Effects of Cheonggukjang (Fermented Soybean) on the Development of Colitis-Associated Colorectal Cancer in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of the CJ
2.2. AOM/DSS-Induced Colorectal Cancer Model and CJ Treatment
2.3. ELISA Analysis
2.4. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.5. Western Blotting
2.6. Hematoxylin & Eosin (H&E) Staining and Immunohistochemistry
2.7. Statistical Analysis
3. Results and Discussion
3.1. CJ Attenuates Pathological Symptoms in Mice with AOM/DSS-Induced CAC
3.2. CJ Suppresses Tumorigenesis in AOM/DSS-Induced CAC Mouse Model
3.3. CJ Modulates the Expression of Inflammatory Cytokines in AOM/DSS-Induced CAC Mice
3.4. CJ Suppresses Activation of NF-κB Signaling in AOM/DSS-Induced CAC Mice
3.5. CJ Improves Intestinal Integrity in Mice with AOM/DSS-Induced CAC
3.6. CJ Suppresses Tumor Growth by Regulating Apoptosis and Proliferation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviation
CRC | Colorectal Cancer |
IBD | Inflammatory Bowel Disease |
CAC | Colitis-Associated Colorectal Cancer |
CJ | Cheonggukjang |
γ-PGA | poly γ-glutamic acid |
DSS | Dextran Sulfate Sodium |
AOM | Azoxymethane |
NOR | Normal |
CON | Control |
PC | Positive Control |
5-ASA | 5-Aminosalicylic acid |
qRT-PCR | Quantitative Real-Time PCR |
H&E | Hematoxylin & Eosin |
NF-κB | Nuclear Factor-κB |
iNOS | Inducible Nitric Oxide Synthase |
COX-2 | Cyclooxygenase |
References
- Siegel, R.L.; Miller, K.D.; Goding Sauer, A.; Fedewa, S.A.; Butterly, L.F.; Anderson, J.C.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 145–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, S.; Won, Y.J.; Lee, J.J.; Jung, K.W.; Kong, H.J.; Im, J.S.; Seo, H.G. Community of Population-Based Regional Cancer Registries. Cancer Statistics in Korea: Incidence, Mortality, Survival, and Prevalence in 2018. Cancer Res. Treat. 2021, 53, 301–315. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2017, 9, 7204–7218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lasry, A.; Zinger, A.; Ben-Neriah, Y. Inflammatory networks underlying colorectal cancer. Nat. Immunol. 2016, 17, 230–240. [Google Scholar] [CrossRef] [PubMed]
- Rieder, F.; Fiocchi, C.; Rogler, G. Mechanisms, Management, and Treatment of Fibrosis in Patients with Inflammatory Bowel Diseases. Gastroenterology 2017, 152, 340–350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guan, Q. A Comprehensive Review and Update on the Pathogenesis of Inflammatory Bowel Disease. J. Immunol. Res. 2019, 2019, 7247238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schetter, A.J.; Heegaard, N.H.; Harris, C.C. Inflammation and cancer: Interweaving microRNA, free radical, cytokine and p53 pathways. Carcinogenesis 2010, 31, 37–49. [Google Scholar] [CrossRef] [Green Version]
- Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef] [Green Version]
- Teng, S.; Hao, J.; Bi, H.; Li, C.; Zhang, Y.; Zhang, Y.; Han, W.; Wang, D. The Protection of Crocin Against Ulcerative Colitis and Colorectal Cancer via Suppression of NF-κB-Mediated Inflammation. Front. Pharmacol. 2021, 12, 639458. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.S.; Hwang, C.W.; Yang, W.S.; Kim, C.H. Current Perspectives on the Physiological Activities of Fermented Soybean-Derived Cheonggukjang. Int. J. Mol. Sci. 2021, 22, 5746. [Google Scholar] [CrossRef]
- Jang, C.H.; Oh, J.; Lim, J.S.; Kim, H.J.; Kim, J.S. Fermented Soy Products: Beneficial Potential in Neurodegenerative Diseases. Foods 2021, 10, 636. [Google Scholar] [CrossRef]
- Jeong, D.Y.; Ryu, M.S.; Yang, H.J.; Park, S. γ-PGA-Rich Chungkookjang, Short-Term Fermented Soybeans: Prevents Memory Impairment by Modulating Brain Insulin Sensitivity, Neuro-Inflammation, and the Gut-Microbiome-Brain Axis. Foods 2021, 10, 221. [Google Scholar] [CrossRef]
- Lim, H.J.; Kim, H.R.; Jeong, S.J.; Yang, H.J.; Ryu, M.S.; Jeong, D.Y.; Kim, S.Y.; Jung, C.H. Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model. Foods 2022, 11, 776. [Google Scholar] [CrossRef] [PubMed]
- Lucafò, M.; Curci, D.; Franzin, M.; Decorti, G.; Stocco, G. Inflammatory Bowel Disease and Risk of Colorectal Cancer: An Overview from Pathophysiology to Pharmacological Prevention. Front. Pharmacol. 2021, 12, 772101. [Google Scholar] [CrossRef] [PubMed]
- van Staa, T.P.; Card, T.; Logan, R.F.; Leufkens, H.G. 5-Aminosalicylate use and colorectal cancer risk in inflammatory bowel disease: A large epidemiological study. Gut 2005, 54, 1573–1578. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, W.; Li, Y.; Zhang, S.; Kong, G.; Li, Z. Association between cellular immune response and spleen weight in mice with hepatocellular carcinoma. Oncol. Lett. 2021, 22, 625. [Google Scholar] [CrossRef]
- Parang, B.; Barrett, C.W.; Williams, C.S. AOM/DSS Model of Colitis-Associated Cancer. Methods Mol. Biol. 2016, 1422, 297–307. [Google Scholar]
- Chen, L.H.; Song, J.L.; Qian, Y.; Zhao, X.; Suo, H.Y.; Li, J. Increased preventive effect on colon carcinogenesis by use of resistant starch (RS3) as the carrier for polysaccharide of Larimichthys crocea swimming bladder. Int. J. Mol. Sci. 2014, 15, 817–829. [Google Scholar] [CrossRef] [Green Version]
- Cornaggia, M.; Leutner, M.; Mescoli, C.; Sturniolo, G.C.; Gullotta, R. Chronic idiopathic inflammatory bowel diseases: The histology report. Dig. Liver Dis. 2011, 43, S293–S303. [Google Scholar] [CrossRef]
- Li, Y.; Li, N.; Yu, X.; Huang, K.; Zheng, T.; Cheng, X.; Zeng, S.; Liu, X. Hematoxylin and eosin staining of intact tissues via delipidation and ultrasound. Sci. Rep. 2018, 8, 12259. [Google Scholar] [CrossRef]
- Wu, S.; Luo, W.; Wu, X.; Shen, Z.; Wang, X. Functional Phenotypes of Peritoneal Macrophages Upon AMD3100 Treatment during Colitis-Associated Tumorigenesis. Front. Med. 2022, 9, 840704. [Google Scholar] [CrossRef]
- Oh, N.S.; Lee, J.Y.; Kim, Y.T.; Kim, S.H.; Lee, J.H. Cancer-protective effect of a synbiotic combination between Lactobacillus gasseri 505 and a Cudrania tricuspidata leaf extract on colitis-associated colorectal cancer. Gut Microbes. 2020, 12, 1785803. [Google Scholar] [CrossRef]
- Zhu, J.; Paul, W.E. CD4 T cells: Fates, functions, and faults. Blood 2008, 112, 1557–1569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brantley, D.M.; Chen, C.L.; Muraoka, R.S.; Bushdid, P.B.; Bradberry, J.L.; Kittrell, F.; Medina, D.; Matrisian, L.M.; Kerr, L.D.; Yull, F.E. Nuclear factor-kappaB (NF-kappaB) regulates proliferation and branching in mouse mammary epithelium. Mol Biol Cell. 2001, 12, 1445–1455. [Google Scholar] [CrossRef] [PubMed]
- Oeckinghaus, A.; Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol. 2009, 1, a000034. [Google Scholar] [CrossRef] [PubMed]
- Slattery, M.L.; Mullany, L.E.; Sakoda, L.; Samowitz, W.S.; Wolff, R.K.; Stevens, J.R.; Herrick, J.S. The NF-κB signalling pathway in colorectal cancer: Associations between dysregulated gene and miRNA expression. J. Cancer Res. Clin. Oncol. 2018, 144, 269–283. [Google Scholar] [CrossRef] [Green Version]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Haq, S.; Khan, W.I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning from Clinical and Experimental Studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef]
- Herath, M.; Hosie, S.; Bornstein, J.C.; Franks, A.E.; Hill-Yardin, E.L. The Role of the Gastrointestinal Mucus System in Intestinal Homeostasis: Implications for Neurological Disorders. Front. Cell Infect. Microbiol. 2020, 10, 248. [Google Scholar] [CrossRef] [PubMed]
- Capaldo, C.T.; Powell, D.N.; Kalman, D. Layered defense: How mucus and tight junctions seal the intestinal barrier. J. Mol. Med. 2017, 95, 927–934. [Google Scholar] [CrossRef] [Green Version]
- Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef]
- Odenwald, M.A.; Choi, W.; Buckley, A.; Shashikanth, N.; Joseph, N.E.; Wang, Y.; Warren, M.H.; Buschmann, M.M.; Pavlyuk, R.; Hildebrand, J.; et al. ZO-1 interactions with F-actin and occludin direct epithelial polarization and single lumen specification in 3D culture. J. Cell Sci. 2017, 130, 243–259. [Google Scholar] [CrossRef] [PubMed]
- de Souza, H.S.; Fiocchi, C. Immunopathogenesis of IBD: Current state of the art. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 13–27. [Google Scholar] [CrossRef] [PubMed]
- Clay, S.L.; Fonseca-Pereira, D.; Garrett, W.S. Colorectal cancer: The facts in the case of the microbiota. J. Clin. Investig. 2022, 132, e155101. [Google Scholar] [CrossRef]
- Testa, U.; Pelosi, E.; Castelli, G. Colorectal cancer: Genetic abnormalities, tumor progression, tumor heterogeneity, clonal evolution and tumor-initiating cells. Med. Sci. 2018, 6, 31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, X.; Shen, D.; Kong, C.; Zhang, Z.; Zeng, Y.; Lin, X.; Liu, X. NF-κB suppresses apoptosis and promotes bladder cancer cell proliferation by upregulating survivin expression in vitro and in vivo. Sci. Rep. 2017, 7, 40723. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
TNF-α | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA |
IFN-γ | AGCCCTATTACAGCACAG | TTCTAACAACAAGTATCCC |
IL-6 | TGTCTATACCACTTCACAAGTCGGAG | GCACAACTCTTTTCTCATTTCCAC |
IL-1β | CAACCAACAAGTGATATTCTCCATG | GATCCACACTCTCCAGCTGCA |
IL-4 | GGTCTCAACCCCCAGCTAGT | GCCGATGATCTCTCTCAAGTGAT |
IL-10 | CTTACTGACTGGCATGAGGATCA | GCAGCTCTAGGAGCATGTGG |
iNOS | CGAAACGCTTCACTTCCAA | TGAGCCTATATTGCTGTGGCT |
COX-2 | TTTGGTCTGGTGCCTGGTC | CTGCTGGTTTGGAATAGTTGCTC |
p53 | CCCCTGTCATCTTTTGTCCCT | AGCTGGCAGAATAGCTTATTGAG |
Bcl-2 | GCTACCGTCGTGACTTCGC | CCCCACCGAACTCAAAGAAGG |
Bcl-XL | GGCACTGTGCGTGGAAAGCGTA | CCGCCGTTCTCCTGGATCCA |
Bax | AGACAGGGGCCTTTTTGCTAC | AATTCGCCGGAGACACTCG |
MUC-2 | ATGCCCACCTCCTCAAAGAC | GTAGTTTCCGTTGGAACAGTGAA |
Occludin | TCTGCTTCATCGCTTCCTTAG | GTCGGGTTCACTCCCATTA |
ZO-1 | AGGACACCAAAGCATGTGAG | GGCATTCCTGCTGGTTACA |
GAPDH | GACGGCCGCATCTTCTTGT | CAGTGCCAGCCTCGTCCCGTACAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, H.-J.; Park, I.-S.; Jeong, S.-J.; Ha, G.-S.; Yang, H.-J.; Jeong, D.-Y.; Kim, S.-Y.; Jung, C.-H. Effects of Cheonggukjang (Fermented Soybean) on the Development of Colitis-Associated Colorectal Cancer in Mice. Foods 2023, 12, 383. https://doi.org/10.3390/foods12020383
Lim H-J, Park I-S, Jeong S-J, Ha G-S, Yang H-J, Jeong D-Y, Kim S-Y, Jung C-H. Effects of Cheonggukjang (Fermented Soybean) on the Development of Colitis-Associated Colorectal Cancer in Mice. Foods. 2023; 12(2):383. https://doi.org/10.3390/foods12020383
Chicago/Turabian StyleLim, Hyeon-Ji, In-Sun Park, Su-Ji Jeong, Gwang-Su Ha, Hee-Jong Yang, Do-Youn Jeong, Seon-Young Kim, and Chan-Hun Jung. 2023. "Effects of Cheonggukjang (Fermented Soybean) on the Development of Colitis-Associated Colorectal Cancer in Mice" Foods 12, no. 2: 383. https://doi.org/10.3390/foods12020383