Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Isolation and Preliminary Identification
2.3. Identification of Enterococcus Isolates
2.4. Antimicrobial Resistance
2.5. Genomic DNA Isolation and Detection of Linezolid Resistance Mechanisms
Gene | Primer Sequence 5′-3′ | Annealing Temperature | References |
---|---|---|---|
23S rRNA | F: GTAACGATTTGGGCACTGTCG R: CGATTAGTATTGGTCCGCTC | 55 °C | [31] |
rplC | F: GCGCTTCATTCGTGAATTCAA R: TTCTTTCTGCATCGACACGTACAA | 50 °C | |
rplD | F: ACGATGCAATCGTAATGCAA R: TTCAGCAACTTTTTCTGACAA | 51 °C | |
rplV | F: GGACATGCTGCTGACGATA R: ACCATTTAGCATCCCAGTCG | 50 °C | |
cfr | F: TGAAGTATAAAGCAGGTTGGGAGTCA R: ACCATATAATTGACCACAAGCAGC | 50 °C | [33] |
optrA | F: TACTTGATGAACCTACTAACCA R: CCTTGAACTACTGATTCTCGG | 50 °C | [21] |
poxtA | F: AAAGCTACCCATAAAATATC R: TCATCAAGCTGTTCGAGTTC | 50 °C | [32] |
3. Results
3.1. Isolation and Identification of Enterococci
3.2. Antibiotic Resistance Patterns of Enterococcus Isolates
3.3. Detection of Linezolid Resistance Mechanisms
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ogier, J.C.; Serror, P. Safety assessment of dairy microorganisms: The Enterococcus genus. Int. J. Food. Microbiol. 2008, 126, 291–301. [Google Scholar] [CrossRef] [PubMed]
- Chajęcka-Wierzchowska, W.; Zarzecka, U.; Zadernowska, A. Enterococci isolated from plant-derived food—Analysis of antibiotic resistance and the occurrence of resistance genes. LWT Food Sci. Tech. 2021, 139, 110549. [Google Scholar] [CrossRef]
- Zarzecka, U.; Zadernowska, A.; Chajęcka-Wierzchowska, W. Effects of osmotic and high-pressure stress on expression of virulence factors among Enterococcus spp. isolated from food of animal origin. Food Microbiol. 2022, 102, 103900. [Google Scholar] [CrossRef] [PubMed]
- Hanchi, H.; Mottawea, W.; Sebei, K.; Hammami, R. The Genus Enterococcus: Between Probiotic Potential and Safety Concerns-An Update. Front. Microbiol. 2018, 9, 1791. [Google Scholar] [CrossRef]
- Khan, H.A.; Ahma, A.; Mehboob, R. Nosocomial infections and their control strategies. Asian. Pac. J. Trop. Biomedi. 2015, 5, 509–514. [Google Scholar] [CrossRef] [Green Version]
- Chajęcka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Virulence factors, antimicrobial resistance and biofilm formation in Enterococcus spp. isolated from retail shrimps. LWT Food Sci. Tech. 2016, 69, 117–122. [Google Scholar] [CrossRef]
- Belgacem, Z.B.; Abriouel, H.; Omar, N.B.; Lucas, R.; Martínez-Canamero, M.; Gálvez, A.; Manai, M. Antimicrobial activity, safety aspects, and some technological properties of bacteriocinogenic Enterococcus faecium from artisanal Tunisian fermented meat. Food Cont. 2010, 21, 462–470. [Google Scholar] [CrossRef]
- Hammerum, A.M.; Lester, C.H.; Heuer, O.E. Antimicrobial-Resistant Enterococci in Animals and Meat: A Human Health Hazard? Foodborne Pathog. Dis. 2010, 7, 1137–1146. [Google Scholar] [CrossRef]
- Chajęcka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Diversity of Antibiotic Resistance Genes in Enterococcus Strains Isolated from Ready-to-Eat Meat Products. J. Food Sci. 2016, 81, M2799–M2807. [Google Scholar] [CrossRef]
- Na, S.H.; Moon, D.C.; Choi, M.J.; Oh, S.J.; Jung, D.Y.; Kang, H.Y.; Hyun, B.H.; Lim, S.K. Detection of oxazolidinone and phenicol resistant enterococcal isolates from duck feces and carcasses. Int. J. Food Microbiol. 2019, 293, 53–59. [Google Scholar] [CrossRef]
- Hashemian, S.; Farhadi, T.; Ganjparvar, M. Linezolid: A review of its properties, function, and use in critical care. Drug Des. Devel. Ther. 2018, 12, 1759–1767. [Google Scholar] [CrossRef] [PubMed]
- Aoki, H.; Ke, L.; Poppe, S.M.; Poel, T.J.; Weaver, E.A.; Gadwood, R.C.; Thomas, R.C.; Shinabarger, D.L.; Ganoza, M.C. Oxazolidinone antibiotics target the P site on Escherichia coli ribosomes. Antimicrob. Agents Chemother. 2002, 46, 1080–1085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Long, K.S.; Vester, B. Resistance to linezolid caused by modifications at its binding site on the ribosome. Antimicrob. Agents Chemother. 2012, 56, 603–612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bender, J.K.; Fleige, C.; Klare, I.; Fiedler, S.; Mischnik, A.; Mutters, N.T.; Dingle, K.E.; Werner, G. Detection of a cfr(B) Variant in German Enterococcus faecium Clinical Isolates and the Impact on Linezolid Resistance in Enterococcus spp. PLoS ONE 2016, 11, e0167042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cafini, F.; Nguyenle, T.T.; Higashide, M.; Roman, F.; Prieto, J.; Morikawa, K. Horizontal gene transmission of the cfr gene to MRSA and Enterococcus: Role of Staphylococcus epidermidis as a reservoir and alternative pathway for the spread of linezolid resistance. J. Antimicrob. Chemother. 2016, 71, 587–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Wang, Y.; Wu, C.; Shen, Z.; Schwarz, S.; Du, X.D.; Dai, L.; Zhang, W.; Zhang, Q.; Shen, J. First report of the multidrug resistance gene cfr in Enterococcus faecalis of animal origin. Antimicrob. Agents Chemother. 2012, 56, 1650–1654. [Google Scholar] [CrossRef] [Green Version]
- Diaz, L.; Kiratisin, P.; Mendes, R.E.; Panesso, D.; Singh, K.V.; Arias, C.A. Transferable plasmid-mediated resistance to linezolid due to cfr in a human clinical isolate of Enterococcus faecalis. Antimicrob. Agents Chemother. 2012, 56, 3917–3922. [Google Scholar] [CrossRef] [Green Version]
- LaMarre, J.M.; Howden, B.P.; Mankin, A.S. Inactivation of the indigenous methyltransferase RlmN in Staphylococcus aureus increases linezolid resistance. Antimicrob. Agents Chemother. 2011, 55, 2989–2991. [Google Scholar] [CrossRef] [Green Version]
- Sharkey, L.K.R.; O’Neill, A.J. Antibiotic resistance ABC-F proteins: Bringing target protection into the limelight. ACS Infect. Dis. 2018, 4, 239–246. [Google Scholar] [CrossRef]
- Wang, Y.; Zou, Y.; Xie, J.; Wang, T.; Zheng, X.; He, H.; Dong, W.; Xing, J.; Dong, Y. Linezolid versus vancomycin for the treatment of suspected methicillin-resistant Staphylococcus aureus nosocomial pneumonia: A systematic review employing meta-analysis. Eur. J. Clin. Pharmacol. 2015, 71, 107–115. [Google Scholar] [CrossRef]
- Brenciani, A.; Morroni, G.; Vincenzi, C.; Manso, E.; Mingoia, M.; Giovanetti, E.; Varaldo, P.E. Detection in Italy of two clinical Enterococcus faecium isolates carrying both the oxazolidinone and phenicol resistance gene optrA and a silent multiresistance gene cfr. J. Antimicrob. Chemother. 2016, 71, 1118–1119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, J.; Wang, Y.; Schwarz, S.; Lv, H.; Li, Y.; Liao, K.; Yu, S.; Zhao, K.; Gu, D.; Wang, X.; et al. Enterococcal isolates carrying the novel oxazolidinone resistance gene optrA from hospitals in Zhejiang, Guangdong, and Henan, China, 2010–2014. Clin. Microbiol. Infect. 2015, 21, 1095.e1–1095.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, L.; Wang, Y.; Lv, Y.; Wang, S.; Song, Y.; Li, Y.; Liu, J.; Xue, F.; Yang, W.; Zhang, J. Nationwide Surveillance of Novel Oxazolidinone Resistance Gene optrA in Enterococcus Isolates in China from 2004 to 2014. Antimicrob. Agents Chemother. 2016, 60, 7490–7493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, T.; Shen, Y.; Schwarz, S.; Cai, J.; Lv, Y.; Li, J.; Fessler, A.T.; Zhang, R.; Wu, C.; Shen, J.; et al. Genetic environment of the transferable oxazolidinone/phenicol resistance gene optrA in Enterococcus faecalis isolates of human and animal origin. J. Antimicrob. Chemother. 2016, 71, 1466–1473. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.; Chen, L.; Wu, Z.; Wang, L. Retrospective analysis of genome sequences revealed the wide dissemination of optrA in Gram-positive bacteria. J. Antimicrob. Chemother. 2017, 72, 614–616. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Wang, Y.; Schwarz, S.; Cai, J.; Fan, R.; Li, J.; Fessler, A.T.; Zhang, R.; Wu, C.; Shen, J. Co-location of the oxazolidinone resistance genes optrA and cfr on a multiresistance plasmid from Staphylococcus sciuri. J. Antimicrob. Chemother. 2016, 71, 1474–1478. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Lv, Y.; Cai, J.; Schwarz, S.; Cui, L.; Hu, Z.; Zhang, R.; Li, J.; Zhao, Q.; He, T.; et al. A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother. 2015, 70, 2182–2190. [Google Scholar] [CrossRef] [Green Version]
- Cavaco, L.M.; Korsgaard, H.; Kaas, R.S.; Seyfarth, A.M.; Leekitcharoenphon, P.; Hendriksen, R.S. First detection of linezolid resistance due to the optrA gene in enterococci isolated from food products in Denmark. J. Glob. Antimicrob. Resist. 2017, 9, 128–129. [Google Scholar] [CrossRef]
- Antonelli, A.; D’Andrea, M.M.; Brenciani, A.; Galeotti, C.L.; Morroni, G.; Pollini, S.; Varaldo, P.E.; Rossolini, G.M. Characterization of poxtA, a novel phenicol–oxazolidinone–tetracycline resistance gene from an MRSA of clinical origin. J. Antimicrob. Chemother. 2018, 73, 1763–1769. [Google Scholar] [CrossRef] [Green Version]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Nineth Informational Supplement M100S-S29; CLSI: Wayne, PA, USA, 2019; pp. 104–109. [Google Scholar]
- Mališová, L.; Jakubů, V.; Pomorská, K.; Musílek, M.; Žemličková, H. Spread of Linezolid-Resistant Enterococcus spp. in Human Clinical Isolates in the Czech Republic. Antibiotics 2021, 10, 219. [Google Scholar] [CrossRef]
- Bender, J.K.; Fleige, C.; Klare, I.; Werner, G. Development of a multiplex-PCR to simultaneously detect acquired linezolid resistance genes cfr, optrA and poxtA in enterococci of clinical origin. J. Microbiol. Methods 2019, 160, 101–103. [Google Scholar] [CrossRef] [PubMed]
- Kehrenberg, C.; Schwarz, S. Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob. Agents Chemother. 2006, 50, 1156–1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gawryszewska, I.; Żabicka, D.; Hryniewicz, W.; Sadowy, E. Linezolid-resistant enterococci in Polish hospitals: Species, clonality and determinants of linezolid resistance. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 1279–1286. [Google Scholar] [CrossRef] [Green Version]
- Zahedi Bialvaei, A.; Rahbar, M.; Yousefi, M.; Asgharzadeh, M.; Samadi Kafil, H. Linezolid: A promising option in the treatment of Gram-positives. J. Antimicrob. Chemother. 2017, 72, 354–364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chajęcka-Wierzchowska, W.; Zadernowska, A.; García-Solache, M. Ready-to-eat dairy products as a source of multidrug-resistant Enterococcus strains: Phenotypic and genotypic characteristics. J. Dairy Sci. 2020, 103, 4068–4077. [Google Scholar] [CrossRef]
- Chajęcka-Wierzchowska, W.; Zadernowska, A.; Zarzecka, U.; Zakrzewski, A.; Gajewska, J. Enterococci from ready-to-eat food—Horizontal gene transfer of antibiotic resistance genes and genotypic characterization by PCR melting profile. J. Sci. Food Agric. 2019, 99, 1172–1179. [Google Scholar] [CrossRef]
- Patel, S.N.; Memari, N.; Shahinas, D.; Toye, B.; Jamieson, F.B.; Farrell, D.J. Linezolid resistance in Enterococcus faecium isolated in Ontario, Canada. Diagn. Microbiol. Infect. Dis. 2013, 77, 350–353. [Google Scholar] [CrossRef]
- Tamang, M.D.; Moon, D.C.; Kim, S.R.; Kang, H.Y.; Lee, K.; Nam, H.M.; Jang, G.C.; Lee, H.S.; Jung, S.C.; Lim, S.K. Detection of novel oxazolidinone and phenicol resistance gene optrA in enterococcal isolates from food animals and animal carcasses. Vet. Microbiol. 2017, 201, 252–256. [Google Scholar] [CrossRef]
- Fioriti, S.; Morroni, G.; Coccitto, S.N.; Brenciani, A.; Antonelli, A.; Di Pilato, V.; Baccani, I.; Pollini, S.; Cucco, L.; Morelli, A.; et al. Detection of Oxazolidinone Resistance Genes and Characterization of Genetic Environments in Enterococci of Swine Origin, Italy. Microorganisms 2020, 8, 2021. [Google Scholar] [CrossRef]
- Mendes, R.E.; Deshpande, L.M.; Costello, A.J.; Farrell, D.J. Molecular epidemiology of Staphylococcus epidermidis clinical isolates from U.S. hospitals. Antimicrob. Agents Chemother. 2012, 56, 4656–4661. [Google Scholar] [CrossRef] [Green Version]
- Lei, C.W.; Kang, Z.Z.; Wu, S.K.; Chen, Y.P.; Kong, L.H.; Wang, H.N. Detection of the phenicol-oxazolidinone-tetracycline resistance gene poxtA in Enterococcus faecium and Enterococcus faecalis of food-producing animal origin in China. J. Antimicrob. Chemother. 2019, 74, 2459–2461. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, S.; Zhang, W.; Du, X.D.; Krüger, H.; Feßler, A.T.; Ma, S.; Zhu, Y.; Wu, C.; Shen, J.; Wang, Y. Mobile Oxazolidinone Resistance Genes in Gram-Positive and Gram-Negative Bacteria. Clin. Microb. Rev. 2021, 34, e0018820. [Google Scholar] [CrossRef] [PubMed]
- Yoon, S.; Son, S.H.; Kim, Y.B.; Seo, K.W.; Lee, Y.J. Molecular characteristics of optrA-carrying Enterococcus faecalis from chicken meat in South Korea. Poultry Sci. 2020, 99, 6990–6996. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dong, G.; Li, J.; Chen, L.; Liu, H.; Bi, W.; Lu, H.; Zhou, T. A high incidence and coexistence of multiresistance genes cfr and optrA among linezolid-resistant enterococci isolated from a teaching hospital in Wenzhou, China. Eur. J. Clin. Microbiol. Infect. Dis. 2018, 37, 1441–1448. [Google Scholar] [CrossRef] [PubMed]
- Alonso, M.; Marín, M.; Iglesias, C.; Cercenado, E.; Bouza, E.; García de Viedma, D. Rapid identification of linezolid resistance in Enterococcus spp. based on high-resolution melting analysis. J. Microbiol. Methods 2014, 98, 41–43. [Google Scholar] [CrossRef]
- Smith, T.T.; Tamma, P.D.; Do, T.B.; Dzintars, K.E.; Zhao, Y.; Cosgrove, S.E.; Avdic, E. Prolonged linezolid use is associated with the development of linezolid-resistant Enterococcus faecium. Diagn. Microbiol. Infect. Dis. 2018, 91, 161–163. [Google Scholar] [CrossRef]
Species | Antibiotic Resistance Profile | LZD MIC Range [µg/mL] | LZDR Mechanism | Isolation Source (no. of Isolates) |
---|---|---|---|---|
E. faecalis | E, TE, LZD, RD | 8–32 | poxtA, optrA | Sushi (3) |
NOR, E, TE, LZD, RD | 8 | poxtA, optrA | Sushi (3) | |
AMP, CIP, NOR, E, FOT, LZD, F, RD | 16 | optrA | Raw milk (1) | |
TE, LZD, RD, S | 8 | cfr | Raw milk (1) | |
CIP, TE, LZD, RD, DO, MH | 8 | ∆G2576T | Raw milk (1) | |
CIP, NOR, VA, LZD, RD | 16 | poxtA | Raw milk (1) | |
CIP, LZD, RD | 8–16 | poxtA | Sushi (2) | |
VA, LZD, F, RD | 8 | poxtA | Sushi (1) | |
CIP, NOR, VA, E, LZD, RD | 8 | poxtA, cfr | Sushi (1) | |
CIP, VA, LZD, F, RD, C, S | 8 | poxtA | Sushi (1) | |
LZD, RD | 8–16 | poxtA | Raw milk (2) | |
CIP, VA, E, LZD, F, RD, C | 32 | ∆G2576T | Sushi (1) | |
CIP, NOR, VA, E, TE, LZD, RD | 16 | cfr | Raw milk (1) | |
CIP, NOR, LZD, RD, MH | 8 | ∆G2576T | Raw milk (1) | |
CIP, VA, LZD, RD, C, MH | 8 | poxtA | Sushi (2) | |
CIP, NOR, VA, LZD, RD | 8 | ∆G2576T | Sushi (1) | |
CIP, NOR, VA, LZD, F, RD, C | 32 | ∆G2576T | Sushi (1) | |
CIP, LZD, RD | 8 | ∆G2576T | Sushi (1) | |
E. faecium | CIP, QD, LZD, RD | 32 | cfr | Raw milk (1) |
AMP, CIP, NOR, VA, QD, LZD, RD | 16 | ∆G2576T | Raw milk (1) | |
E. hirae | QD, LZD | 8 | ∆G2576T | Shrimp (1) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zarzecka, U.; Zakrzewski, A.J.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance. Foods 2022, 11, 975. https://doi.org/10.3390/foods11070975
Zarzecka U, Zakrzewski AJ, Chajęcka-Wierzchowska W, Zadernowska A. Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance. Foods. 2022; 11(7):975. https://doi.org/10.3390/foods11070975
Chicago/Turabian StyleZarzecka, Urszula, Arkadiusz Józef Zakrzewski, Wioleta Chajęcka-Wierzchowska, and Anna Zadernowska. 2022. "Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance" Foods 11, no. 7: 975. https://doi.org/10.3390/foods11070975
APA StyleZarzecka, U., Zakrzewski, A. J., Chajęcka-Wierzchowska, W., & Zadernowska, A. (2022). Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance. Foods, 11(7), 975. https://doi.org/10.3390/foods11070975