Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Management
2.2. Sample Collection
2.3. Experimental Detection
2.3.1. Feed and Muscle Analyses
2.3.2. Muscle Texture, Slice Analysis, and Muscle Component Analysis
2.3.3. Fluorescent Quantitative PCR
2.3.4. Plasma Biochemistry
2.4. Data Analysis
3. Results
3.1. Growth Performance
3.2. Plasma Biochemistry
3.3. Muscle Texture, Slice Analysis, and Muscle Component Analysis
3.4. Fluorescent Quantitative PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Merino, G.; Barange, M.; Blanchard, J.L.; Harle, J.; Holmes, R.; Allen, I.; Allison, E.H.; Badjeck, M.C.; Dulvy, N.K.; Holt, J.; et al. Can Marine Fisheries and Aquaculture Meet Fish Demand from a Growing Human Population in a Changing Climate? Glob. Environ. Chang. 2012, 22, 795–806. [Google Scholar] [CrossRef]
- Naylor, R.L.; Goldburg, R.J.; Primavera, J.H.; Kautsky, N.; Beveridge, M.C.M.; Clay, J.; Folke, C.; Lubchenco, J.; Mooney, H.; Troell, M. Effect of Aquaculture on World Fish Supplies. Nature 2000, 405, 1017–1024. [Google Scholar] [CrossRef]
- Tacon, A.G.J.; Metian, M. Feed Matters: Satisfying the Feed Demand of Aquaculture. Rev. Fish. Sci. Aquac. 2015, 23, 1–10. [Google Scholar] [CrossRef]
- Little, D.C.; Newton, R.W.; Beveridge, M.C.M. Aquaculture: A Rapidly Growing and Significant Source of Sustainable Food? Status, Transitions and Potential. Proc. Nutr. Soc. 2016, 75, 274–286. [Google Scholar] [CrossRef]
- Cottrell, R.S.; Blanchard, J.L.; Halpern, B.S.; Metian, M.; Froehlich, H.E. Global Adoption of Novel Aquaculture Feeds Could Substantially Reduce Forage Fish Demand by 2030. Nat. Food 2020, 1, 301–308. [Google Scholar] [CrossRef]
- Imsland, A.K.D.; Helmvig, T.; Kristjansson, G.O.; Arnason, J. Effect of Fish Protein Replacement in Diets for Juvenile Turbot Scophthalmus Maximus. Turk. J. Fish. Aquat. Sci. 2016, 16, 267–273. [Google Scholar] [CrossRef]
- Meng, F.; Li, B.; Xie, Y.; Li, M.; Wang, R. Substituting Fishmeal with Extruded Soybean Meal in Diets Did Not Affect the Growth Performance, Hepatic Enzyme Activities, but Hypoxia Tolerance of Dolly Varden (Salvelinus malma) Juveniles. Aquac. Res. 2020, 51, 379–388. [Google Scholar] [CrossRef]
- Nogales Mérida, S.; Tomás-Vidal, A.; Martínez-Llorens, S.; Jover Cerdá, M. Sunflower Meal as a Partial Substitute in Juvenile Sharpsnout Sea Bream (Diplodus puntazzo) Diets: Amino Acid Retention, Gut and Liver Histology. Aquaculture 2010, 298, 275–281. [Google Scholar] [CrossRef]
- Feizollahi, E.; Mirmahdi, R.S.; Zoghi, A.; Zijlstra, R.T.; Roopesh, M.S.; Vasanthan, T. Review of the Beneficial and Anti-Nutritional Qualities of Phytic Acid, and Procedures for Removing It from Food Products. Food Res. Int. 2021, 143, 110284. [Google Scholar] [CrossRef]
- Zheng, L.; Li, D.; Li, Z.-L.; Kang, L.-N.; Jiang, Y.-Y.; Liu, X.-Y.; Chi, Y.-P.; Li, Y.-Q.; Wang, J.-H. Effects of Bacillus Fermentation on the Protein Microstructure and Anti-Nutritional Factors of Soybean Meal. Lett. Appl. Microbiol. 2017, 65, 520–526. [Google Scholar] [CrossRef]
- Qiu, H.; Dai, M.; Chen, N.; Li, S. Apparent Digestibility of Ten Protein Ingredients for Largemouth Bass (Micropterus salmoides). Aquac. Res. 2022, 53, 6846–6854. [Google Scholar] [CrossRef]
- Carrigan, C.N.; Imperiali, B. The Engineering of Membrane-Permeable Peptides. Anal. Biochem. 2005, 341, 290–298. [Google Scholar] [CrossRef]
- Tonheim, S.K.; Espe, M.; Hamre, K.; Rønnestad, I. Pre-Hydrolysis Improves Utilisation of Dietary Protein in the Larval Teleost Atlantic Halibut (Hippoglossus hippoglossus L.). J. Exp. Mar. Biol. Ecol. 2005, 321, 19–34. [Google Scholar] [CrossRef]
- Zhuang, Y.; Zhang, W.; Zheng, J.; Tang, Z.; Li, X.; Cao, X.; Zhang, L.; Xu, W.; Mai, K.; Ai, Q. Effects of Enzymatic Hydrolysis Chicken By-Product in High Plant-Based Protein Diet on Growth Performance, Digestive Capacity, Antioxidant Capacity and Non-Specific Immunity of Juvenile Turbot (Scophthalmus maximus L.). Aquacult. Nutr. 2021, 27, 1578–1589. [Google Scholar] [CrossRef]
- Aguiar, D.H.; Bock, C.; Padovani, C.R.; Pai-Silva, M.D. MyoD, Myogenin and Proliferating Cell Nuclear Antigen Expression in Growing Nile Tilapia (Oreochromis niloticus L.). Aquac. Res. 2008, 39, 1673–1679. [Google Scholar] [CrossRef]
- Lv, H.-B.; Ma, Y.; Hu, C.-T.; Lin, Q.-Y.; Yue, J.; Chen, L.-Q.; Zhang, M.-L.; Du, Z.-Y.; Qiao, F. The Individual and Combined Effects of Hypoxia and High-Fat Diet Feeding on Nutrient Composition and Flesh Quality in Nile Tilapia (Oreochromis niloticus). Food Chem. 2021, 343, 128479. [Google Scholar] [CrossRef]
- Flos, R.; Reig, L.; Oca, J.; Ginovart, M. Influence of Marketing and Different Land-Based Systems on Gilthead Sea Bream (Sparus aurata) Quality. Aquac. Int. 2002, 10, 189–206. [Google Scholar] [CrossRef]
- López-Albors, O.; Abdel, I.; Periago, M.J.; Ayala, M.D.; Alcázar, A.G.; Graciá, C.M.; Nathanailides, C.; Vázquez, J.M. Temperature Influence on the White Muscle Growth Dynamics of the Sea Bass Dicentrarchus labrax, L. Flesh Quality Implications at Commercial Size. Aquaculture 2008, 277, 39–51. [Google Scholar] [CrossRef]
- Matarneh, S.K.; Silva, S.L.; Gerrard, D.E. New Insights in Muscle Biology That Alter Meat Quality. Annu. Rev. Anim. Biosci. 2021, 9, 355–377. [Google Scholar] [CrossRef]
- Li, H.; Hu, Z.; Liu, S.; Sun, J.; Ji, H. Influence of Dietary Soybean Meal Replacement with Yellow Mealworm (Tenebrio molitor) on Growth Performance, Antioxidant Capacity, Skin Color, and Flesh Quality of Mirror Carp (Cyprinus carpio Var. Specularis). Aquaculture 2022, 561, 738686. [Google Scholar] [CrossRef]
- Peng, K.; Fu, B.; Li, J.; Zhao, H.; Cao, J.; Huang, W.; Chen, B.; Li, X.; Peng, Z.; Wei, M. Effects of Replacing Soybean Meal and Rapeseed Meal with Faba Bean Meal on Growth Performance and Muscle Quality of Tilapia (Oreochromis niloticus). Aquac. Rep. 2022, 26, 101328. [Google Scholar] [CrossRef]
- Yu, H.; Liang, H.; Ge, X.; Zhu, J.; Wang, Y.; Ren, M.; Chen, X. Dietary Chlorella (Chlorella vulgaris) Supplementation Effectively Improves Body Color, Alleviates Muscle Inflammation and Inhibits Apoptosis in Largemouth Bass (Micropterus salmoides). Fish Shellfish. Immunol. 2022, 127, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Yun, B.; Xue, M.; Wang, J.; Wu, X.; Zheng, Y.; Han, F. Effects of Fish Meal Quality and Fish Meal Substitution by Animal Protein Blend on Growth Performance, Flesh Quality and Liver Histology of Japanese Seabass (Lateolabrax japonicus). Aquaculture 2013, 372–375, 52–61. [Google Scholar] [CrossRef]
- Peng, Z.; Yan, L.; Wei, L.; Gao, X.; Shi, L.; Ren, T.; Wang, W.; Han, Y. Effect of Dietary Chicken Gut Meal Levels on Growth Performance, Plasma Biochemical Parameters, Digestive Ability and Fillet Quality of Cyprinus Carpio. Aquac. Rep. 2022, 24, 101183. [Google Scholar] [CrossRef]
- Van Riel, A.; Nederlof, M.A.J.; Chary, K.; Wiegertjes, G.F.; De Boer, I.J.M. Feed-Food Competition in Global Aquaculture: Current Trends and Prospects. Rev. Aquac. 2023, 15, 1142–1158. [Google Scholar] [CrossRef]
- Chen, H.; Yu, J.; Ran, X.; Wu, J.; Chen, Y.; Tan, B.; Lin, S. Effects of Yellow Mealworm (Tenebrio molitor) on Growth Performance, Hepatic Health and Digestibility in Juvenile Largemouth Bass (Micropterus salmoides). Animals 2023, 13, 1389. [Google Scholar] [CrossRef]
- Li, S.; Dai, M.; Qiu, H.; Chen, N. Effects of Fishmeal Replacement with Composite Mixture of Shrimp Hydrolysate and Plant Proteins on Growth Performance, Feed Utilization, and Target of Rapamycin Pathway in Largemouth Bass, Micropterus salmoides. Aquaculture 2021, 533, 736185. [Google Scholar] [CrossRef]
- Sampaio-Oliveira, A.M.B.M.; Cyrino, J.E.P. Digestibility of Plant Protein-Based Diets by Largemouth Bass Micropterus salmoides. Aquac. Nutr. 2008, 14, 318–323. [Google Scholar] [CrossRef]
- Du, X.; Zhang, W.; He, J.; Zhao, M.; Wang, J.; Dong, X.; Fu, Y.; Xie, X.; Miao, S. The Impact of Rearing Salinity on Flesh Texture, Taste, and Fatty Acid Composition in Largemouth Bass Micropterus salmoides. Foods 2022, 11, 3261. [Google Scholar] [CrossRef]
- Yue, Y.; Chen, M.; Bao, X.; Yu, Y.; Shi, W.; Kumkhong, S.; Liu, Y.; Yang, Y.; Yu, H. Effects of Three Feed Attractants on the Growth Performance and Meat Quality of the Largemouth Bass (Micropterus salmoides). Front. Mar. Sci. 2022, 9, 1029969. [Google Scholar] [CrossRef]
- Ding, G.; Li, S.; Wang, A.; Chen, N. Effect of Chicken Haemoglobin Powder on Growth, Feed Utilization, Immunity and Haematological Index of Largemouth Bass (Micropterus salmoides). Aquac. Fish. 2020, 5, 187–192. [Google Scholar] [CrossRef]
- Zhang, Q.; Liang, H.; Longshaw, M.; Wang, J.; Ge, X.; Zhu, J.; Li, S.; Ren, M. Effects of Replacing Fishmeal with Methanotroph (Methylococcus capsulatus, Bath) Bacteria Meal (FeedKind®) on Growth and Intestinal Health Status of Juvenile Largemouth Bass (Micropterus salmoides). Fish Shellfish. Immunol. 2022, 122, 298–305. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists: Official Methods of Analysis of AOAC International, 21st ed.; AOAC: Washington, DC, USA, 2019. [Google Scholar]
- GB 5009.168-2016; Determination of Fatty Acids in Food of National Standard for Food Safety. National Health and Family Planning Commission of the People’s Republic of China State Food and Drug Administration: Beijing, China, 2016.
- Yi, C.; Liang, H.; Xu, G.; Zhu, J.; Wang, Y.; Li, S.; Ren, M.; Chen, X. Appropriate Dietary Phenylalanine Improved Growth, Protein Metabolism and Lipid Metabolism, and Glycolysis in Largemouth Bass (Micropterus salmoides). Fish Physiol. Biochem. 2022, 1–17. [Google Scholar] [CrossRef]
- Liang, H.; Xu, G.; Xu, P.; Zhu, J.; Li, S.; Ren, M. Dietary Histidine Supplementation Maintained Amino Acid Homeostasis and Reduced Hepatic Lipid Accumulation of Juvenile Largemouth Bass, Micropterus salmoides. Aquac. Nutr. 2022, 2022, 4034922. [Google Scholar] [CrossRef]
- Yu, H.H.; Liang, X.F.; Chen, P.; Wu, X.F.; Zheng, Y.H.; Luo, L.; Qin, Y.C.; Long, X.C.; Xue, M. Dietary Supplementation of Grobiotic®—A Increases Short-Term Inflammatory Responses and Improves Long-Term Growth Performance and Liver Health in Largemouth Bass (Micropterus salmoides). Aquaculture 2019, 500, 327–337. [Google Scholar] [CrossRef]
- Gu, J.; Liang, H.; Ge, X.; Xia, D.; Pan, L.; Mi, H.; Ren, M. A Study of the Potential Effect of Yellow Mealworm (Tenebrio molitor) Substitution for Fish Meal on Growth, Immune and Antioxidant Capacity in Juvenile Largemouth Bass (Micropterus salmoides). Fish Shellfish. Immunol. 2022, 120, 214–221. [Google Scholar] [CrossRef]
- Huang, D.; Liang, H.; Zhu, J.; Ren, M.; Ge, X. Transcriptome Reveals Insights into Hepatic Nutritional Metabolism and Gill Immune Responses Adapted to Cold Stress in Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus). Aquac. Rep. 2022, 26, 101297. [Google Scholar] [CrossRef]
- Yang, Y.; Xie, S.; Cui, Y.; Zhu, X.; Lei, W.; Yang, Y. Partial and Total Replacement of Fishmeal with Poultry By-Product Meal in Diets for Gibel Carp, Carassius auratus gibelio Bloch. Aquac. Res. 2006, 37, 40–48. [Google Scholar] [CrossRef]
- Riche, M. Nitrogen Utilization from Diets with Refined and Blended Poultry By-Products as Partial Fish Meal Replacements in Diets for Low-Salinity Cultured Florida Pompano, Trachinotus carolinus. Aquaculture 2015, 435, 458–466. [Google Scholar] [CrossRef]
- Kureshy, N.; Davis, D.A.; Arnold, C.R. Partial Replacement of Fish Meal with Meat-and-Bone Meal, Flash-Dried Poultry By-Product Meal, and Enzyme-Digested Poultry By-Product Meal in Practical Diets for Juvenile Red Drum. N. Am. J. Aquac. 2000, 62, 266–272. [Google Scholar] [CrossRef]
- Ji, K.; He, J.; Liang, H.; Ren, M.; Ge, X.; Masagounder, K. Response of Gibel Carp (Carassius auratus gibelio) to Increasing Levels of Dietary Lysine in Zero Fish Meal Diets. Aquacult. Nutr. 2021, 27, 49–62. [Google Scholar] [CrossRef]
- Zhu, S.; Gao, W.; Wen, Z.; Chi, S.; Shi, Y.; Hu, W.; Tan, B. Partial Substitution of Fish Meal by Clostridium Autoethanogenum Protein in the Diets of Juvenile Largemouth Bass (Micropterus salmoides). Aquac. Rep. 2022, 22, 100938. [Google Scholar] [CrossRef]
- Yu, R.; Cao, H.; Huang, Y.; Peng, M.; Kajbaf, K.; Kumar, V.; Tao, Z.; Yang, G.; Wen, C. The Effects of Partial Replacement of Fishmeal Protein by Hydrolysed Feather Meal Protein in the Diet with High Inclusion of Plant Protein on Growth Performance, Fillet Quality and Physiological Parameters of Pengze Crucian Carp (Carassius auratus Var. Pengze). Aquac. Res. 2020, 51, 636–647. [Google Scholar] [CrossRef]
- Lee, J.; Choi, I.C.; Kim, K.T.; Cho, S.H.; Yoo, J.Y. Response of Dietary Substitution of Fishmeal with Various Protein Sources on Growth, Body Composition and Blood Chemistry of Olive Flounder (Paralichthys olivaceus, Temminck & Schlegel, 1846). Fish Physiol. Biochem. 2012, 38, 735–744. [Google Scholar] [CrossRef] [PubMed]
- Boniecka, I.; Jeznach-Steinhagen, A.; Michalska, W.; Rymarz, A.; Szostak-Węgierek, D.; Niemczyk, S. Nutritional Status, Selected Nutrients Intake and Their Relationship with the Concentration of Ghrelin and Adiponectin in Patients with Diabetic Nephropathy. Nutrients 2021, 13, 4416. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, W.; et al. High Carbohydrate Diet Induced Endoplasmic Reticulum Stress and Oxidative Stress, Promoted Inflammation and Apoptosis, Impaired Intestinal Barrier of Juvenile Largemouth Bass (Micropterus salmoides). Fish Shellfish. Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef]
- Furuta, A.; Tanimoto, S. Effects of Different Heating Conditions on Texture, Protein Composition, and Extract Components of Red Seabream Pagrus major Muscle. Fish Sci. 2023, 89, 271–280. [Google Scholar] [CrossRef]
- Grajales-Lagunes, A.; Rivera-Bautista, C.; Ruiz-Cabrera, M.; Gonzalez-Garcia, R.; Ramirez-Telles, J.; Abud-Archila, M. Effect of Lactic Acid on the Meat Quality Properties and the Taste of Pork Serratus Ventralis Muscle. Agric. Food Sci. 2012, 21, 171–181. [Google Scholar] [CrossRef]
- Fan, Z.; Li, C.; Wu, D.; Li, J.; Wang, L.; Cao, D.; Miao, L.; Xie, S. Evaluation of Four Novel Protein Sources as Alternatives to Soybean Meal for Two Specifications of Cage-Farmed Grass Carp (Ctenopharyngodon idellus) Deeds: Effect on Growth Performance, Flesh Quality, and Expressions of Muscle-Related Genes. Front. Mar. Sci. 2022, 9, 935651. [Google Scholar] [CrossRef]
- Suontama, J.; Kiessling, A.; Melle, W.; Waagbø, R.; Olsen, R.E. Protein from Northern Krill (Thysanoessa inermis), Antarctic Krill (Euphausia superba) and the Arctic Amphipod (Themisto libellula) Can Partially Replace Fish Meal in Diets to Atlantic Salmon (Salmo salar) without Affecting Product Quality. Aquac. Nutr. 2007, 13, 50–58. [Google Scholar] [CrossRef]
- Tang, T.; Bai, J.; Ao, Z.; Wei, Z.; Hu, Y.; Liu, S. Effects of Dietary Paper Mulberry (Broussonetia papyrifera) on Growth Performance and Muscle Quality of Grass Carp (Ctenopharyngodon idella). Animals 2021, 11, 1655. [Google Scholar] [CrossRef]
- Li, Q.; Huang, Y.; Zhang, X.; Zou, C.; Lin, L. Improvement of Muscle Quality in Tilapia (Oreochromis niloticus) with Dietary Faba Bean (Vicia faba L.). Front. Nutr. 2023, 10, 1153323. [Google Scholar] [CrossRef]
- Arsyad, M.A.; Akazawa, T.; Nozaki, C.; Yoshida, M.; Oyama, K.; Mukai, T.; Ogawa, M. Effects of Olive Leaf Powder Supplemented to Fish Feed on Muscle Protein of Red Sea Bream. Fish Physiol. Biochem. 2018, 44, 1299–1308. [Google Scholar] [CrossRef] [PubMed]
- Basto, A.; Marques, A.; Silva, A.; Sá, T.; Sousa, V.; Oliveira, M.B.P.P.; Aires, T.; Valente, L.M.P. Nutritional, Organoleptic and Sensory Quality of Market-Sized European Sea Bass (Dicentrarchus labrax) Fed Defatted Tenebrio Molitor Larvae Meal as Main Protein Source. Aquaculture 2023, 566, 739210. [Google Scholar] [CrossRef]
- Joo, S.T.; Kim, G.D.; Hwang, Y.H.; Ryu, Y.C. Control of Fresh Meat Quality through Manipulation of Muscle Fiber Characteristics. Meat Sci. 2013, 95, 828–836. [Google Scholar] [CrossRef] [PubMed]
- Gumus, E.; Aydin, B. Effect of Poultry By-Product Meal on Growth Performance and Fatty Acid Composition of Carp (Cyprinus carpio) Fry. Turk. J. Fish. Aquat. Sci. 2013, 13, 827–834. [Google Scholar] [CrossRef] [PubMed]
- Irm, M.; Taj, S.; Jin, M.; Luo, J.; Andriamialinirina, H.J.T.; Zhou, Q. Effects of Replacement of Fish Meal by Poultry By-Product Meal on Growth Performance and Gene Expression Involved in Protein Metabolism for Juvenile Black Sea Bream (Acanthoparus schlegelii). Aquaculture 2020, 528, 735544. [Google Scholar] [CrossRef]
- Zhou, Q.; Xiong, Y.; Li, P.; Saidyleigh, M.; Yang, C.; Li, J.; Sun, C.; Zheng, X.; Liu, B.; Jiang, S.; et al. Effects of Animal Protein Feedstuffs Partially Replacing Fishmeal in the Diet of Macrobrachium nipponense. Aquac. Res. 2022, 53, 6227–6238. [Google Scholar] [CrossRef]
- Hou, Y.; Wu, Z.; Dai, Z.; Wang, G.; Wu, G. Protein Hydrolysates in Animal Nutrition: Industrial Production, Bioactive Peptides, and Functional Significance. J. Anim. Sci. Biotechnol. 2017, 8, 24. [Google Scholar] [CrossRef]
- Ichinose, T.; Lesmana, R.; Yamamoto, A.; Kobayashi, T.; Shitara, H.; Shimoyama, D.; Takatsuru, Y.; Iwasaki, T.; Shimokawa, N.; Takagishi, K.; et al. Possible Involvement of IGF-1 Signaling on Compensatory Growth of the Infraspinatus Muscle Induced by the Supraspinatus Tendon Detachment of Rat Shoulder. Physiol. Rep. 2014, 2, e00197. [Google Scholar] [CrossRef]
- Droguett, R.; Cabello-Verrugio, C.; Santander, C.; Brandan, E. TGF-β Receptors, in a Smad-Independent Manner, Are Required for Terminal Skeletal Muscle Differentiation. Exp. Cell Res. 2010, 316, 2487–2503. [Google Scholar] [CrossRef] [PubMed]
- Nikooie, R.; Jafari-Sardoie, S.; Sheibani, V.; Nejadvaziri Chatroudi, A. Resistance Training-induced Muscle Hypertrophy Is Mediated by TGF-β1-Smad Signaling Pathway in Male Wistar Rats. J. Cell. Physiol. 2020, 235, 5649–5665. [Google Scholar] [CrossRef]
- Weintraub, H.; Davis, R.; Tapscott, S.; Thayer, M.; Krause, M.; Benezra, R.; Blackwell, T.K.; Turner, D.; Rupp, R.; Hollenberg, S.; et al. The MyoD Gene Family: Nodal Point During Specification of the Muscle Cell Lineage. Science 1991, 251, 761–766. [Google Scholar] [CrossRef] [PubMed]
- Zammit, P.S. Function of the Myogenic Regulatory Factors Myf5, MyoD, Myogenin and MRF4 in Skeletal Muscle, Satellite Cells and Regenerative Myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.; Han, L.; Weng, M.; Zhu, H.; Heng, Y.; Wang, G.; Shen, Z.; Chen, X.; Fu, X.; Zhang, M.; et al. Paxbp1 Controls a Key Checkpoint for Cell Growth and Survival during Early Activation of Quiescent Muscle Satellite Cells. Proc. Natl. Acad. Sci. USA 2021, 118, e2021093118. [Google Scholar] [CrossRef]
- Lunde, I.G.; Aronsen, J.M.; Melleby, A.O.; Strand, M.E.; Skogestad, J.; Bendiksen, B.A.; Ahmed, M.S.; Sjaastad, I.; Attramadal, H.; Carlson, C.R.; et al. Cardiomyocyte-Specific Overexpression of Syndecan-4 in Mice Results in Activation of Calcineurin-NFAT Signalling and Exacerbated Cardiac Hypertrophy. Mol. Biol. Rep. 2022, 49, 11795–11809. [Google Scholar] [CrossRef]
- Gumucio, J.P.; Mendias, C.L. Atrogin-1, MuRF-1, and Sarcopenia. Endocrine 2013, 43, 12–21. [Google Scholar] [CrossRef]
- McFarlane, C.; Sharma, M.; Kambadur, R. Myostatin Is a Procachectic Growth Factor during Postnatal Myogenesis. Curr. Opin. Clin. Nutr. Metab. Care 2008, 11, 422–427. [Google Scholar] [CrossRef]
Diet | Control | EHPB 1 | EHPB 2 | EHPB 3 | EHPB 4 |
---|---|---|---|---|---|
Replace fishmeal levels | 0.00 | 8.89 | 17.78 | 26.67 | 35.56 |
Enzymatic hydrolysis of poultry by-product a | 0.00 | 3.10 | 6.20 | 9.30 | 12.40 |
Fish meal a | 45.00 | 41.00 | 37.00 | 33.00 | 29.00 |
Blood meal a | 6.00 | 6.00 | 6.00 | 6.00 | 6.00 |
Soybean meal a | 13.00 | 13.00 | 13.00 | 13.00 | 13.00 |
Corn gluten meal a | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
Wheat flour a | 7.00 | 7.00 | 7.00 | 7.00 | 7.00 |
Tapioca starch | 7.00 | 7.00 | 7.00 | 7.00 | 7.00 |
Rice bran | 7.52 | 7.52 | 7.52 | 7.52 | 7.52 |
Microcrystalline cellulose | 2.23 | 2.31 | 2.43 | 2.61 | 2.69 |
Squid paste | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
Fish oil | 3.70 | 3.99 | 4.28 | 4.47 | 4.76 |
Vitamin premix b | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
Mineral premix b | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
Calcium dihydrogen phosphate | 1.00 | 1.45 | 1.85 | 2.30 | 2.75 |
Vitamin C | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
Choline chloride | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
L-Lysine c | 0.00 | 0.05 | 0.10 | 0.16 | 0.21 |
L-Methionine c | 0.00 | 0.03 | 0.06 | 0.09 | 0.12 |
Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
Taurine (mg/kg) | 0.00 | 11.40 | 22.80 | 34.20 | 45.60 |
Proximate analysis (% of dry diet) | |||||
Crude protein (%) | 49.81 | 50.06 | 49.25 | 49.11 | 50.60 |
Crude lipid (%) | 11.2 | 11.2 | 11.2 | 11.1 | 11.1 |
Instrument | Type | Manufacturer |
---|---|---|
Real-time PCR machine | 7500 real-time PCR machine | Applied Biosystems, Carlsbad, NM, USA |
Microspectrophotometer | Nano Drop 2000 | Thermo Fisher Multiskan GO, Shanghai, China |
Automatic analyzer | BS-400 | Mindray, Shenzhen, China |
Auto Kjeldahl apparatus | Hanon K1100 | Jinan Hanon Instruments Co., Ltd., Jinan, China |
Muffle | XL-2A | Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China |
Photographic microscope | Eclipse Ci-L | Nikon, Tokyo, Japan |
Amino acid analyzer | SYKAM S-433D | Sykam GmbH, Munich, Germany |
Reagent | ||
RNA isolator | R401-01-AA | Vazyme, Nanjing, China |
HiScript® II One Step qRT-PCR SYBR Green | Q221-01 | Vazyme, Nanjing, China |
ALB | BS-400 | Mindray Medical International Ltd., Shenzhen, China (Include kits and machine) |
ALT | ||
AST | ||
TC | ||
TG | ||
GLU | ||
TP | ||
ALP |
Gene | Forward Sequence | Reverse Sequence | Accession Number/ Reference |
---|---|---|---|
pi3k | CTCACCATGGAGGATGGACC | ACGGTGGGAGTGGAGGTTTA | Cluster-21914.23096 |
akt | AGCGCACCTTCCATGTAGAC | GGCTATTTGCCACTTGCTGG | AXE72881.1 |
tor | CCATCCTCAACCTACTTCC | CTCTCCTTCTCCTTCTTCAG | Cluster-21914.16479 |
s6k | GTAATGCAAAGGACACGGCG | GTTCCCCACCGCTCAGATAC | XP_010747297.3 |
eif2-α | CCTCGTTTGTCCGTCTGTATC | GCTGACTCTGTCGGCCTTG | XM_038728156.1 |
igf-1 | CCTCTGCCTGTGTATAATCA | TGTCCGTCTTAGCCATCT | XM_038738328.1 |
tgf-β | GCTCAAAGAGAGCGAGGATG | TCCTCTACCATTCGCAATCC | [37] |
smad-2 | ATTCTGACAGAGCTTCCGCC | ATTTCTGCTGGTGAGCCTGTT | XM_038733539.1 |
myod-1 | CCTGCTGTTACTGCTCTG | ACCACTGATGTCCACTGA | XM_038706745.1 |
myog | TGACTTGTAACTCTGCTGAT | ATGTCTGGATGGTAGGATAAG | XM_038697403.1 |
myf-5 | CAACTTTGTGGACCGCAGAC | CCTGCTCTCGTAACAGGTCC | XM_038738312.1 |
paxbp-1 | GCCTCAGTTGGAGCCATTCT | TGATGTGGTCCAGGGCATTC | XM_038708491.1 |
snydecan-4 | TCCAAGACATCCGCTAAGCC | GATCTCCACCTCGTTGACGG | XM_038697979.1 |
murf-1 | AGAACACGGACCTACAGAG | CGGCTTGGTGAACATCTC | XP_018534138.1 |
myos | ACCTTGGAGTGAATGTAGAC | GAGTGGAGTGGAGTGGAT | DQ666527.3 |
β-actin | ATGCAGAAGGAGATCACAGCCT | AGTATTTACGCTCAGGTGGGG | MH018565.1 |
Diet | Control | EHPB 1 | EHPB 2 | EHPB 3 | EHPB 4 |
---|---|---|---|---|---|
IBW (g) | 240.33 ± 0.17 | 240.17 ± 0.17 | 240.00 ± 0.00 | 240.17 ± 0.17 | 240.17 ± 0.17 |
FBW (g) | 437.03 ± 11.35 c | 440.00 ± 1.53 c | 418.13 ± 1.62 b | 406.40 ± 3.85 ab | 397.20 ± 0.85 a |
SGR (%/day) | 0.88 ± 0.04 c | 0.89 ± 0.00 c | 0.82 ± 0.01 b | 0.77 ± 0.01 ab | 0.74 ± 0.00 a |
WGR (%) | 81.85 ± 4.85 c | 83.21 ± 0.56 c | 74.22 ± 0.67 b | 69.21 ± 1.55 ab | 65.39 ± 0.42 a |
FCR | 1.21 ± 0.05 a | 1.24 ± 0.00 ab | 1.26 ± 0.03 ab | 1.34 ± 0.04 b | 1.47 ± 0.01 c |
SR (%) | 96.67 ± 3.33 ab | 100.00 ± 0.00 b | 96.67 ± 3.33 ab | 93.33 ± 3.33 ab | 90.00 ± 0.00 a |
Control | EHPB 1 | EHPB 2 | EHPB 3 | EHPB 4 | |
---|---|---|---|---|---|
ALB (g/L) | 12.33 ± 1.25 a | 16.35 ± 1.21 b | 15.48 ± 0.56 ab | 24.07 ± 1.85 c | 13.75 ± 0.59 ab |
ALT (U/L) | 2.00 ± 0.38 a | 3.76 ± 0.70 b | 2.22 ± 0.78 a | 1.65 ± 0.18 a | 1.24 ± 0.47 a |
AST (U/L) | 9.74 ± 2.16 a | 22.65 ± 2.31 b | 16.61 ± 4.74 ab | 16.51 ± 2.41 ab | 18.36 ± 2.63 ab |
TC (mmol/L) | 8.06 ± 0.33 a | 10.22 ± 0.50 b | 9.01 ± 0.47 ab | 8.85 ± 0.42 ab | 9.37 ± 0.53 ab |
TG (mmol/L) | 6.58 ± 0.60 ab | 7.80 ± 0.26 b | 6.88 ± 0.50 ab | 6.89 ± 0.45 ab | 5.66 ± 0.55 a |
GLU (mmol/L) | 7.47 ± 0.44 a | 10.06 ± 0.71 b | 6.44 ± 0.59 a | 7.47 ± 0.73 a | 7.99 ± 0.63 a |
TP (g/L) | 42.73 ± 2.92 a | 49.36 ± 0.87 b | 51.97 ± 2.05 b | 50.25 ± 1.85 b | 46.22 ± 2.13 ab |
ALP (U/L) | 69.94 ± 4.20 c | 63.54 ± 4.40 bc | 49.91 ± 4.80 a | 53.16 ± 3.72 ab | 63.89 ± 3.28 bc |
Group | Item | |||
---|---|---|---|---|
Moisture (%) | Crude Protein (% W.W.) 1 | Crude Lipid (% W.W.) 1 | Crude Ash (% W.W.) 1 | |
Control | 77.22 ± 0.21 | 18.19 ± 0.01 | 3.57 ± 0.10 | 1.22 ± 0.05 |
EHPB1 | 77.55 ± 0.24 | 18.02 ± 0.05 | 3.81 ± 0.07 | 1.24 ± 0.02 |
Amino Acid (%) | Control | EHPB 1 | Fatty Acid (%) | Control | EHPB 1 |
---|---|---|---|---|---|
Methionine | 2.687 | 2.675 | C14:0 | 1.56 ± 0.17 | 1.66 ± 0.17 |
Cystine | 0.766 | 0.772 | C15:0 | 0.21 ± 0.01 | 0.20 ± 0.00 |
Methionine + cystine | 3.463 | 3.447 | C16:0 | 17.35 ± 0.65 | 18.95 ± 0.45 |
Lysine | 8.281 | 8.136 | C16:1 | 4.33 ± 0.07 | 4.49 ± 0.32 |
Threonine | 3.936 | 3.935 | C17:0 | 0.22 ± 0.02 | 0.27 ± 0.03 |
Tryptophan | / | / | C18:0 | 4.15 ± 0.89 | 4.43 ± 0.31 |
Arginine | 5.224 | 5.212 | C18:1 | 24.70 ± 1.50 | 28.45 ± 2.95 |
Isoleucine | 4.415 | 4.391 | C18:2 | 24.15 ± 4.45 | 21.90 ± 0.60 |
Leucine | 7.293 | 7.263 | C18:3n6γ | / | / |
Valine | 4.604 | 4.604 | C18:3n3α | 1.87 ± 0.33 | 1.73 ± 0.06 |
Histidine | 2.213 | 2.123 | C20:0 | / | / |
Phenylalanine | 4.12 | 4.192 | C20:1 | 0.82 ± 0.01 | 1.15 ± 0.42 |
Glycine | 4.559 | 4.384 | C20:2 | 0.75 ± 0.02 | 0.82 ± 0.11 |
Serine | 3.445 | 3.424 | C20:3n6 | 0.47 ± 0.00 | 0.31 ± 0.08 |
Proline | 3.162 | 3.151 | C20:4n6 | 1.49 ± 0.40 | 1.06 ± 0.40 |
Alanine | 5.496 | 5.427 | C20:5n3 | 1.72 ± 0.32 | 1.35 ± 0.20 |
Aspartic acid | 9.292 | 9.285 | C23:0 | / | / |
Glutamic acid | 13.05 | 13.014 | C24:1 | / | / |
Ammonia | 1.288 | 1.339 | C22:6n3 | 16.30 ± 4.20 | 13.15 ± 2.65 |
Total amino acids (including ammonia) | 83.841 | 83.327 | Total fatty acid | 99.99 ± 0.01 | 99.93 ± 0.02 |
Total amino acids (excluding ammonia) | 82.553 | 81.988 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yi, C.; Huang, D.; Yu, H.; Gu, J.; Liang, H.; Ren, M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods 2023, 12, 3485. https://doi.org/10.3390/foods12183485
Yi C, Huang D, Yu H, Gu J, Liang H, Ren M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods. 2023; 12(18):3485. https://doi.org/10.3390/foods12183485
Chicago/Turabian StyleYi, Changguo, Dongyu Huang, Heng Yu, Jiaze Gu, Hualiang Liang, and Mingchun Ren. 2023. "Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth" Foods 12, no. 18: 3485. https://doi.org/10.3390/foods12183485
APA StyleYi, C., Huang, D., Yu, H., Gu, J., Liang, H., & Ren, M. (2023). Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods, 12(18), 3485. https://doi.org/10.3390/foods12183485