Proteolysis Degree of Protein Corona Affect Ultrasound-Induced Sublethal Effects on Saccharomyces cerevisiae: Transcriptomics Analysis and Adaptive Regulation of Membrane Homeostasis
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. WB Extract-mediated Preparation of Nano-Se
2.3. Extraction of Wheat Protein
2.4. Preparation of Cell-free Protease Extract (CFPE)
2.5. CFPE Proteolysis of Nano-Se@PC
2.6. Measurement of PC Degree of Hydrolysis and Surface Hydrophobicity
2.7. Co-treatment of US and Nano-Se@PC on S. cerevisiae
2.8. Evaluation of Lethal and Sublethal Injury
2.9. RNA Extraction, Sequencing and Transcriptomics Analysis
2.10. Quantitative Validation by Real-Time PCR (qRT-PCR)
2.11. Measurement of Cell Membrane Integrity
2.12. Measurement of the Membrane Potential
2.13. Proton Motive Force Assay
2.14. Oxidation Kinetics of Membrane Lipid
2.15. Measurement of Membrane Fluidity
3. Results and Discussion
3.1. Characterization of Nano-Se and Nano-Se@PC
3.2. Assessment of Lethal and Sublethal Effects of Nano-Se@PC+ US
3.3. Investigation of Cell Membrane Homeostasis
3.4. Transcriptional Response of S. cerevisiae to US + nano-Se@PC
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Luo, G.; Fujino, M.; Nakano, S.; Hida, A.; Tajima, T.; Kato, J. Accelerating itaconic acid production by increasing membrane permeability of whole-cell biocatalyst based on a psychrophilic bacterium Shewanella livingstonensis Ac10. J. Biotechnol. 2020, 312, 56–62. [Google Scholar] [CrossRef]
- Muralidharan, A.; Rems, L.; Kreutzer, M.T.; Boukany, P.E. Actin networks regulate the cell membrane permeability during electroporation. Biochim. Biophys. Acta (BBA)—Biomembr. 2021, 1863, 183468. [Google Scholar] [CrossRef] [PubMed]
- Chandan, R.; Mehta, S.M.; Banerjee, R. Ultrasound-Responsive Carriers for Therapeutic Applications. ACS Biomater. Sci. Eng. 2020, 6, 4731–4747. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Z.-Y.; Xie, G.; Li, L.; Liu, W.-L. The joint effect of ultrasound and magnetic Fe3O4 nanoparticles on the yield of 2,6-dimethoxy-ρ-benzoquinone from fermented wheat germ: Comparison of evolutionary algorithms and interactive analysis of paired-factors. Food Chem. 2020, 302, 125275. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Yang, K.; Cui, J.; Ye, J.; Deng, C. Controlled permeation of cell membrane by single bubble acoustic cavitation. J. Control Release 2012, 157, 103–111. [Google Scholar] [CrossRef]
- Lesniak, A.; Salvati, A.; Santos-Martinez, M.J.; Radomski, M.W.; Dawson, K.A.; Åberg, C. Nanoparticle Adhesion to the Cell Membrane and Its Effect on Nanoparticle Uptake Efficiency. J. Am. Chem. Soc. 2013, 135, 1438–1444. [Google Scholar] [CrossRef]
- Hu, S.; Hu, W.; Li, Y.; Li, S.; Tian, H.; Lu, A.; Wang, J. Construction and structure-activity mechanism of polysaccharide nano-selenium carrier. Carbohydr. Polym. 2020, 236, 116052. [Google Scholar] [CrossRef]
- Tan, H.-W.; Mo, H.-J.; Lau, A.T.Y.; Xu, Y.-M. Selenium Species: Current Status and Potentials in Cancer Prevention and Therapy. Int. J. Mol. Sci. 2019, 20, 75. [Google Scholar] [CrossRef]
- Toubhans, B.; Gazze, S.A.; Bissardon, C.; Bohic, S.; Gourlan, A.T.; Gonzalez, D.; Charlet, L.; Conlan, R.S.; Francis, L.W. Selenium nanoparticles trigger alterations in ovarian cancer cell biomechanics. Nanomed. Nanotechnol. Biol. Med. 2020, 29, 102258. [Google Scholar] [CrossRef]
- Sun, X.; Yue, S.-Z.; Qiao, Y.-H.; Sun, Z.-J.; Wang, C.; Li, H.-F. Dietary supplementation with selenium-enriched earthworm powder improves antioxidative ability and immunity of laying hens. Poult. Sci. 2020, 99, 5344–5349. [Google Scholar] [CrossRef]
- Wang, X.; Appels, R.; Zhang, X.; Bekes, F.; Diepeveen, D.; Ma, W.; Hu, X.; Islam, S. Solubility variation of wheat dough proteins: A practical way to track protein behaviors in dough processing. Food Chem. 2020, 312, 126038. [Google Scholar] [CrossRef] [PubMed]
- Mandial, D.; Khullar, P.; Gupta, V.; Kumar, H.; Singh, N.; Ahluwalia, G.K.; Bakshi, M.S. Role of Gluten in Surface Chemistry: Nanometallic Bioconjugation of Hard, Medium, and Soft Wheat Protein. J. Agric. Food Chem. 2019, 67, 7886–7897. [Google Scholar] [CrossRef] [PubMed]
- Hui, C.; Wei, R.; Jiang, H.; Zhao, Y.; Xu, L. Characterization of the ammonification, the relevant protease production and activity in a high-efficiency ammonifier Bacillus amyloliquefaciens DT. Int. Biodeterior. Biodegrad. 2019, 142, 11–17. [Google Scholar] [CrossRef]
- Peng, Y.; Zhang, Z.; Wang, M.; Shi, X.; Zhou, Y.; Zhou, Y.; Kong, Y. Inactivation of harmful Anabaena flos-aquae by ultrasound irradiation: Cell disruption mechanism and enhanced coagulation. Ultrason. Sonochem. 2020, 69, 105254. [Google Scholar] [CrossRef] [PubMed]
- Suga, K.; Kitagawa, K.; Taguchi, S.; Okamoto, Y.; Umakoshi, H. Evaluation of Molecular Ordering in Bicelle Bilayer Membranes Based on Induced Circular Dichroism Spectra. Langmuir 2020, 36, 3242–3250. [Google Scholar] [CrossRef] [PubMed]
- Baltacıoğlu, H.; Baltacıoğlu, C.; Okur, I.; Tanrıvermiş, A.; Yalıç, M. Optimization of microwave-assisted extraction of phenolic compounds from tomato: Characterization by FTIR and HPLC and comparison with conventional solvent extraction. Vib. Spectrosc. 2021, 113, 103204. [Google Scholar] [CrossRef]
- Azizi, M.; Sedaghat, S.; Tahvildari, K.; Derakhshi, P.; Ghaemi, A. Synthesis of silver nanoparticles using Peganum harmala extract as a green route. Green Chem. Lett. Rev. 2017, 10, 420–427. [Google Scholar] [CrossRef]
- Kethireddy, V.; Oey, I.; Jowett, T.; Bremer, P. Critical analysis of the maximum non inhibitory concentration (MNIC) method in quantifying sub-lethal injury in Saccharomyces cerevisiae cells exposed to either thermal or pulsed electric field treatments. Int. J. Food Microbiol. 2016, 233, 73–80. [Google Scholar] [CrossRef]
- Wu, S.C.; Han, F.; Song, M.R.; Chen, S.; Li, Q.; Zhang, Q.; Zhu, K.; Shen, J.Z. Natural Flavones from Morus alba against Methicillin-Resistant Staphylococcus aureus via Targeting the Proton Motive Force and Membrane Permeability. J. Agric. Food Chem. 2019, 67, 10222–10234. [Google Scholar] [CrossRef]
- Du, M.; Chen, Y.; Tu, J.; Liufu, C.; Yu, J.; Yuan, Z.; Gong, X.; Chen, Z. Ultrasound Responsive Magnetic Mesoporous Silica Nanoparticle-Loaded Microbubbles for Efficient Gene Delivery. ACS Biomater. Sci. Eng. 2020, 6, 2904–2912. [Google Scholar] [CrossRef]
- Kladko, D.V.; Zakharzhevskii, M.A.; Vinogradov, V.V. Magnetic Field-Mediated Control of Whole-Cell Biocatalysis. J. Phys. Chem. Lett. 2020, 11, 8989–8996. [Google Scholar] [CrossRef]
- Iqbal, A.; Panta, P.R.; Ontoy, J.; Bruno, J.; Ham, J.H.; Doerrler, W.T. Chemical or Genetic Alteration of Proton Motive Force Results in Loss of Virulence of Burkholderia glumae, the Cause of Rice Bacterial Panicle Blight. Appl. Environ. Microbiol. 2021, 87, AEM0091521. [Google Scholar] [CrossRef]
- He, Q.; Liu, D.; Ashokkumar, M.; Ye, X.; Jin, T.Z.; Guo, M. Antibacterial mechanism of ultrasound against Escherichia coli: Alterations in membrane microstructures and properties. Ultrason. Sonochem. 2021, 73, 105509. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Xia, Y.; Hu, W.; Tao, L.; Ni, L.; Yu, J.; Ai, L. Membrane Fluidity of Saccharomyces cerevisiae from Huangjiu (Chinese Rice Wine) Is Variably Regulated by OLE1 To Offset the Disruptive Effect of Ethanol. Appl. Environ. Microbiol. 2019, 85, e01620-19. [Google Scholar] [CrossRef]
- Katsuki, Y.; Yamaguchi, Y.; Tani, M. Overexpression of PDR16 confers resistance to complex sphingolipid biosynthesis inhibitor aureobasidin A in yeast Saccharomyces cerevisiae. FEMS Microbiol. Lett. 2017, 365, 1–9. [Google Scholar] [CrossRef]
- Fernández-Acero, T.; Rodríguez-Escudero, I.; Molina, M.; Cid, V.J. The yeast cell wall integrity pathway signals from recycling endosomes upon elimination of phosphatidylinositol (4,5)-bisphosphate by mammalian phosphatidylinositol 3-kinase. Cell Signal 2015, 27, 2272–2284. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.D.; Dang, X.; Zheng, H.W.; Chen, X.F.; Lin, X.L.; Zhang, D.M.; Abubakar, Y.S.; Chen, X.; Lu, G.; Wang, Z.; et al. Two Rab5 Homologs Are Essential for the Development and Pathogenicity of the Rice Blast Fungus Magnaporthe oryzae. Front. Plant Sci. 2017, 8, 620. [Google Scholar] [CrossRef] [PubMed]
- Kaksonen, M.; Toret, C.P.; Drubin, D.G. A Modular Design for the Clathrin- and Actin-Mediated Endocytosis Machinery. Cell 2005, 123, 305–320. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Lu, Z.; Chen, D.; Wei, Y.; Chen, X.; Huang, J.; Guan, N.; Lu, Q.; Wu, R.; Huang, R. Transcriptomic analysis and driver mutant prioritization for differentially expressed genes from a Saccharomyces cerevisiae strain with high glucose tolerance generated by UV irradiation. RSC Adv. 2017, 7, 38784–38797. [Google Scholar] [CrossRef]
- Ma, M.; Liu, Z.L. Mechanisms of ethanol tolerance in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2010, 87, 829–845. [Google Scholar] [CrossRef]
- Yang, K.-M.; Lee, N.-R.; Woo, J.-M.; Choi, W.; Zimmermann, M.; Blank, L.M.; Park, J.-B. Ethanol reduces mitochondrial membrane integrity and thereby impacts carbon metabolism of Saccharomyces cerevisiae. FEMS Yeast Res. 2012, 12, 675–684. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharya, S.; Esquivel, B.D.; White, T.C. Overexpression or Deletion of Ergosterol Biosynthesis Genes Alters Doubling Time, Response to Stress Agents, and Drug Susceptibility in Saccharomyces cerevisiae. mBio 2018, 9, e01291-18. [Google Scholar] [CrossRef] [PubMed]
- Imazu, H.; Sakurai, H.; Beverley, S.M.; Owens, K.L.; Showalter, M.; Griffith, C.L.; Doering, T.L.; Jones, V.C.; McNeil, M.R. Saccharomyces cerevisiae Heat Shock Transcription Factor Regulates Cell Wall Remodeling in Response to Heat Shock. Eukaryot. Cell 2005, 4, 1147–1154. [Google Scholar] [CrossRef] [PubMed]
- Nicklow, E.E.; Sevier, C.S. Activity of the yeast cytoplasmic Hsp70 nucleotide-exchange factor Fes1 is regulated by reversible methionine oxidation. J. Biol. Chem. 2020, 295, 552–569. [Google Scholar] [CrossRef] [PubMed]
- Ohdate, T.; Kita, K.; Inoue, Y. Kinetics and redox regulation of Gpx1, an atypical 2-Cys peroxiredoxin, in Saccharomyces cerevisiae. FEMS Yeast Res. 2010, 10, 787–790. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jablonska, E.; Raimondi, S.; Gromadzinska, J.; Reszka, E.; Wieczorek, E.; Krol, M.B.; Smok-Pieniazek, A.; Nocun, M.; Stepnik, M.; Socha, K.; et al. DNA damage and oxidative stress response to selenium yeast in the non-smoking individuals: A short-term supplementation trial with respect to GPX1 and SEPP1 polymorphism. Eur. J. Nutr. 2016, 55, 2469–2484. [Google Scholar] [CrossRef]
- Kazaz, S.; Miray, R.; Lepiniec, L.; Baud, S. Plant monounsaturated fatty acids: Diversity, biosynthesis, functions and uses. Prog. Lipid Res. 2022, 85, 101138. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | qRT-PCR Results (log2FC) | RNA-Seq Results (log2FC) |
---|---|---|---|---|
MKS1 | TTTTAACTCGGCCAATGACATCACC | AATTGTCTGTTTGGAGCAACGTCAT | 4.79 | 3.01 |
YBR204C | AAATGGTCTACAGCGGTGCC | TGACATGCCAGAAAACAACCC | 4.8 | 5.98 |
CYS4 | TCGACTTAGTTGGTAACACCCCATT | TGGCAATTCTGTCTTTGATGGAACC | 0.24 | 0.37 |
YCR06W | GATACGAGCAGGCTGCCAAG | GAGCCTCGATGAGGATTCCC | 0.16 | 0.31 |
FAS1 | AATTCAAAGCCACCCACATA | AGTACCGGCAACGATAACAC | 0.22 | 0.39 |
GPX2-R | GCTTGGGTTGCTGTTGTTTC | ACAGGCTTTGGATTTCTTGG | 5.41 | 4.12 |
YDL10C | CCCGACGCAAAGTTCTTCTC | AGTGTTGGTGATGGAGGCG | 4.41 | 2.89 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Z.-Y.; Feng, C.-H.; Xie, G.; Liu, W.-L.; Zhu, X.-L. Proteolysis Degree of Protein Corona Affect Ultrasound-Induced Sublethal Effects on Saccharomyces cerevisiae: Transcriptomics Analysis and Adaptive Regulation of Membrane Homeostasis. Foods 2022, 11, 3883. https://doi.org/10.3390/foods11233883
Zheng Z-Y, Feng C-H, Xie G, Liu W-L, Zhu X-L. Proteolysis Degree of Protein Corona Affect Ultrasound-Induced Sublethal Effects on Saccharomyces cerevisiae: Transcriptomics Analysis and Adaptive Regulation of Membrane Homeostasis. Foods. 2022; 11(23):3883. https://doi.org/10.3390/foods11233883
Chicago/Turabian StyleZheng, Zi-Yi, Chao-Hua Feng, Guo Xie, Wen-Li Liu, and Xiao-Lei Zhu. 2022. "Proteolysis Degree of Protein Corona Affect Ultrasound-Induced Sublethal Effects on Saccharomyces cerevisiae: Transcriptomics Analysis and Adaptive Regulation of Membrane Homeostasis" Foods 11, no. 23: 3883. https://doi.org/10.3390/foods11233883
APA StyleZheng, Z.-Y., Feng, C.-H., Xie, G., Liu, W.-L., & Zhu, X.-L. (2022). Proteolysis Degree of Protein Corona Affect Ultrasound-Induced Sublethal Effects on Saccharomyces cerevisiae: Transcriptomics Analysis and Adaptive Regulation of Membrane Homeostasis. Foods, 11(23), 3883. https://doi.org/10.3390/foods11233883