Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Material
2.2. Determination of Volatile Compounds
2.3. Transcriptome Sequencing
2.4. Real-Time Fluorescence Quantitative PCR
2.5. Data Processing
3. Results and Discussion
3.1. Analysis of Volatile Organic Compound Types of Strawberry during Storage
3.2. Volatile Organic Compounds Analysis of Strawberries during Storage
3.3. Analysis of Key Volatile Compounds in Strawberry
3.4. Metabolic Pathway Analysis
3.5. Analysis of Key Gene Transcript Expression
3.6. Analysis of Real-Time Quantitative Fluorescence
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Compounds | RT | CAS | Content (μg/kg) | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Storage Time | 0 h | 3 h | 6 h | 9 h | 12 h | 1 d | 2 d | 3 d | 6 d | 9 d | 12 d | 15 d | |||
Esters | |||||||||||||||
Ethyl butyrate | 7.545 | 105-54-4 | ck | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | 20.22 ± 2.85 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Methyl hexoate | 11.254 | 106-70-7 | ck | 17.25 ± 2.42 | 19.98 ± 3.24 | 19.21 ± 2.35 | 34.56 ± 4.21 | 50.47 ± 5.35 | 7.80 ± 1.84 | 19.50 ± 2.56 | 25.40 ± 4.21 | 9.88 ± 1.74 | 24.45 ± 2.45 | 27.63 ± 3.62 | 30.22 ± 5.32 |
u | 10.86 ± 2.01 | 28.43 ± 4.25 | 9.83 ± 2.10 | 27.37 ± 3.42 | 34.19 ± 2.46 | 24.25 ± 4.72 | 28.92 ± 3.62 | 18.86 ± 3.23 | 10.06 ± 1.72 | 26.50 ± 3.32 | 16.51 ± 2.32 | 22.73 ± 3.26 | |||
Ethyl hexanoate | 12.773 | 123-66-0 | ck | 25.63 ± 4.23 | 21.55 ± 3.23 | 20.96 ± 3.12 | 29.00 ± 2.64 | 13.94 ± 1.24 | 65.27 ± 8.34 | 30.53 ± 5.63 | 15.26 ± 2.34 | 9.91 ± 1.64 | 24.40 ± 3.52 | 69.45 ± 7.35 | 92.97 ± 10.52 |
u | 25.00 ± 2.62 | 24.19 ± 2.73 | 23.74 ± 3.26 | 39.21 ± 5.25 | 42.37 ± 6.74 | 37.02 ± 4.26 | 29.55 ± 4.72 | 28.58 ± 3.72 | 18.52 ± 2.46 | 41.27 ± 6.34 | 82.86 ± 11.46 | 103.70 ± 12.63 | |||
Hexyl acetate | 14.181 | 142-92-7 | ck | 3.98 ± 1.52 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Trans-2-hexenyl acetate | 16.638 | 2497-18-9 | ck | 9.09 ± 1.26 | 8.01 ± 2.01 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 6.13 ± 2.13 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Cyclohexyl acetate | 16.883 | 622-45-7 | ck | ND | 2.54 ± 0.23 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | 2.38 ± 0.54 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Methyl benzoate | 30.819 | 93-58-3 | ck | ND | ND | ND | 0.58 ± 0.12 | 0.30 ± 0.06 | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | 0.87 ± 0.13 | 0.47 ± 0.10 | ND | ND | ND | ND | ND | ND | ND | ND | |||
Gamma-butyrolactone | 31.299 | 96-48-0 | ck | 0.55 ± 0.08 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Methyl salicylate | 38.742 | 119-36-8 | ck | ND | ND | ND | 0.42 ± 0.14 | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Methyl cinnamate | 51.77 | 1754-62-7 | ck | 0.55 ± 0.11 | ND | 0.24 ± 0.04 | 0.29 ± 0.06 | 0.50 ± 0.14 | ND | 0.30 ± 0.06 | 0.49 ± 0.10 | ND | 0.64 ± 0.13 | ND | ND |
u | ND | 0.29 ± 0.05 | ND | 0.33 ± 0.04 | 0.70 ± 0.06 | 0.64 ± 0.15 | ND | 0.69 ± 0.21 | 0.47 ± 0.12 | 0.84 ± 0.25 | ND | ND | |||
Ethyl cinnamate | 53.123 | 103-36-6 | ck | 11.22 ± 2.61 | 6.90 ± 1.26 | 7.42 ± 2.73 | 6.48 ± 2.71 | 4.61 ± 1.73 | 24.09 ± 4.71 | 19.16 ± 3.72 | 9.91 ± 2.26 | 10.19 ± 2.71 | 17.39 ± 1.28 | 39.33 ± 4.72 | 92.22 ± 10.27 |
u | 9.72 ± 1.83 | 5.63 ± 0.83 | 5.91 ± 1.61 | 7.18 ± 2.31 | 18.45 ± 3.72 | 27.24 ± 3.17 | 10.85 ± 2.72 | 15.21 ± 2.27 | 13.84 ± 2.21 | 31.61 ± 5.62 | 102.39 ± 17.36 | 106.79 ± 10.62 | |||
Gamma-Decanolactone | 58.882 | 706-14-9 | ck | ND | ND | ND | ND | ND | 1.62 ± 0.15 | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Diisobutyl phthalate | 61.859 | 84-69-5 | ck | ND | ND | 3.05 ± 0.26 | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | 4.65 ± 0.45 | ND | ND | ND | ND | ND | ND | ND | |||
Alcohols | |||||||||||||||
Isoamylol | 13.529 | 123-51-3 | ck | 6.41 ± 1.12 | ND | 7.84 ± 0.92 | 5.19 ± 0.63 | 4.29 ± 0.63 | 3.98 ± 0.42 | 5.23 ± 0.47 | 5.26 ± 1.02 | ND | ND | 3.75 ± 0.51 | ND |
u | ND | ND | ND | 4.85 ± 0.52 | 6.16 ± 0.72 | ND | 3.92 ± 0.42 | 3.97 ± 0.23 | 5.22 ± 0.41 | 4.80 ± 0.85 | 3.46 ± 0.45 | ND | |||
Pentanol | 13.562 | 71-41-0 | ck | 7.77 ± 1.93 | 4.61 ± 0.32 | 9.76 ± 0.89 | 5.00 ± 0.46 | 4.43 ± 0.52 | 4.06 ± 0.35 | 4.70 ± 0.32 | 5.80 ± 0.56 | ND | 5.02 ± 0.67 | 3.95 ± 0.36 | 5.96 ± 0.63 |
u | 3.48 ± 0.43 | 7.36 ± 1.25 | 9.38 ± 1.56 | ND | 5.82 ± 1.31 | 2.16 ± 0.23 | 3.27 ± 0.34 | 3.89 ± 0.25 | 5.43 ± 0.43 | 5.00 ± 0.46 | 3.86 ± 0.25 | 3.61 ± 0.15 | |||
Cis-2-penten-1-ol | 16.244 | 1576-95-0 | ck | 3.45 ± 0.35 | 2.72 ± 0.23 | ND | 3.60 ± 0.51 | ND | ND | ND | ND | ND | ND | ND | ND |
u | 2.02 ± 0.23 | 3.55 ± 0.42 | ND | 3.49 ± 0.14 | 4.12 ± 0.23 | 1.50 ± 0.06 | ND | ND | ND | ND | 2.55 ± 0.24 | ND | |||
Hexan-1-ol | 17.703 | 111-27-3 | ck | 10.07 ± 1.45 | 9.25 ± 0.82 | 4.22 ± 0.24 | 2.56 ± 0.34 | 4.71 ± 0.45 | 3.49 ± 0.24 | 2.35 ± 0.15 | 12.45 ± 1.26 | 2.39 ± 0.42 | 2.85 ± 0.25 | 7.23 ± 0.92 | 2.95 ± 0.35 |
u | 4.48 ± 0.25 | 6.53 ± 0.45 | 2.66 ± 0.27 | 2.81 ± 0.29 | 3.48 ± 0.49 | 14.68 ± 1.52 | 5.83 ± 0.51 | 12.68 ± 1.53 | 2.06 ± 0.26 | 4.20 ± 0.42 | 4.49 ± 0.64 | 6.24 ± 0.52 | |||
Trans-2-Hexen-1-ol | 20.141 | 928-95-0 | ck | 11.50 ± 1.64 | 19.30 ± 2.64 | 5.01 ± 0.56 | ND | 7.12 ± 0.62 | 2.46 ± 0.43 | ND | 2.13 ± 0.25 | 1.78 ± 0.15 | 2.52 ± 0.26 | 6.37 ± 0.53 | 1.09 ± 0.15 |
u | 8.83 ± 1.83 | 11.65 ± 0.92 | ND | 5.18 ± 0.63 | 5.10 ± 0.52 | 7.76 ± 0.61 | 1.49 ± 0.11 | 3.93 ± 0.46 | 1.56 ± 0.15 | ND | ND | 1.92 ± 0.29 | |||
Cyclohexanol | 20.15 | 108-93-0 | ck | 15.98 ± 1.51 | 19.75 ± 2.31 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Cis-2-Hexen-1-ol | 20.2 | 928-94-9 | ck | 13.24 ± 1.42 | 12.05 ± 2.21 | 3.19 ± 0.41 | 5.27 ± 0.45 | 7.26 ± 0.64 | 2.65 ± 00.25 | ND | ND | ND | ND | ND | ND |
u | ND | 12.25 ± 0.98 | 4.62 ± 0.52 | 4.79 ± 0.43 | 5.75 ± 1.06 | 2.19 ± 0.25 | ND | ND | ND | 3.01 ± 0.32 | 2.96 ± 0.31 | 2.41 ± 0.23 | |||
Oct-1-en-3-ol | 22.344 | 3391-86-4 | ck | ND | ND | 5.15 ± 0.62 | ND | ND | 2.03 ± 0.43 | 9.48 ± 1.34 | 9.07 ± 0.82 | 7.30 ± 0.91 | 3.67 ± 0.43 | 4.21 ± 0.32 | ND |
u | ND | 4.45 ± 0.32 | ND | ND | 7.59 ± 0.94 | ND | ND | 12.13 ± 1.23 | 6.70 ± 0.42 | 5.72 ± 0.62 | 3.37 ± 0.31 | ND | |||
2-Ethylhexan-1-ol | 24.237 | 104-76-7 | ck | 5.54 ± 0.41 | 3.68 ± 0.23 | 4.48 ± 0.45 | 2.36 ± 0.25 | ND | 4.56 ± 0.15 | 4.46 ± 0.25 | 5.01 ± 0.62 | 5.48 ± 0.56 | 6.58 ± 0.72 | 8.70 ± 1.02 | 11.13 ± 1.93 |
u | 5.13 ± 0.53 | 2.59 ± 0.20 | 3.68 ± 0.53 | 2.32 ± 0.30 | 5.53 ± 0.53 | 3.13 ± 0.24 | 4.10 ± 0.31 | 2.80 ± 0.45 | 6.39 ± 0.53 | 8.34 ± 0.75 | 4.97 ± 0.34 | 6.34 ± 0.25 | |||
Octan-1-ol | 27.958 | 111-87-5 | ck | 2.95 ± 0.36 | 1.70 ± 0.16 | 3.57 ± 0.46 | 3.45 ± 0.26 | 2.27 ± 0.74 | 4.46 ± 0.53 | 17.03 ± 1.93 | 16.55 ± 0.37 | 8.73 ± 0.39 | 2.95 ± 0.32 | 5.31 ± 0.52 | 8.15 ± 0.89 |
u | 2.80 ± 0.34 | 3.62 ± 0.53 | 2.15 ± 0.32 | 2.21 ± 0.22 | 6.82 ± 0.34 | 3.60 ± 0.52 | 6.59 ± 0.63 | 17.78 ± 1.52 | 7.12 ± 0.82 | 8.67 ± 0.93 | 5.00 ± 0.52 | 11.96 ± 1.83 | |||
2-Phenylethanol | 45.972 | 60-12-8 | ck | 0.65 ± 0.12 | ND | ND | 0.39 ± 0.07 | ND | ND | ND | ND | ND | ND | ND | ND |
u | 0.26 ± 0.12 | ND | ND | 0.41 ± 0.08 | ND | ND | ND | ND | 2.13 ± 0.24 | ND | ND | ND | |||
Aldehydes | |||||||||||||||
Hexanal | 8.452 | 66-25-1 | ck | 20.61 ± 3.18 | 19.56 ± 2.41 | 14.94 ± 2.12 | 17.72 ± 2.51 | 28.45 ± 3.52 | 19.92 ± 1.51 | 31.94 ± 3.24 | 27.04 ± 2.51 | 18.07 ± 1.72 | 34.33 ± 4.63 | 16.69 ± 2.52 | 21.50 ± 2.16 |
u | 16.99 ± 1.62 | 27.98 ± 2.32 | 22.39 ± 1.62 | 23.47 ± 2.63 | 31.34 ± 2.35 | 17.52 ± 2.15 | 23.20 ± 3.21 | 18.78 ± 2.61 | 22.32 ± 2.61 | 36.06 ± 3.12 | 23.65 ± 3.11 | 23.13 ± 2.62 | |||
Trans-2-hexenal | 12.361 | 6728-26-3 | ck | 38.01 ± 4.61 | 33.23 ± 3.71 | 32.02 ± 2.46 | 30.99 ± 2.36 | 29.47 ± 3.72 | 45.00 ± 5.27 | 37.62 ± 3.61 | 35.72 ± 4.16 | 38.99 ± 4.26 | 27.63 ± 3.71 | 29.19 ± 3.77 | 29.19 ± 2.18 |
u | 19.92 ± 2.71 | 37.18 ± 4.17 | 37.18 ± 4.81 | 43.86 ± 4.16 | 35.94 ± 3.71 | 52.36 ± 5.16 | 28.28 ± 3.93 | 47.43 ± 4.12 | 44.59 ± 4.61 | 39.40 ± 3.36 | 22.70 ± 2.41 | 52.40 ± 6.27 | |||
Octanal | 14.249 | 124-13-0 | ck | ND | ND | ND | ND | ND | 2.78 ± 0.31 | 6.70 ± 0.53 | 5.12 ± 0.66 | 4.84 ± 0.34 | 3.14 ± 0.23 | 3.30 ± 0.52 | 4.23 ± 0.33 |
u | ND | ND | ND | ND | 2.53 ± 0.21 | 1.79 ± 0.43 | 2.69 ± 0.22 | 3.80 ± 0.43 | 7.15 ± 0.56 | 3.72 ± 0.25 | 4.34 ± 0.36 | 3.52 ± 0.25 | |||
Nonanal | 19.332 | 124-19-6 | ck | 4.36 ± 0.47 | ND | 3.01 ± 0.31 | 5.05 ± 0.46 | 6.81 ± 0.67 | 7.60 ± 0.83 | 39.02 ± 3.13 | 24.47 ± 2.41 | 38.01 ± 3.15 | 11.04 ± 1.23 | 17.55 ± 2.41 | 35.26 ± 3.15 |
u | 4.40 ± 0.32 | ND | ND | 3.23 ± 0.12 | 11.71 ± 2.31 | 7.43 ± 0.25 | 21.98 ± 3.51 | 53.40 ± 6.32 | 26.02 ± 3.23 | 34.65 ± 3.71 | 10.37 ± 2.01 | 41.62 ± 4.10 | |||
Furfural | 22.628 | 98-01-1 | ck | ND | 0.94 ± 0.15 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Benzaldehyde | 25.541 | 100-52-7 | ck | 9.60 ± 1.20 | 7.20 ± 1.23 | 9.19 ± 0.95 | 11.40 ± 1.21 | 9.86 ± 0.41 | ND | 10.94 ± 1.21 | 7.06 ± 0.57 | 7.22 ± 0.48 | 8.15 ± 1.02 | 7.59 ± 0.96 | 8.12 ± 0.83 |
u | 6.20 ± 0.73 | 8.62 ± 0.93 | 7.80 ± 0.94 | 13.04 ± 1.21 | 14.03 ± 2.56 | 9.00 ± 1.02 | 7.56 ± 0.53 | 10.59 ± 0.93 | 12.87 ± 2.10 | 14.71 ± 1.43 | 17.05 ± 1.20 | 13.75 ± 1.56 | |||
Undecan-4-olide | 58.899 | 104-67-6 | ck | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | 1.73 ± 0.53 | ND | ND | ND | ND | ND | ND | ND | |||
Acids | |||||||||||||||
Acetic acid | 22.313 | 64-19-7 | ck | 2.99 ± 0.45 | 3.02 ± 0.32 | 3.83 ± 0.43 | 1.67 ± 0.34 | 2.98 ± 0.32 | 3.79 ± 0.44 | ND | 4.82 ± 0.45 | ND | 3.02 ± 0.22 | 5.91 ± 0.67 | 4.99 ± 0.43 |
u | 3.16 ± 0.32 | 3.43 ± 0.31 | 3.82 ± 0.43 | 3.83 ± 0.33 | 3.69 ± 0.43 | 8.37 ± 0.64 | 3.03 ± 0.52 | ND | 4.98 ± 0.64 | 4.13 ± 0.36 | 6.35 ± 0.67 | 3.84 ± 0.19 | |||
2-Methylbutyric acid | 33.755 | 116-53-0 | ck | ND | ND | ND | 8.61 ± 1.38 | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | 2.51 ± 0.32 | ND | ND | 3.07 ± 0.71 | ND | ND | ND | ND | ND | ND | ND | |||
Pentanoic acid | 37.311 | 109-52-4 | ck | ND | 0.25 ± 0.05 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Hexanoic acid | 42.853 | 142-62-1 | ck | 24.59 ± 3.58 | 13.51 ± 1.42 | 24.32 ± 2.53 | 37.84 ± 4.23 | 49.69 ± 5.00 | 61.90 ± 5.19 | 34.64 ± 3.10 | 22.04 ± 2.84 | 20.42 ± 2.12 | 28.78 ± 3.82 | 64.36 ± 8.32 | 8.95 ± 1.49 |
u | 47.00 ± 4.19 | 43.27 ± 3.92 | 18.60 ± 2.94 | 40.18 ± 4.01 | 83.01 ± 9.91 | 56.30 ± 4.92 | 35.83 ± 3.01 | 46.75 ± 4.92 | 20.98 ± 2.27 | 60.94 ± 4.91 | 92.70 ± 10.93 | 43.69 ± 4.12 | |||
Octanoic acid | 51.332 | 124-07-2 | ck | 3.34 ± 0.52 | 4.94 ± 0.23 | 2.36 ± 0.33 | 4.34 ± 0.41 | 2.05 ± 0.22 | 8.02 ± 0.84 | 3.38 ± 0.29 | 1.52 ± 0.19 | 1.35 ± 0.20 | 1.38 ± 0.10 | 4.81 ± 0.93 | ND |
u | 2.17 ± 0.23 | 3.01 ± 0.25 | 1.81 ± 0.21 | 3.06 ± 0.41 | 4.86 ± 0.51 | 9.57 ± 1.39 | 2.74 ± 0.42 | 4.96 ± 0.50 | 1.95 ± 0.29 | 5.49 ± 0.48 | 16.70 ± 1.94 | 2.20 ± 0.39 | |||
Nonanoic acid | 54.164 | 112-05-0 | ck | 5.97 ± 0.39 | 3.10 ± 0.42 | ND | ND | ND | ND | 2.50 ± 0.28 | 1.37 ± 0.15 | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Benzoic acid | 60.014 | 65-85-0 | ck | 6.64 ± 1.03 | 4.46 ± 0.84 | 2.61 ± 0.42 | ND | ND | 2.82 ± 0.32 | 1.61 ± 0.15 | ND | ND | ND | ND | ND |
u | 2.29 ± 0.32 | 3.63 ± 0.35 | 1.81 ± 0.15 | ND | 2.35 ± 0.34 | ND | ND | ND | ND | ND | ND | ND | |||
Ketones | |||||||||||||||
6-Methylhept-5-en-2-one | 17.057 | 110-93-0 | ck | ND | ND | 1.62 ± 0.30 | ND | ND | 3.21 ± 0.32 | 3.08 ± 0.43 | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | 1.27 ± 0.20 | ND | ND | ND | ND | ND | ND | ND | |||
4-Methoxy-2,5-dimethylfuran-3(2H)-one | 29.556 | 4077-47-8 | ck | 6.51 ± 1.02 | 1.23 ± 0.29 | 7.15 ± 0.85 | 7.93 ± 0.95 | 8.13 ± 1.92 | 15.06 ± 1.72 | 11.10 ± 2.02 | 3.88 ± 0.83 | 5.13 ± 0.31 | 9.07 ± 1.09 | 18.34 ± 1.84 | 25.39 ± 3.92 |
u | 2.96 ± 0.42 | 6.77 ± 0.53 | 2.95 ± 0.32 | 2.68 ± 0.23 | 21.14 ± 0.21 | 22.30 ± 0.24 | 2.90 ± 0.37 | 3.78 ± 0.74 | 3.70 ± 0.46 | 7.80 ± 0.91 | 15.94 ± 1.38 | 18.96 ± 2.73 | |||
Acetophenone | 32.305 | 98-86-2 | ck | 1.82 ± 0.31 | 1.58 ± 0.15 | ND | 1.35 ± 0.11 | ND | ND | 2.63 ± 0.27 | 1.37 ± 0.25 | 1.68 ± 0.15 | 1.21 ± 0.16 | ND | ND |
u | 1.63 ± 0.20 | ND | 1.33 ± 0.15 | ND | 3.70 ± 0.34 | ND | ND | ND | 2.75 ± 0.25 | 1.78 ± 0.14 | ND | 2.46 ± 0.24 | |||
1,5-Ditert-butyl-3,3-dimethylbicyclo[3.1.0]hexan-2-one | 52.29 | 19377-95-8 | ck | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 1.03 ± 0.23 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Noroxoagarofuran | 61.462 | 5986-25-4 | ck | 7.01 ± 0.91 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Terpenes | |||||||||||||||
Alpha-pinene | 10.507 | 80-56-8 | ck | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 3.08 ± 0.21 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Limonene | 11.635 | 138-86-3 | ck | 3.77 ± 0.42 | 2.74 ± 0.23 | 2.23 ± 0.24 | 2.69 ± 0.41 | 2.99 ± 0.32 | ND | 2.70 ± 0.32 | 2.82 ± 0.44 | 2.20 ± 0.23 | 1.52 ± 0.18 | 1.78 ± 0.19 | 1.85 ± 0.21 |
u | 2.32 ± 0.21 | 1.98 ± 0.21 | 2.26 ± 0.22 | 2.17 ± 0.32 | 3.63 ± 0.34 | ND | 2.80 ± 0.26 | 2.38 ± 0.27 | 2.41 ± 0.21 | 1.97 ± 0.19 | ND | 2.85 ± 0.32 | |||
Cineole | 11.84 | 470-82-6 | ck | 0.94 ± 0.19 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 0.67 ± 0.09 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
(Z)-linalool oxide | 23.287 | 5989-33-3 | ck | 4.78 ± 0.45 | 1.81 ± 0.19 | 2.04 ± 0.29 | 3.09 ± 0.30 | 3.25 ± 0.31 | 2.80 ± 0.25 | 2.28 ± 0.24 | 2.32 ± 0.22 | 1.59 ± 0.19 | 1.54 ± 0.23 | 1.24 ± 0.21 | 1.41 ± 0.16 |
u | 2.84 ± 0.23 | 3.11 ± 0.42 | 3.07 ± 0.63 | 2.25 ± 0.32 | 6.28 ± 1.21 | 3.02 ± 0.53 | 2.40 ± 0.25 | 1.78 ± 0.43 | 1.52 ± 0.22 | 2.02 ± 0.31 | 2.21 ± 0.34 | 2.30 ± 0.26 | |||
Linalool | 27.136 | 78-70-6 | ck | 71.84 ± 8.39 | 79.58 ± 9.10 | 92.75 ± 8.38 | 106.58 ± 15.28 | 128.36 ± 10.38 | 118.83 ± 11.39 | 76.83 ± 9.38 | 88.51 ± 7.29 | 58.72 ± 6.29 | 71.46 ± 5.29 | 48.91 ± 5.10 | 67.09 ± 7.29 |
u | 81.28 ± 8.39 | 82.59 ± 8.03 | 63.70 ± 7.03 | 87.37 ± 9.38 | 143.52 ± 10.39 | 98.11 ± 9.48 | 95.42 ± 10.37 | 91.23 ± 9.57 | 88.64 ± 8.93 | 91.31 ± 10.39 | 79.19 ± 8.94 | 91.41 ± 9.38 | |||
Terpinine-4-ol | 30.014 | 562-74-3 | ck | 24.65 ± 2.93 | 12.68 ± 1.29 | 20.57 ± 3.02 | 6.16 ± 1.20 | 5.98 ± 0.84 | 19.19 ± 2.30 | 12.12 ± 1.20 | 14.24 ± 1.62 | 9.18 ± 0.84 | 9.48 ± 0.72 | 7.35 ± 0.82 | 16.40 ± 1.47 |
u | 20.84 ± 2.48 | 9.23 ± 1.29 | 10.78 ± 1.47 | 3.80 ± 0.48 | 16.04 ± 0.94 | 6.37 ± 0.73 | 9.87 ± 0.92 | 5.58 ± 0.56 | 12.79 ± 0.74 | 14.47 ± 1.37 | 5.67 ± 0.46 | 18.68 ± 2.48 | |||
Menthol | 32.103 | 89-78-1 | ck | 66.39 ± 5.83 | 7.32 ± 0.78 | 36.04 ± 5.38 | 6.78 ± 1.36 | 5.06 ± 0.67 | 20.06 ± 2.04 | 14.03 ± 1.37 | 13.26 ± 0.95 | 10.61 ± 0.93 | 7.16 ± 0.45 | 5.02 ± 0.35 | 29.99 ± 3.47 |
u | 21.10 ± 2.02 | 7.77 ± 0.76 | 8.77 ± 1.02 | 8.56 ± 0.84 | 12.95 ± 1.27 | ND | 11.12 ± 1.40 | 5.00 ± 0.67 | ND | 12.22 ± 1.38 | 7.24 ± 0.85 | 15.50 ± 0.92 | |||
Terpineol | 35.142 | 98-55-5 | ck | 10.56 ± 1.28 | 3.86 ± 0.45 | 7.14 ± 0.74 | ND | 2.27 ± 0.32 | ND | 3.24 ± 0.42 | 3.59 ± 0.32 | 3.08 ± 0.31 | 2.56 ± 0.30 | 2.95 ± 0.29 | 5.95 ± 0.65 |
u | 5.91 ± 0.76 | 2.76 ± 0.34 | 3.33 ± 0.32 | ND | 7.44 ± 0.67 | 3.83 ± 0.43 | ND | 2.58 ± 0.35 | 3.61 ± 0.36 | 4.30 ± 0.54 | 5.05 ± 0.58 | 4.64 ± 0.32 | |||
Piperitone | 36.546 | 89-81-6 | ck | 11.06 ± 1.48 | ND | 4.20 ± 0.74 | ND | ND | 4.45 ± 0.43 | ND | ND | ND | ND | ND | 2.81 ± 0.53 |
u | 6.14 ± 0.74 | ND | ND | ND | 4.28 ± 0.32 | ND | ND | ND | ND | 3.30 ± 0.43 | ND | 5.34 ± 0.56 | |||
Nerolidol | 50.741 | 7212-44-4 | ck | 6.69 ± 0.78 | 1.48 ± 0.32 | ND | 5.89 ± 1.02 | 3.95 ± 0.43 | 7.89 ± 0.84 | 2.94 ± 0.32 | 2.51 ± 0.32 | 2.35 ± 0.21 | 1.62 ± 0.18 | 6.69 ± 0.78 | ND |
u | 1.47 ± 0.17 | 4.12 ± 0.43 | ND | 2.04 ± 0.23 | 19.19 ± 2.01 | 20.30 ± 2.93 | 4.73 ± 0.43 | 4.44 ± 0.32 | 4.72 ± 0.56 | 6.02 ± 0.64 | 2.29 ± 0.32 | 14.93 ± 1.42 | |||
Others | |||||||||||||||
Toluene | 7.575 | 108-88-3 | ck | 13.58 ± 1.24 | 15.54 ± 1.64 | 17.59 ± 2.83 | 19.46 ± 2.83 | 22.79 ± 2.735 | 23.04 ± 2.65 | 11.32 ± 1.27 | 9.55 ± 0.95 | 8.23 ± 0.75 | 7.49 ± 0.74 | 10.86 ± 0.91 | 8.26 ± 1.38 |
u | 15.85 ± 1.52 | 15.74 ± 1.38 | 15.84 ± 1.73 | 16.45 ± 1.82 | 20.57 ± 2.73 | 18.13 ± 2.10 | 11.73 ± 1.02 | 16.46 ± 1.28 | 10.77 ± 0.94 | 8.86 ± 0.83 | ND | 8.67 ± 0.93 | |||
Ethylbenzene | 9.949 | 100-41-4 | ck | 2.90 ± 0.34 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Styrene | 13.093 | 100-42-5 | ck | ND | ND | 1.53 ± 0.20 | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | 1.16 ± 0.23 | ND | |||
M-cymene | 13.318 | 535-77-3 | ck | ND | ND | ND | ND | ND | ND | ND | ND | ND | 1.44 ± 0.21 | ND | ND |
u | 1.55 ± 0.18 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
P-cymene | 14.011 | 99-87-6 | ck | 3.44 ± 0.45 | 2.57 ± 0.32 | 2.53 ± 0.23 | 1.92 ± 0.21 | 1.37 ± 0.19 | 2.52 ± 0.28 | 2.39 ± 0.29 | 1.52 ± 0.20 | 1.88 ± 0.31 | ND | ND | 1.70 ± 0.19 |
u | ND | 2.00 ± 0.29 | 1.63 ± 0.21 | 1.03 ± 0.19 | 1.99 ± 0.17 | 1.65 ± 0.15 | 1.92 ± 0.20 | 1.63 ± 0.18 | 1.97 ± 0.32 | 1.67 ± 0.27 | 2.57 ± 0.31 | 2.07 ± 0.29 | |||
1,3-Dimethyl-5-ethylbenzene | 14.052 | 934-74-7 | ck | ND | ND | 2.08 ± 0.28 | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
2,5-Dimethylpyrazine | 16.858 | 123-32-0 | ck | 1.02 ± 0.09 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
2-(2-Ethoxyethoxy)ethanol | 31.527 | 111-90-0 | ck | 2.42 ± 0.28 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 1.21 ± 0.17 | ND | 1.43 ± 0.18 | 0.92 ± 0.08 | ND | ND | ND | ND | ND | ND | ND | ND | |||
1-Methylnaphthalene | 42.353 | 90-12-0 | ck | 0.34 ± 0.04 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Butylated hydroxytoluene | 45.532 | 128-37-0 | ck | 1.64 ± 0.26 | ND | ND | ND | ND | 4.72 ± 0.57 | ND | ND | 2.54 ± 0.21 | ND | ND | ND |
u | ND | ND | ND | ND | 3.28 ± 0.32 | 4.57 ± 0.65 | ND | ND | 2.79 ± 0.21 | ND | ND | ND | |||
Benzothiazole | 47.414 | 95-16-9 | ck | 1.96 ± 0.19 | 1.10 ± 0.14 | 1.31 ± 0.15 | 0.85 ± 0.11 | ND | 1.89 ± 0.18 | 1.03 ± 0.21 | 1.37 ± 0.13 | 2.14 ± 0.25 | 1.12 ± 0.21 | 1.09 ± 0.10 | 1.74 ± 0.15 |
u | 1.33 ± 0.21 | 0.92 ± 0.09 | 0.92 ± 0.10 | ND | 2.05 ± 0.21 | 1.43 ± 0.24 | 0.89 ± 0.10 | 0.91 ± 0.08 | 2.10 ± 0.28 | 1.62 ± 0.16 | 1.39 ± 0.18 | 1.73 ± 0.13 | |||
M-Cresol | 49.356 | 108-39-4 | ck | ND | ND | ND | ND | ND | 1.68 ± 0.19 | ND | ND | ND | ND | ND | ND |
u | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
Phenol | 49.396 | 108-95-2 | ck | 1.10 ± 0.19 | 0.63 ± 0.05 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND |
u | 0.57 ± 0.04 | ND | 0.75 ± 0.10 | ND | ND | ND | ND | ND | ND | ND | ND | ND | |||
2,4-Di-t-butylphenol | 57.16 | 96-76-4 | ck | 4.55 ± 0.56 | 0.92 ± 0.19 | 3.88 ± 0.41 | ND | 0.34 ± 0.05 | 1.32 ± 0.21 | 1.52 ± 0.14 | 0.97 ± 0.19 | 1.43 ± 0.17 | ND | ND | 0.87 ± 0.11 |
u | 1.80 ± 0.21 | 0.64 ± 0.17 | 0.53 ± 0.08 | 0.42 ± 0.05 | 0.93 ± 0.09 | 1.27 ± 0.14 | ND | ND | 1.41 ± 0.17 | 0.51 ± 0.04 | ND | ND |
References
- Liu, L.; Ji, M.L.; Chen, M.; Sun, M.Y.; Fu, X.L.; Li, L.; Gao, D.S.; Zhu, C.Y. The flavor and nutritional characteristic of four strawberry varieties cultured in soilless system. Food Sci. Nutr. 2016, 4, 858–868. [Google Scholar] [CrossRef] [PubMed]
- Zuñiga, P.E.; Castañeda, Y.; Arrey-Salas, O.; Fuentes, L.; Aburto, F.; Figueroa, C.R. Methyl Jasmonate Applications From Flowering to Ripe Fruit Stages of Strawberry (Fragaria × ananassa ‘Camarosa’) Reinforce the Fruit Antioxidant Response at Post-harvest. Front. Plant Sci. 2020, 11, 538. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.W.; Ban, Z.J.; Lu, H.Y.; Li, D.; Poverenov, E.; Luo, Z.S.; Li, L. The aroma volatile repertoire in strawberry fruit: A review. J. Sci. Food Agric. 2018, 98, 4395–4402. [Google Scholar] [CrossRef] [PubMed]
- Feliziani, E.; Romanazzi, G. Postharvest decay of strawberry fruit: Etiology, epidemiology, and disease management. J. Berry Res. 2016, 6, 47–63. [Google Scholar] [CrossRef]
- Shen, F.; Zhang, B.; Cao, C.J.; Jiang, X.S. On-line discrimination of storage shelf-life and prediction of post-harvest quality for strawberry fruit by visible and near infrared spectroscopy. J. Food Process Eng. 2018, 41, e12866. [Google Scholar] [CrossRef]
- Feng, Y.B.; Suo, K.; Zhang, Y.; Yang, Z.F.; Zhou, C.S.; Shi, L.Y.; Chen, W.; Wang, J.C.; Wang, C.Y.; Zheng, Y.X. Ultrasound synergistic slightly acidic electrolyzed water treatment of grapes: Impacts on microbial loads, wettability, and postharvest storage quality. Ultrason. Sonochem. 2024, 103, 106751. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Jiang, H.; Li, Y.T.; Wang, S.J.; Wang, B.; Xiao, J.S.; Cao, Y.P. Transcriptomic and physiological analysis reveals the possible mechanism of ultrasound inhibiting strawberry (Fragaria × ananassa Duch.) postharvest softening. Front. Nutr. 2022, 9, 1066043. [Google Scholar] [CrossRef] [PubMed]
- Lewers, K.S.; Newell, M.J.; Park, E.; Luo, Y.G. Consumer preference and physiochemical analyses of fresh strawberries from ten cultivars. Small Fruits Rev. 2020, 20, S733–S756. [Google Scholar] [CrossRef]
- Vallone, S.; Sivertsen, H.; Anthon, G.E.; Barrett, D.M.; Mitcham, E.J.; Ebeler, S.E.; Zakharov, F. An integrated approach for flavour quality evaluation in muskmelon (Cucumis melo L. reticulatus group) during ripening. Food Chem. 2013, 139, 171–183. [Google Scholar] [CrossRef]
- Kulkarni, R.S.; Chidley, H.G.; Pujari, K.H.; Giri, A.P.; Gupta, V.S. Geographic variation in the flavour volatiles of Alphonso mango. Food Chem. 2012, 130, 58–66. [Google Scholar] [CrossRef]
- Vandendriessche, T.; Geerts, P.; Membrebe, B.N.; Keulemans, J.; NicolaI, B.M.; Hertog, M. Journeys through aroma space: A novel approach towards the selection of aroma-enriched strawberry cultivars in breeding programmes. Plant Breed. 2013, 132, 217–223. [Google Scholar] [CrossRef]
- Oh, Y.; Barbey, C.R.; Chandra, S.; Bai, J.H.; Fan, Z.; Plotto, A.; Pillet, J.; Folta, K.M.; Whitaker, V.M.; Lee, S. Genomic Characterization of the Fruity Aroma Gene, FaFAD1, Reveals a Gene Dosage Effect on γ-Decalactone Production in Strawberry (Fragaria × ananassa). Front Plant Sci. 2021, 12, 639345. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.X.; Zhang, Y.T.; Dong, J.; Zhong, C.F.; Chang, L.L.; Wang, L.N. Study of volatile compound contents in a progeny issued from cross between ‘Camarosa’ and ‘Benihoppe’. Acta Hortic. 2012, 926, 65–71. [Google Scholar] [CrossRef]
- Aubert, C.; Bruaut, M.; Chalot, G.; Cottet, V. Impact of maturity stage at harvest on the main physicochemical characteristics, the levels of vitamin C, polyphenols and volatiles and the sensory quality of Gariguette strawberry. Eur. Food Res. Technol. 2021, 247, 37–49. [Google Scholar] [CrossRef]
- Abouelenein, D.; Acquaticci, L.; Alessandroni, L.; Borsetta, G.; Caprioli, G.; Mannozzi, C.; Marconi, R.; Piatti, D.; Santanatoglia, A.; Sagratini, G.; et al. Volatile Profile of Strawberry Fruits and Influence of Different Drying Methods on Their Aroma and Flavor: A Review. Molecules 2023, 28, 5810. [Google Scholar] [CrossRef] [PubMed]
- Rey Serra, P.; Mnejja, M.; Monfort, A. Inheritance of esters and other volatile compounds responsible for the fruity aroma in strawberry. Front Plant Sci. 2022, 13, 959155. [Google Scholar] [CrossRef] [PubMed]
- Jetti, R.R.; Yang, E.; Kurnianta, A.; Finn, C.; Qian, M.C. Quantification of selected aroma-active compounds in strawberries by headspace solid-phase microextraction gas chromatography and correlation with sensory descriptive analysis. J. Food Sci. 2007, 72, S487–S496. [Google Scholar] [CrossRef] [PubMed]
- Prat, L.; Espinoza, M.I.; Agosin, E.; Silva, H. Identification of volatile compounds associated with the aroma of white strawberries (Fragaria chiloensis). J. Sci. Food Agric. 2014, 94, 752–759. [Google Scholar] [CrossRef] [PubMed]
- Lixia, S.; Yinan, N.; Jianwen, W.; Yue, C.; Hongsheng, G. Characteristic-Aroma-Component-Based Evaluation and Classification of Strawberry Varieties by Aroma Type. Molecules 2021, 26, 6219. [Google Scholar] [CrossRef]
- Zhang, Y.Y.; Yin, X.R.; Xiao, Y.W.; Zhang, Z.Y.; Li, S.J.; Liu, X.F.; Zhang, B.; Yang, X.F.; Donald, G.; Jiang, G.H.; et al. An ethylene response factor-MYB transcription complex regulates furaneol biosynthesis by activating quinone oxidoreductase expression in strawberry. Plant Physiol. 2018, 178, 189–201. [Google Scholar] [CrossRef]
- Du, X.F.; Anne, P.; Elizabeth, B.; Russell, R. Evaluation of volatiles from two subtropical strawberry cultivars using GC-olfactometry, GC-MS odor activity values, and sensory analysis. J. Agric. Food Chem. 2011, 59, 12569–12577. [Google Scholar] [CrossRef]
- Gong, D.; Bi, Y.; Zong, Y.Y.; Li, Y.C.; Sionov, E.; Prusky, D. Characterization and sources of volatile organic compounds produced by postharvest pathogenic fungi colonized fruit. Postharvest Biol. Technol. 2022, 188, 111903. [Google Scholar] [CrossRef]
- Hou, X.L.; Jiang, J.M.; Luo, C.Q.; Latifur, R.; Li, X.Y.; Xie, X. Advances in detecting fruit aroma compounds by combining chromatography and spectrometry. J. Sci. Food Agric. 2023, 103, 4755–4766. [Google Scholar] [CrossRef] [PubMed]
- Pott, D.M.; Osorio, S.; Vallarino, J.G. From Central to Specialized Metabolism: An Overview of Some Secondary Compounds Derived From the Primary Metabolism for Their Role in Conferring Nutritional and Organoleptic Characteristics to Fruit. Front Plant Sci. 2019, 10, 835. [Google Scholar] [CrossRef]
- Vandendriessche, T.; Keulemans, J.; Geeraerd, A.; Nicolai, B.M.; Hertog, M.L.A.T.M. Evaluation of fast volatile analysis for detection of Botrytis cinerea infections in strawberry. Food Microbiol. 2012, 32, 406–414. [Google Scholar] [CrossRef] [PubMed]
- Aguiló-Aguayo, I.; Oms-Oliu, G.; Soliva-Fortuny, R.; Martín-Belloso, O. Flavour retention and related enzyme activities during storage of strawberry juices processed by high-intensity pulsed electric fields or heat. Food Chem. 2009, 116, 59–65. [Google Scholar] [CrossRef]
- Zannou, O.; Kelebek, H.; Selli, S. Elucidation of key odorants in Beninese Roselle (Hibiscus sabdariffa L. infusions prepared by hot and cold brewing. Food Res. Int. 2020, 133, 109133. [Google Scholar] [CrossRef]
- Parra-Palma, C.; Úbeda, C.; Gil, M.; Ramos, P.; Castro, R.I.; Morales-Quintana, L. Comparative study of the volatile organic compounds of four strawberry cultivars and it relation to alcohol acyltransferase enzymatic activity. Sci. Hortic. 2019, 251, 65–72. [Google Scholar] [CrossRef]
- Xu, H.S.; Quan, Q.; Chang, X.; Ge, S.; Xu, S.Q.; Wang, R.R.; Xu, Y.Q.; Luo, Z.S.; Shan, Y.; Ding, S.H. Maintaining the balance of fungal community through active packaging film makes strawberry fruit pose pleasant flavor during storage. Postharvest Biol. Technol. 2024, 211, 112815. [Google Scholar] [CrossRef]
- Liu, Q.; Ding, H.Z.; Zhang, T.T.; Zhou, D.D.; Zhu, T.; Pan, L.Q.; Ma, G.X.; Lan, W.J.; Zhao, S.Q.; Hu, Q.H.; et al. Effect on lipoxygenase pathway and flavor stabilization of postharvest strawberries by intense pulsed light treatment. Postharvest Biol. Technol. 2023, 204, 112472. [Google Scholar] [CrossRef]
- Hou, W.F.; Ma, Y.; Zhang, C.H.; Zhao, W.T.; Zhao, S.; Wang, P.; Zhao, X.Y.; Wang, D. Investigation on the inactivation effect and mechanism of Listeria monocytogenes in fresh-cut cucumber during storage by ultrasound combined with sodium hypochlorite. Ultrason. Sonochem. 2023, 101, 106706. [Google Scholar] [CrossRef] [PubMed]
- Adeboyejo, F.O.; Oyesanya, O.B. Ultrasound and autoclave-deacetylated Achatina fulica shell chitosan: Characterisation and effect on tomato and cucumber fruit qualities during storage. Food Chem. 2023, 415, 135750. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.Y.; Xing, L.J.; Kang, D.C.; Zhou, L.; Wang, L.; Zhang, W.G. Effects of ultrasound-assisted vacuum tumbling on the oxidation and physicochemical properties of pork myofibrillar proteins. Ultrason. Sonochem. 2021, 74, 105582. [Google Scholar] [CrossRef]
- Da Porto, C.; Decorti, D. Ultrasound-assisted extraction coupled with under vacuum distillation of flavour compounds from spearmint (carvone-rich) plants: Comparison with conventional hydrodistillation. Ultrason. Sonochem. 2009, 16, 795–799. [Google Scholar] [CrossRef] [PubMed]
- Bruna-Maynou, F.J.; Castro, R.; Rodríguez-Dodero, M.C.; Barroso, C.G.; Durán-Guerrero, E. Flavored Sherry vinegar with citric notes: Characterization and effect of ultrasound in the maceration of orange peels. Food Res. Int. 2020, 133, 795–799. [Google Scholar] [CrossRef] [PubMed]
- Singla, M.; Sit, N. Application of Ultrasound in Combination with Other Technologies in Food Processing: A Review. Ultrason. Sonochem. 2021, 73, 105506. [Google Scholar] [CrossRef] [PubMed]
- Alenyorege, E.A.; Ma, H. Removal of pesticides from fresh-cut Chinese cabbage (Brassica rapa var. chinensis L.) by sequential multi-frequency ultrasound cleaning treatments. Food Humanit. 2023, 1, 958–965. [Google Scholar] [CrossRef]
- Khandpur, P.; Gogate, P.R. Evaluation of ultrasound based sterilization approaches in terms of shelf life and quality parameters of fruit and vegetable juices. Ultrason. Sonochem. 2016, 29, 337–353. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Song, J.; Kalt, W.; Forney, C.; Tsao, R.; Pinto, D.; Chisholm, K.; Campbell, L.; Fillmore, S.; Li, X.H. Quantitative proteomic investigation employing stable isotope labeling by peptide dimethylation on proteins of strawberry fruit at different ripening stages. J. Proteom. 2013, 94, 219–239. [Google Scholar] [CrossRef] [PubMed]
- Pastrana, A.M.; Borrero, C.; Perez, A.G.; Aviles, M. Soilborne pathogens affect strawberry fruit flavor and quality. Plant Sci. 2022, 326, 111533. [Google Scholar] [CrossRef]
- Wang, K.H.; Qi, J.; Jin, Y.; Li, F.; Wang, J.; Xu, H.D. Influence of fruit maturity and lactic fermentation on physicochemical properties, phenolics, volatiles, and sensory of mulberry juice. Food Biosci. 2022, 48, 101782. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef] [PubMed]
- Ulrich, D.; Kecke, S.; Olbricht, K. What Do We Know about the Chemistry of Strawberry Aroma? J. Agric. Food Chem. 2018, 66, 3291–3301. [Google Scholar] [CrossRef] [PubMed]
- Caleb, O.J.; Ilte, K.; Herppich, W.B.; Geyer, M.; Mahajan, P.V. Impacts of minimal processing and hot water dipping of ‘Sonata’ strawberries on volatiles emitted during storage. Sci. Hortic. 2019, 243, 385–391. [Google Scholar] [CrossRef]
- Waghmode, B.; Masoodi, L.; Kushwaha, K.; Iqbal Mir, J.; Sircar, D. Volatile components are non-invasive biomarkers to track shelf-life and nutritional changes in apple cv. ‘Golden Delicious’ during low temperature postharvest storage. J. Food Compos. Anal. 2021, 102, 104075. [Google Scholar] [CrossRef]
- Cai, H.F.; Han, S.; Jiang, L.; Yu, M.L.; Ma, R.J.; Yu, Z.F. Exogenous nitric oxide fumigation promoted the emission of volatile organic compounds in peach fruit during shelf life after long-term cold storage. Food Res. Int. 2020, 133, 109135. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.Q.; Luo, Z.S.; Charles, M.T.; Rolland, D.; Roussel, D. Pre-harvest UV-C irradiation triggers VOCs accumulation with alteration of antioxidant enzymes and phytohormones in strawberry leaves. J. Plant Physiol. 2017, 218, 265–274. [Google Scholar] [CrossRef]
- Padilla-Jimenez, S.M.; Angoa-Perez, M.V.; Mena-Violante, H.G.; Oyoque-Salcedo, G.; Montanez-Soto, J.L.; Oregel-Zamudio, E. Identification of Organic Volatile Markers Associated with Aroma during Maturation of Strawberry Fruits. Molecules 2021, 26, 504. [Google Scholar] [CrossRef]
- Severo, J.; de Oliveira, I.R.; Bott, R.; Le Bourvellec, C.; Renard, C.M.G.C.; Page, D.; Chaves, F.C.; Rombaldi, C.V. Preharvest UV-C radiation impacts strawberry metabolite content and volatile organic compound production. LWT-Food Sci. Technol. 2016, 85, 390–393. [Google Scholar] [CrossRef]
- Yang, W.B.; Liu, J.C.; Liu, H.; Zhang, Q.; Lv, Z.Z.; Jiao, Z.G. Characterization of strawberry purees fermented by Lactobacillus spp. based on nutrition and flavor profiles using LC-TOF/MS, HS-SPME-GC/MS and E-nose. LWT-Food Sci. Technol. 2023, 189, 115457. [Google Scholar] [CrossRef]
- Schiefner, A.; Sinz, Q.; Neumaier, I.; Schwab, W.; Skerra, A. Structural basis for the enzymatic formation of the key strawberry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone. J. Biol. Chem. 2013, 288, 16815–16826. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Brouwer, B.; Oud, N.; Verdonk, J.C.; Tikunov, Y.; Woltering, E.; Schouten, R.; da Silva, F.P. Sensory, GC-MS and PTR-ToF-MS profiling of strawberries varying in maturity at harvest with subsequent cold storage. Postharvest Biol. Technol. 2021, 182, 111719. [Google Scholar] [CrossRef]
- Knudsen, J.T.; Eriksson, R.; Gershenzon, J.; Stahl, B. Diversity and Distribution of Floral Scent. Bot. Rev. 2006, 72, 1–120. [Google Scholar] [CrossRef]
- Gao, L.Y.; Chen, H.M.; Chen, W.X.; Chen, W.J.; Jian, H.Y.; Zhong, Q.P.; Zhang, M. Linalool against Hafnia alvei, its antibacterial mechanism revealed by metabolomic analyses. Food Biosci. 2023, 51, 102316. [Google Scholar] [CrossRef]
- Do, E.; Kim, M.; Ko, D.Y.; Lee, M.; Lee, C.; Ku, K.M. Machine learning for storage duration based on volatile organic compounds emitted from ‘Jukhyang’ and ‘Merry Queen’ strawberries during post-harvest storage. Postharvest Biol. Technol. 2024, 211, 112808. [Google Scholar] [CrossRef]
- Öz, A.T.; Ali, A. Retaining overall quality of fresh figs by postharvest hexanal vapor treatment during cold storage. Postharvest Biol. Technol. 2023, 205, 112539. [Google Scholar] [CrossRef]
- Qian, L.; Xiaoman, Z.; Yanli, X.; Jingmeng, L. Antifungal properties and mechanisms of three volatile aldehydes (octanal, nonanal and decanal) on Aspergillus flavus. Grain Oil Sci. Technol. 2021, 4, 131–140. [Google Scholar]
- Pelayo-Zaldivar, C.; Ben Abda, J.; Ebeler, S.E.; Kader, A.A. Quality and chemical changes associated with flavor of ‘Camarosa’ strawberries in response to a CO2-enriched atmosphere. HortScience 2007, 42, 299–303. [Google Scholar] [CrossRef]
- Liu, Y.P.; Liu, R.; Li, F.F.; Yu, S.M.; Nie, Y.F.; Li, J.Q.; Pan, C.P.; Zhu, W.T.; Zhou, Z.Q.; Diao, J.L. Nano-selenium repaired the damage caused by fungicides on strawberry flavor quality and antioxidant capacity by regulating ABA biosynthesis and ripening-related transcription factors. Pestic. Biochem. Physiol. 2024, 198, 105753. [Google Scholar] [CrossRef]
- Teixeira da Silva, J.A.; Hidvegi, N.; Gulyas, A.; Toth, B.; Dobranszki, J. Transcriptomic Response of In Vitro Potato (Solanum tuberosum L.) to Piezoelectric Ultrasound. Plant Mol. Biol. Rep. 2020, 38, 404–418. [Google Scholar] [CrossRef]
- Mishra, R.C.; Ghosh, R.; Bae, H. Plant acoustics: In the search of a sound mechanism for sound signaling in plants. J. Exp. Bot. 2016, 67, 4483–4494. [Google Scholar] [CrossRef] [PubMed]
- Dobranszki, J.; Hidvegi, N.; Gulyas, A.; Toth, B.; Teixeira da Silva, J.A. Abiotic stress elements in in vitro potato (Solanum tuberosum L.) exposed to air-based and liquid-based ultrasound: A comparative transcriptomic assessment. Prog. Biophys. Mol. Biol. 2020, 158, 47–56. [Google Scholar] [CrossRef] [PubMed]
- Song, F.Y.; Huangfu, Z.Q.; Han, Y.R.; Li, H.M.; Wang, Z.P.; Jin, X.W.; Chen, J.L. Nitric oxide fumigation can affect the metabolism of volatile compounds derived from analyses of fatty acids and amino acids in post-harvest flat peach during cold storage. Food Control 2024, 159, 110258. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.J.; Zhou, D.D.; Zhang, Q.; Pan, L.Q.; Tu, K. Transcriptomics analysis provides insights into metabolisms of sugars and carotenoids of nectarine fruit subjected to different temperature storage. Sci. Hortic. 2022, 304, 111262. [Google Scholar] [CrossRef]
- Schwab, W.; Davidovich-Rikanati, R.; Lewinsohn, E. Biosynthesis of plant-derived flavor compounds. Plant J. 2008, 54, 712–732. [Google Scholar] [CrossRef] [PubMed]
- Magalhaes, H.C.R.; Garruti, D.d.S.; Gandra, E.A.; Purgatto, E. Effect of Postharvest Treatments on the Biosynthesis of Fruit Volatile Compounds: A Literature Review. Curr. Nutr. Food Sci. 2023, 19, 246–261. [Google Scholar] [CrossRef]
- Aharoni, A.; Keizer, L.C.P.; Bouwmeester, H.J.; Sun, Z.K.; Alvarez-Huerta, M.; Verhoeven, H.A.; Blaas, J.; van Houwelingen, A.M.M.L.; De Vos, R.C.H.; van der Voet, H. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 2000, 12, 647–661. [Google Scholar] [CrossRef] [PubMed]
- Saez, D.; Rodríguez-Arriaza, F.; Urra, G.; Fabi, J.P.; Hormazábal-Abarza, F.; Méndez-Yáñez, A.; Castro, E.; Bustos, D.; Ramos, P.; Morales-Quintana, L. Unraveling the Key step in the Aroma Puzzle: Insights into Alcohol Acyltransferases in Strawberries. Plant Physiol. Biochem. 2024, 28, 108668. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.R.; He, D.N.; Gao, W.K.; Li, M.H.; Wu, X.E.; Lv, J.H. Integrated transcriptomic and metabolomic analyses of ‘Guifei’ mango fruit flavor in an endospermic genotype and a mutated genotype without endosperm. Sci. Hortic. 2022, 303, 111189. [Google Scholar] [CrossRef]
- Aharoni, A.; Verstappen, F.W.; Schwab, W.; Giri, A.P.; Bouwmeester, H.J. Gain and loss of fruit flavor compounds produced by wild and cultivated strawberry species. Abstr. Pap. Am. Chem. Soc. 2004, 228, U51. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.J.; Zhang, Y.; Wang, L.; Bilal, A.; Shi, X.X.; Ren, Y.; Liang, C.; Zhang, X.K.; Zhang, Y.X.; Du, G.Q. Integrated transcriptome and metabolome analysis unveiled the mechanisms of xenia effect and the role of different pollens on aroma formation in ‘Yali’ pear (Pyrus bretschneideri Rehd). Sci. Hortic. 2023, 307, 111503. [Google Scholar] [CrossRef]
- Lunkenbein, S.; Salentijn, E.M.J.; Coiner, H.A.; Boone, M.J.; Krens, F.A.; Schwab, W. Up- and down-regulation of Fragaria x ananassa O-methyltransferase: Impacts on furanone and phenylpropanoid metabolism. J. Exp. Bot. 2006, 57, 2445–2453. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Feng, Y.F.; Li, S.S.; Li, D.M.; Yu, J.; Zhao, Z.Y. Jasmonate-induced MdMYC2 improves fruit aroma during storage of ‘Ruixue’ apple based on transcriptomic, metabolic and functional analyses. LWT-Food Sci. Technol. 2023, 185, 115168. [Google Scholar] [CrossRef]
- Cai, H.F.; Han, S.; Jiang, L.; Yu, M.L.; Ma, R.J.; Yu, Z.F. 1-MCP treatment affects peach fruit aroma metabolism as revealed by transcriptomics and metabolite analyses. Food Res. Int. 2019, 122, 573–584. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.Y.; Song, Z.Y.; Li, Q.M.; Li, J.; Chen, W.X.; Li, X.P. Physiological and transcriptomic analysis reveals the roles of 1-MCP in the ripening and fruit aroma quality of banana fruit (Fenjiao). Food Res. Int. 2020, 130, 108968. [Google Scholar] [CrossRef] [PubMed]
- Xi, W.P.; Zhang, B.; Shen, J.Y.; Sun, C.D.; Xu, C.J.; Chen, K.S. Intermittent warming alleviated the loss of peach fruit aroma-related esters by regulation of AAT during cold storage. Postharvest Biol. Technol. 2012, 74, 42–48. [Google Scholar] [CrossRef]
- Lu, H.Y.; Luo, Z.S.; Li, D.; Jiang, Y.H.; Li, L. FaMYB11 promotes the accumulation of volatile esters by regulating FaLOX5 during strawberry (Fragaria × ananassa) ripening. Postharvest Biol. Technol. 2021, 178, 111560. [Google Scholar] [CrossRef]
Gene Name | Sequences | |
---|---|---|
FaAAT | F | GGGAGGACATCATGGATTG |
R | CTAGATTCACCCACGCTTC | |
FaOMT | F | CACCAGACACTAGCCTTGCC |
R | GGAATCCAGAACCCTTAGCC | |
FaQR | F | AACAATAGTAGGTCCAGCAA |
R | ACATACAAGGGAAAGGAAA | |
FaNES | F | TGGGTCGTATGTAAGGTGC |
R | TGAATGATGCTGGAAATGG |
Name | Threshold | Storage Time | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control Group | 0 h | 3 h | 6 h | 9 h | 12 h | 1 d | 2 d | 3 d | 6 d | 9 d | 12 d | 15 d | |
Hexanal | 5 | 4.12 | 3.91 | 2.99 | 3.54 | 5.69 | 3.98 | 6.39 | 5.41 | 3.61 | 6.87 | 3.34 | 4.30 |
Ethyl hexanoate | 5 | 5.13 | 4.31 | 4.19 | 5.80 | 2.79 | 13.05 | 6.11 | 3.05 | 1.98 | 4.88 | 13.89 | 18.59 |
Hexan-1-ol | 5.6 | 1.80 | 1.65 | 0.75 | 0.46 | 0.84 | 0.62 | 0.42 | 2.22 | 0.43 | 0.51 | 1.29 | 0.53 |
Nonanal | 8 | 0.54 | 0.00 | 0.38 | 0.63 | 0.85 | 0.95 | 4.88 | 3.06 | 4.75 | 1.38 | 2.19 | 4.41 |
Linalool | 6 | 11.97 | 13.26 | 15.46 | 17.76 | 21.39 | 19.81 | 12.80 | 14.75 | 9.79 | 11.91 | 8.15 | 11.18 |
4-Methoxy-2,5-dimethyl furan-3(2H)-one | 16 | 0.41 | 0.08 | 0.45 | 0.50 | 0.51 | 0.94 | 0.69 | 0.24 | 0.32 | 0.57 | 1.15 | 1.59 |
Nerolidol | 10 | 0.67 | 0.15 | 0.00 | 0.59 | 0.39 | 0.79 | 0.29 | 0.25 | 0.24 | 0.16 | 0.67 | 0.00 |
Ethyl cinnamate | 17 | 0.66 | 0.41 | 0.44 | 0.38 | 0.27 | 1.42 | 1.13 | 0.58 | 0.60 | 1.02 | 2.31 | 5.42 |
Ultrasonic Group | 0 h | 3 h | 6 h | 9 h | 12 h | 1 d | 2 d | 3 d | 6 d | 9 d | 12 d | 15 d | |
Hexanal | 5 | 3.40 | 5.60 | 4.48 | 4.69 | 6.27 | 3.50 | 4.64 | 3.76 | 4.46 | 7.21 | 4.73 | 4.63 |
Ethyl hexanoate | 5 | 5.00 | 4.84 | 4.75 | 7.84 | 8.47 | 7.40 | 5.91 | 5.72 | 3.70 | 8.25 | 16.57 | 20.74 |
Hexan-1-ol | 5.6 | 0.80 | 1.17 | 0.48 | 0.50 | 0.62 | 2.62 | 1.04 | 2.27 | 0.37 | 0.75 | 0.80 | 1.11 |
Nonanal | 8 | 0.55 | 0.00 | 0.00 | 0.40 | 1.46 | 0.93 | 2.75 | 6.67 | 3.25 | 4.33 | 1.30 | 5.20 |
Linalool | 6 | 13.55 | 13.76 | 10.62 | 14.56 | 23.92 | 16.35 | 15.90 | 15.21 | 14.77 | 15.22 | 13.20 | 15.23 |
4-Methoxy-2,5-dimethyl furan-3(2H)-one | 16 | 0.18 | 0.42 | 0.18 | 0.17 | 1.32 | 1.39 | 0.18 | 0.24 | 0.23 | 0.49 | 1.00 | 1.18 |
Nerolidol | 10 | 0.15 | 0.41 | 0.00 | 0.20 | 1.92 | 2.03 | 0.47 | 0.44 | 0.47 | 0.60 | 0.23 | 1.49 |
Ethyl cinnamate | 17 | 0.57 | 0.33 | 0.35 | 0.42 | 1.09 | 1.60 | 0.64 | 0.89 | 0.81 | 1.86 | 6.02 | 6.28 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Liu, S.; Kuang, H.; Zhang, J.; Wang, B.; Wang, S. Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest. Foods 2024, 13, 2231. https://doi.org/10.3390/foods13142231
Li Y, Liu S, Kuang H, Zhang J, Wang B, Wang S. Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest. Foods. 2024; 13(14):2231. https://doi.org/10.3390/foods13142231
Chicago/Turabian StyleLi, Yutong, Siyue Liu, Huiyu Kuang, Junyi Zhang, Bei Wang, and Shaojia Wang. 2024. "Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest" Foods 13, no. 14: 2231. https://doi.org/10.3390/foods13142231
APA StyleLi, Y., Liu, S., Kuang, H., Zhang, J., Wang, B., & Wang, S. (2024). Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest. Foods, 13(14), 2231. https://doi.org/10.3390/foods13142231