61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suo, J.; Li, H.; Ban, Q.; Han, Y.; Meng, K.; Jin, M.; Zhang, Z.; Rao, J. Characteristics of chilling injury-induced lignification in kiwifruit with different sensitivities to low temperatures. Postharvest Biol. Technol. 2018, 135, 8–18. [Google Scholar] [CrossRef] [Scilit]
- Wen, M.; Wang, H.; Chen, Y.; Jiang, Y.; Chen, F.; Luo, Z. Inhibition effect of super atmospheric O2 packaging on H2O2-production and the key enzymes of ligin biosynthesis in fresh-cut Chinese cabbage. Postharvest Biol. Technol. 2020, 159, 111027. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.J.; Kim, K.W.; Cho, M.H.; Franceschi, V.R.; Davin, L.B.; Lewis, N.G. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: Lessons for database annotations. Phytochemistry 2007, 68, 1957–1974. [Google Scholar] [CrossRef] [Scilit]
- Goujon, T.; Sibout, R.; Eudes, A.; MacKay, J.; Jouanin, L. Genes involved in the biosynthesis of lignin precursors in Arabidopsis thaliana. Plant Physiol. Biochem. 2003, 41, 677–687. [Google Scholar] [CrossRef] [Scilit]
- Tavares, R.; Aubourg, S.; Lecharny, A.; Kreis, M. Organization and structural evolution of four multigene families in Arabidopsis thaliana: AtLCAD, AtLGT, AtMYST and AtHD-GL2. Plant Mol. Biol. 2000, 42, 703–717. [Google Scholar] [CrossRef] [Scilit]






| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| FaPAL | 5′-AGCAACACAACCAGGATGTCAA | 5′-CAATTGCTTGGCAAAGTGCA |
| FaPAL1 | 5′-CTGGCACGACATCATAAGC | 5′-GGAGGTGGTGGTGTTGTA |
| FaC4H | 5′-CATTGAGCAGGGTTGTTGGC | 5′-CCCACACATGAACCTCCACA |
| FaC4H1 | 5′-AGGCGAGATCAACGAAGACAAC | 5′-GTTCACAAGCTCAGCAATGCC |
| Fa4CL | 5′-AGGCAATGTACGTGGACAAGCT | 5′-TCCGAGAGGACAGAGAAGTGGA |
| FaCAD | 5′-CGAGTTGAACAGGGTCCGAA | 5′-ATCAGCGTCCAATCCCACTC |
| FaCAD1 | 5′-AACATAACGAGTGACATTGAAT | 5′-AACGGTAGCGAACATCAT |
| FaCAD2 | 5′-ATTGGCTGCAACTGACCCTT | 5′-CAAGCATCTGGGTCGTGTCT |
| Actin gene | 5′-GCGGACAGAATGAGCAAGGA | 5′GAAGCCAAGATAGAGCCACCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, J.; Chen, C.; Zhang, X.; Dong, C.; Jin, M.; Zhang, X.; Xue, W.; Li, J. Effects of Efficient Ethylene Remover on the Lignification of Fresh Faba Bean (Vicia faba L.) during Storage. Foods 2024, 13, 3036. https://doi.org/10.3390/foods13193036
Fan J, Chen C, Zhang X, Dong C, Jin M, Zhang X, Xue W, Li J. Effects of Efficient Ethylene Remover on the Lignification of Fresh Faba Bean (Vicia faba L.) during Storage. Foods. 2024; 13(19):3036. https://doi.org/10.3390/foods13193036
Chicago/Turabian StyleFan, Jiaxing, Cunkun Chen, Xiaojun Zhang, Chenghu Dong, Manqin Jin, Xuemei Zhang, Wentong Xue, and Jingming Li. 2024. "Effects of Efficient Ethylene Remover on the Lignification of Fresh Faba Bean (Vicia faba L.) during Storage" Foods 13, no. 19: 3036. https://doi.org/10.3390/foods13193036
APA StyleFan, J., Chen, C., Zhang, X., Dong, C., Jin, M., Zhang, X., Xue, W., & Li, J. (2024). Effects of Efficient Ethylene Remover on the Lignification of Fresh Faba Bean (Vicia faba L.) during Storage. Foods, 13(19), 3036. https://doi.org/10.3390/foods13193036
