Antioxidant Effects and Probiotic Properties of Latilactobacillus sakei MS103 Isolated from Sweet Pickled Garlic
Abstract
1. Introduction
2. Materials and Methods
2.1. Latilactobacillus sakei MS103 Strains and Sample Preparation
2.2. Physiological Functional Properties of L. sakei MS103
2.2.1. L. sakei MS103 Tolerance to Pepsin, Bile, Lysozyme, and H2O2
2.2.2. L. sakei MS103 Auto-Aggregation Activity
2.2.3. L. sakei MS103 Co-Aggregation Activity
2.2.4. L. sakei MS103 Surface Hydrophobicity Characteristics
2.2.5. Adhesion of L. sakei MS103 to HT-29 and HGE Cells
2.2.6. Antibiotic Resistance
2.3. Antibacterial Activity of L. sakei MS103 as Based on Inhibition of P. gingivalis Biofilm Formation
2.4. Antioxidant Activity In Vitro
2.4.1. DPPH Free Radical-Scavenging Activity (RSA)
2.4.2. ABTS Radical Scavenging Assay (ABTS-RSA)
2.4.3. Hydroxyl Radical Scavenging Assay
2.4.4. Superoxide Anion Radical Scavenging Assay
2.4.5. Ferrous Ion-Chelating (FIC) Assay
2.5. Antioxidant Properties of L. sakei MS103 as Assessed Using the H2O2-Induced Oxidative Damage RAW 264.7 Cell Model
2.5.1. Cytotoxicity Text
2.5.2. Assays for Measuring Glutathione (GSH) and Malondialdehyde (MDA) Levels
2.6. RNA Extraction and gshR4, Gpx, npx, and gshR2 Gene Expression
2.7. Statistical Analysis
3. Results and Discussion
3.1. Characterization of L. sakei MS103
3.2. Antibacterial Activity of L. sakei MS103 against P. gingivalis Biofilm Formation
3.3. Results of In Vitro Assays of Antioxidant Activity Induced by L. sakei MS103 Treatment
3.4. RAW 264.7 Cell-Protective L. sakei MS103 Antioxidant Properties
3.4.1. Effect of L. sakei MS103 on RAW 264.7 Cell Viability and Proliferation
3.4.2. L. sakei MS103 Antioxidant Effects on RAW 264.7 Cell GSH and MDA Levels
3.5. Gene Expression Changes in H2O2-Exposed RAW 264.7 Cells after L. sakei MS103 Treatment
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kumar, M.; Ghosh, M.; Ganguli, A. Mitogenic response and probiotic characteristics of lactic acid bacteria isolated from indigenously pickled vegetables and fermented beverages. World J. Microbiol. Biotechnol. 2012, 28, 703–711. [Google Scholar] [CrossRef] [Scilit]
- Mir, S.; Raja, J.; Masoodi, F.A. Fermented Vegetables, a Rich Repository of Beneficial Probiotics—A Review. Ferment. Technol. 2018, 7, 1–6. [Google Scholar] [CrossRef]
- Rahman, M.S. Allicin and Other Functional Active Components in Garlic: Health Benefits and Bioavailability. Int. J. Food Prop. 2007, 10, 245–268. [Google Scholar] [CrossRef] [Scilit]
- Huang, T.-T.; Wu, Z.; Wenxue, Z. Effects of garlic addition on bacterial communities and the conversions of nitrate and nitrite in a simulated pickle fermentation system. Food Control. 2020, 113, 107215. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Ning, Y.; Liu, D.; Yan, A.; Wang, Z.; Wang, S.; Miao, M.; Zhu, H.; Jia, Y. Metabolic mechanism of phenyllactic acid naturally occurring in Chinese pickles. Food Chem. 2015, 186, 265–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Behera, S.S.; El Sheikha, A.F.; Hammami, R.; Kumar, A. Traditionally fermented pickles: How the microbial diversity associated with their nutritional and health benefits? J. Funct. Foods 2020, 70, 103971. [Google Scholar] [CrossRef] [Scilit]
- An, F.; Sun, H.; Wu, J.; Zhao, C.; Li, T.; Huang, H.; Fang, Q.; Mu, E.; Wu, R. Investigating the core microbiota and its influencing factors in traditional Chinese pickles. Food Res. Int. 2021, 147, 110543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Z.; Chen, H.; Wang, X.; Lin, X.; Ji, C.; Li, S.; Liang, H. Effects of different temperatures on bacterial diversity and volatile flavor compounds during the fermentation of suancai, a traditional fermented vegetable food from northeastern China. Lwt Food Sci. Technol. 2020, 118, 108773. [Google Scholar] [CrossRef] [Scilit]
- Modi, M. Role of Lactic Acid Bacteria as Probiotics in Health and Disease. La Prensa Med. 2015, 100, 1–9. [Google Scholar] [CrossRef]
- Gálvez, A.; Abriouel, H.; López, R.L.; Ben Omar, N. Bacteriocin-based strategies for food biopreservation. Int. J. Food Microbiol. 2007, 120, 51–70. [Google Scholar] [CrossRef] [Scilit]
- Mathur, H.; Beresford, T.P.; Cotter, P.D. Health Benefits of Lactic Acid Bacteria (LAB) Fermentates. Nutrients 2020, 12, 1679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morgan, S.M.; Galvin, M.; Kelly, J.; Ross, R.P.; Hill, C. Development of a Lacticin 3147–Enriched Whey Powder with Inhibitory Activity against Foodborne Pathogens. J. Food Prot. 1999, 62, 1011–1016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.; Fugaban, J.I.I.; Holzapfel, W.H.; Todorov, S.D. Selection of Beneficial Bacterial Strains with Potential as Oral Probiotic Candidates. Probiotics Antimicrob. Proteins 2022, 14, 1077–1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chow, Y.C.; Yam, H.C.; Gunasekaran, B.; Lai, W.Y.; Wo, W.Y.; Agarwal, T.; Ong, Y.Y.; Cheong, S.L.; Tan, S.-A. Implications of Porphyromonas gingivalis peptidyl arginine deiminase and gingipain R in human health and diseases. Front. Cell. Infect. Microbiol. 2022, 12, 1456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishra, V.; Shah, C.; Mokashe, N.; Chavan, R.; Yadav, H.; Prajapati, J. Probiotics as potential antioxidants: A systematic review. J. Agric. Food Chem. 2015, 63, 3615–3626. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wu, Y.; Wang, Y.; Xu, H.; Mei, X.; Yu, D.; Wang, Y.; Li, W. Antioxidant Properties of Probiotic Bacteria. Nutrients 2017, 9, 521. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.T.; Kim, J.W.; Kim, S.I.; Kim, S.; Nguyen, T.H.; Kang, C.H. Antioxidant and Anti-Inflammatory Effect and Probiotic Properties of Lactic Acid Bacteria Isolated from Canine and Feline Feces. Microorganisms 2021, 9, 1971. [Google Scholar] [CrossRef] [Scilit]
- Amaretti, A.; di Nunzio, M.; Pompei, A.; Raimondi, S.; Rossi, M.; Bordoni, A. Antioxidant properties of potentially probiotic bacteria: In vitro and in vivo activities. Appl. Microbiol. Biotechnol. 2013, 97, 809–817. [Google Scholar] [CrossRef] [Scilit]
- Feng, T.; Wang, J. Oxidative stress tolerance and antioxidant capacity of lactic acid bacteria as probiotic: A systematic review. Gut Microbes 2020, 12, 1801944. [Google Scholar] [CrossRef] [Scilit]
- Ismail, A.S.; Hooper, L.V. Epithelial cells and their neighbors. IV. Bacterial contributions to intestinal epithelial barrier integrity. Am. J. Physiol. Gastrointest Liver Physiol. 2005, 289, G779–G784. [Google Scholar] [CrossRef] [Scilit]
- Prado, C.; Michels, M.; Ávila, P.; Burger, H.; Milioli, M.V.M.; Dal-Pizzol, F. The protective effects of fecal microbiota transplantation in an experimental model of necrotizing enterocolitis. J. Pediatr. Surg. 2019, 54, 1578–1583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, Y.-F.; Kim, H.; Kim, H.R.; Gim, M.G.; Chung, D.K. Different immune regulatory potential of Lactobacillus plantarum and Lactobacillus sakei isolated from kimchi. J. Microbiol. Biotechnol. 2014, 24, 1629–1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, L.; Chen, Y.; Duan, H.; Qiao, N.; Wang, G.; Zhao, J.; Zhai, Q.; Tian, F.; Chen, W. Latilactobacillus sakei: A candidate probiotic with a key role in food fermentations and health promotion. Crit. Rev. Food Sci. Nutr. 2022, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Champomier-Vergès, M.C.; Chaillou, S.; Cornet, M.; Zagorec, M. Erratum to ”Lactobacillus sakei: Recent developments and future prospects“: [Research in Microbiology 152 (2001) 839]. Res. Microbiol. 2002, 153, 115–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aslim, B.; Onal, D.; Beyatli, Y. Factors influencing autoaggregation and aggregation of Lactobacillus delbrueckii subsp. bulgaricus isolated from handmade yogurt. J. Food Prot. 2007, 70, 223–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Del Re, B.; Sgorbati, B.; Miglioli, M.; Palenzona, D. Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacterium longum. Lett. Appl. Microbiol. 2000, 31, 438–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vlková, E.; Rada, V.; Šmehilová, M.; Killer, J. Auto-aggregation and co-aggregation ability in bifidobacteria and clostridia. Folia Microbiol. 2008, 53, 263–269. [Google Scholar] [CrossRef] [Scilit]
- Bautista-Gallego, J.; Arroyo-López, F.N.; Rantsiou, K.; Jiménez-Díaz, R.; Garrido-Fernández, A.; Cocolin, L. Screening of lactic acid bacteria isolated from fermented table olives with probiotic potential. Food Res. Int. 2013, 50, 135–142. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Chen, L.; Chen, L.; Ren, X.; Ge, H.; Li, B.; Ma, G.; Ke, X.; Zhu, J.; Li, L.; et al. Potential probiotic characterization of Lactobacillus reuteri from traditional Chinese highland barley wine and application for room-temperature-storage drinkable yogurt. J. Dairy Sci. 2018, 101, 5780–5788. [Google Scholar] [CrossRef] [Scilit]
- Kahlmeter, G.; Brown, D.F.; Goldstein, F.W.; MacGowan, A.P.; Mouton, J.W.; Odenholt, I.; Rodloff, A.; Soussy, C.J.; Steinbakk, M.; Soriano, F.; et al. European Committee on Antimicrobial Susceptibility Testing (EUCAST) Technical Notes on antimicrobial susceptibility testing. Clin. Microbiol. Infect. 2006, 12, 501–503. [Google Scholar] [CrossRef] [Scilit]
- Sui, L.; Zhu, X.; Wu, D.; Ma, T.; Tuo, Y.; Jiang, S.; Qian, F.; Mu, G. In vitro assessment of probiotic and functional properties of Bacillus coagulans T242. Food Biosci. 2020, 36, 100675. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.J.; Yu, H.H.; Kim, Y.J.; Lee, N.K.; Paik, H.D. Anti-Biofilm Activity of Grapefruit Seed Extract against Staphylococcus aureus and Escherichia Coli. J. Microbiol. Biotechnol. 2019, 29, 1177–1183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, W.; Xing, Z.; Li, C.; Wang, J.; Wang, Y. Molecular mechanisms and in vitro antioxidant effects of Lactobacillus plantarum MA2. Food Chem. 2017, 221, 1642–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X. Improved pyrogallol autoxidation method: A reliable and cheap superoxide-scavenging assay suitable for all antioxidants. J Agric. Food Chem. 2012, 60, 6418–6424. [Google Scholar] [CrossRef] [Scilit]
- Duan, Y.; Ying, Z.; He, F.; Ying, X.; Jia, L.; Yang, G. A new skeleton flavonoid and a new lignan from Portulaca oleracea L. and their activities. Fitoterapia 2021, 153, 104993. [Google Scholar] [CrossRef] [Scilit]
- Luan, C.; Jiang, N.; Zhou, X.; Zhang, C.; Zhao, Y.; Li, Z.; Li, C. Antibacterial and anti-biofilm activities of probiotic Lactobacillus curvatus BSF206 and Pediococcus pentosaceus AC1-2 against Streptococcus mutans. Microb. Pathog. 2022, 164, 105446. [Google Scholar] [CrossRef] [Scilit]
- Luan, C.; Yan, J.; Jiang, N.; Zhang, C.; Geng, X.; Li, Z.; Li, C. Leuconostoc mesenteroides LVBH107 Antibacterial Activity against Porphyromonas gingivalis and Anti-Inflammatory Activity against P. gingivalis Lipopolysaccharide-Stimulated RAW 264.7 Cells. Nutrients 2022, 14, 2584. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.W. Regression analysis for continuous independent variables in medical research: Statistical standard and guideline of Life Cycle Committee. Life Cycle 2022, 2, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Gong, W.; Xu, C.; Zhu, Z.; Peng, Y.; Xie, C. Probiotic assessment and antioxidant characterization of Lactobacillus plantarum GXL94 isolated from fermented chili. Front. Microbiol. 2022, 13, 997940. [Google Scholar] [CrossRef] [Scilit]
- Angmo, K.; Kumari, A.; Savitri; Bhalla, T.C. Probiotic characterization of lactic acid bacteria isolated from fermented foods and beverage of Ladakh. LWT Food Sci. Technol. 2016, 66, 428–435. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.S.; Kim, S.H. Anti-inflammatory and Anti-osteoporotic Potential of Lactobacillus plantarum A41 and L. fermentum SRK414 as Probiotics. Probiotics Antimicrob. Proteins 2020, 12, 623–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maldonado, N.C.; Silva de Ruiz, C.; Claudia Otero, M.; Sesma, F.; Elena Nader-Macias, M. Lactic acid bacteria isolated from young calves—Characterization and potential as probiotics. Res. Vet. Sci. 2012, 92, 342–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rijnaarts, H.H.; Norde, W.; Bouwer, E.J.; Lyklema, J.; Zehnder, A.J. Bacterial Adhesion under Static and Dynamic Conditions. Appl Environ. Microbiol 1993, 59, 3255–3265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Chen, Y.; Chen, Z.; Zhou, Q.; Wei, F.; Li, P.; Gu, Q. Antioxidant properties and molecular mechanisms of Lactiplantibacillus plantarum ZJ316: A potential probiotic resource. LWT 2023, 187, 115269. [Google Scholar] [CrossRef] [Scilit]
- Dlamini, Z.C.; Langa, R.L.S.; Aiyegoro, O.A.; Okoh, A.I. Safety Evaluation and Colonisation Abilities of Four Lactic Acid Bacteria as Future Probiotics. Probiotics Antimicrob. Proteins 2019, 11, 397–402. [Google Scholar] [CrossRef] [Scilit]
- Boirivant, M.; Strober, W. The mechanism of action of probiotics. Curr. Opin. Gastroenterol. 2007, 23, 679–692. [Google Scholar] [CrossRef] [Scilit]
- Kakisu, E.; Bolla, P.; Abraham, A.; de Urraza, P.; De Antoni, G. Lactobacillus plantarum isolated from kefir: Protection of cultured Hep-2 cells against Shigella invasion. Int. Dairy J. 2013, 33, 22–26. [Google Scholar] [CrossRef] [Scilit]
- Mack, D.R.; Michail, S.; Wei, S.; McDougall, L.; Hollingsworth, M.A. Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am. J. Physiol. 1999, 276, G941–G950. [Google Scholar] [CrossRef] [Scilit]
- Servin, A.L.; Coconnier, M.H. Adhesion of probiotic strains to the intestinal mucosa and interaction with pathogens. Best Pract. Res. Clin. Gastroenterol. 2003, 17, 741–754. [Google Scholar] [CrossRef] [Scilit]
- CLSL. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, NY, USA, 2020. [Google Scholar]
- Yüceer, Ö.; Özden Tuncer, B. Determination of Antibiotic Resistance and Biogenic Amine Production of Lactic Acid Bacteria Isolated from Fermented T urkish Sausage (Sucuk). J. Food Saf. 2015, 35, 276–285. [Google Scholar] [CrossRef] [Scilit]
- Anisimova, E.A.; Yarullina, D.R. Antibiotic Resistance of Lactobacillus Strains. Curr. Microbiol. 2019, 76, 1407–1416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merino, L.; Trejo, F.M.; De Antoni, G.; Golowczyc, M.A. Lactobacillus strains inhibit biofilm formation of Salmonella sp. isolates from poultry. Food Res. Int. 2019, 123, 258–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, A.R.; Kang, M.; Yoo, Y.-J.; Yun, C.-H.; Perinpanayagam, H.; Kum, K.-Y.; Han, S.H. Lactobacillus plantarum lipoteichoic acid disrupts mature Enterococcus faecalis biofilm. J. Microbiol. 2020, 58, 314–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, S.; Park, O.-J.; Kim, A.R.; Ahn, K.B.; Lee, D.; Kum, K.-Y.; Yun, C.-H.; Han, S.H. Lipoteichoic acids of lactobacilli inhibit Enterococcus faecalis biofilm formation and disrupt the preformed biofilm. J. Microbiol. 2019, 57, 310–315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hyun, J.-H.; Woo, I.-K.; Kim, K.-T.; Park, Y.-S.; Kang, D.-K.; Lee, N.-K.; Paik, H.-D. Antioxidant and immunostimulatory effect of heat-treated paraprobiotics Latilactobacillus sakei KU15041 and Latilactobacillus curvatus KU15003. Res. Sq. 2023, 43, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Qiao, Y.; Peng, Q.; Dia, V.P.; Shi, B. Probiotic activity of ropy Lactiplantibacillus plantarum NA isolated from Chinese northeast sauerkraut and comparative evaluation of its live and heat-killed cells on antioxidant activity and RAW 264.7 macrophage stimulation. Food Funct. 2023, 14, 2481–2495. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Xie, F.; Rolston, R.; Moreira, P.I.; Nunomura, A.; Zhu, X.; Smith, M.A.; Perry, G. Prevention and treatment of Alzheimer disease and aging: Antioxidants. Mini Rev. Med. Chem. 2007, 7, 171–180. [Google Scholar] [CrossRef] [Scilit]
- Rival, S.G.; Boeriu, C.G.; Wichers, H.J. Caseins and casein hydrolysates. 2. Antioxidative properties and relevance to lipoxygenase inhibition. J. Agric. Food Chem. 2001, 49, 295–302. [Google Scholar] [CrossRef] [Scilit]
- DÜz, M.; DoĞan, Y.N.; DoĞan, İ. Antioxidant activitiy of Lactobacillus plantarum, Lactobacillus sake and Lactobacillus curvatus strains isolated from fermented Turkish Sucuk. An. Acad. Bras. Cienc. 2020, 92, e20200105. [Google Scholar] [CrossRef] [Scilit]
- Rwubuzizi, R.; Kim, H.; Holzapfel, W.H.; Todorov, S.D. Beneficial, safety, and antioxidant properties of lactic acid bacteria: A next step in their evaluation as potential probiotics. Heliyon 2023, 9, e15610. [Google Scholar] [CrossRef] [Scilit]
- Lin, M.Y.; Yen, C.L. Antioxidative ability of lactic acid bacteria. J. Agric. Food Chem. 1999, 47, 1460–1466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, C.-F.; Pan, T.-M. In vitro effects of lactic acid bacteria on cancer cell viability and antioxidant activity. J. Food Drug Anal. 2010, 18, 8. [Google Scholar] [CrossRef] [Scilit]
- Tur, J.; Pereira-Lopes, S.; Vico, T.; Marín, E.A.; Muñoz, J.P.; Hernández-Alvarez, M.; Cardona, P.J.; Zorzano, A.; Lloberas, J.; Celada, A. Mitofusin 2 in Macrophages Links Mitochondrial ROS Production, Cytokine Release, Phagocytosis, Autophagy, and Bactericidal Activity. Cell Rep. 2020, 32, 108079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, N.; Ganesan, R.; Hegedűs, C.; Kovács, K.; Kufer, T.A.; Virág, L. Programmed necrotic cell death of macrophages: Focus on pyroptosis, necroptosis, and parthanatos. Redox Biol. 2019, 26, 101239. [Google Scholar] [CrossRef] [Scilit]
- Almeida, L.T.; Ferraz, A.C.; da Silva Caetano, C.C.; da Silva Menegatto, M.B.; Dos Santos Pereira Andrade, A.C.; Lima, R.L.S.; Camini, F.C.; Pereira, S.H.; da Silva Pereira, K.Y.; de Mello Silva, B.; et al. Zika virus induces oxidative stress and decreases antioxidant enzyme activities in vitro and in vivo. Virus Res. 2020, 286, 198084. [Google Scholar] [CrossRef] [Scilit]
- Grom, A.A.; Mellins, E.D. Macrophage activation syndrome: Advances towards understanding pathogenesis. Curr. Opin. Rheumatol. 2010, 22, 561–566. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Qiu, Z.; Wang, Y.; Guo, C.; Cai, X.; Zhang, Y.; Liu, L.; Xue, H.; Tang, J. Tea polyphenols alleviate hydrogen peroxide-induced oxidative stress damage through the Mst/Nrf2 axis and the Keap1/Nrf2/HO-1 pathway in murine RAW264.7 cells. Exp. Ther. Med. 2021, 22, 1473. [Google Scholar] [CrossRef] [Scilit]
- Jänsch, A.; Korakli, M.; Vogel, R.F.; Gänzle, M.G. Glutathione reductase from Lactobacillus sanfranciscensis DSM20451T: Contribution to oxygen tolerance and thiol exchange reactions in wheat sourdoughs. Appl. Environ. Microbiol. 2007, 73, 4469–4476. [Google Scholar] [CrossRef] [Scilit]
- Kang, T.S.; Korber, D.R.; Tanaka, T. Influence of oxygen on NADH recycling and oxidative stress resistance systems in Lactobacillus panis PM1. Amb Express 2013, 3, 1–9. [Google Scholar] [CrossRef] [Scilit]






| Gene | Primer Sequence (5′–3′) |
|---|---|
| β-actin | F: GTGGGCCGCCCTAGGCACCAG |
| R: GGAGGAAGAGGATGCGGCAGT | |
| Gpx | F: GCGAGCTCATGGCAGAATCAGTGTATGATTT |
| R: CCCAAGCTTTTAATCTTCTGAACGATCAGCC | |
| gshR2 | F: GCGAGCTCATGTCAGAAAAATTTGACGTTGT |
| R: CCCAAGCTTTTAAATTGCTGACCAAACGG | |
| gshR4 | F: GCGAGCTCATGACAAACAAATACGATTACGATGTG |
| R: CCCAAGCTTTTAAGCCCGGTGCCAAGC | |
| npx | F: GCGAGCTCATGGCAAAAATTATTATTGT |
| R: CCCAAGCTTCTAGTTAGTGGCTAAAGTTTGT |
| Antimicrobial Agent | Disk Content (μg) | Criteria of Inhibition Zone Diameters (mm) | Detection Result | ||||
|---|---|---|---|---|---|---|---|
| Group | Drug | R | I | S | Inhibition Zone (mm) | Sensibility * | |
| Glycopeptis | Vancomycin | 30 | ≤14 | - | ≥15 | 19.9 | S |
| Lipopeptids | Polymyxin B | 300 | ≤8 | 9–11 | ≥12 | 30.1 | S |
| Ansamycins | Rifampicin | 5 | ≤16 | 17–19 | ≥20 | 0 | R |
| Chloramphenicol | Chloramphenicol | 30 | ≤13 | 14–17 | ≥18 | 13.0 | R |
| Cephems | Cefazolin | 30 | ≤19 | 20–22 | ≥23 | 15.6 | R |
| Cefuroxime | 30 | ≤14 | 15–22 | ≥23 | 0 | R | |
| Ceftriaxone | 30 | ≤19 | 20–22 | ≥23 | 0 | R | |
| Cefoperzone | 75 | ≤15 | 16–20 | ≥21 | 19.7 | I | |
| Ceftazidime | 30 | ≤17 | 18–20 | ≥21 | 21.9 | S | |
| Macrolides | Doxycycline | 30 | ≤12 | 13–15 | ≥16 | 13.2 | I |
| Tetracyclins | Erythromcin | 15 | ≤15 | 16–20 | ≥21 | 16.4 | I |
| Minocyline | 30 | ≤12 | 13–15 | ≥16 | 21.3 | S | |
| Tetracycline | 30 | ≤11 | 12–14 | ≥15 | 0 | R | |
| β-Lactams penicillins | Penicillin | 10 | ≤28 | - | ≥29 | 18.5 | R |
| Piperacillin | 100 | ≤17 | 18–20 | ≥21 | 12.7 | R | |
| Ampicillin | 10 | ≤11 | 12–14 | ≥15 | 0 | R | |
| Aminoglycosides | Streptomcin | 10 | ≤12 | 13–14 | ≥15 | 13.8 | I |
| Gentamicin | 10 | ≤12 | 13–14 | ≥15 | 26.4 | S | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Chen, C.; Li, Y.; Li, Z.; Li, C.; Luan, C. Antioxidant Effects and Probiotic Properties of Latilactobacillus sakei MS103 Isolated from Sweet Pickled Garlic. Foods 2023, 12, 4276. https://doi.org/10.3390/foods12234276
Li H, Chen C, Li Y, Li Z, Li C, Luan C. Antioxidant Effects and Probiotic Properties of Latilactobacillus sakei MS103 Isolated from Sweet Pickled Garlic. Foods. 2023; 12(23):4276. https://doi.org/10.3390/foods12234276
Chicago/Turabian StyleLi, Heng, Changlin Chen, Yuanxin Li, Zhengqiang Li, Chen Li, and Chang Luan. 2023. "Antioxidant Effects and Probiotic Properties of Latilactobacillus sakei MS103 Isolated from Sweet Pickled Garlic" Foods 12, no. 23: 4276. https://doi.org/10.3390/foods12234276
APA StyleLi, H., Chen, C., Li, Y., Li, Z., Li, C., & Luan, C. (2023). Antioxidant Effects and Probiotic Properties of Latilactobacillus sakei MS103 Isolated from Sweet Pickled Garlic. Foods, 12(23), 4276. https://doi.org/10.3390/foods12234276

