Dynamic Changes in Vitamin E Biosynthesis during Germination in Brown Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Germinated Brown Rice (GBR) Preparation
2.3. Extraction and Determination of Vitamin E
2.4. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.5. Statistical Analysis
3. Results
3.1. Vitamin E Profiles and Composition in Brown Rice after Germination
3.2. Gene Expression Profiles Related with Vitamin E Biosynthesis
3.3. Correlations among Vitamin E and Genes Involved in Its Biosynthesis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Appendix A
| Abbreviations | Full Title |
|---|---|
| SK | shikimate metabolic |
| MEP | methylerythritol phosphate |
| HPPD | 4-hydroxy-phenylpyruvate dioxygenase |
| HGA | homogentisic acid |
| HPP | 4-hydroxyphenylpyruvate |
| DXP | 1-deoxy-d-xylulose-5-phosphate |
| DXS | 1-deoxy-d-xylulose-5-phosphate synthase |
| D-GAP | d-glyceraldehyde-3-phosphate |
| TPP | thiamine pyrophosphate |
| GGDP | geranylgeranyl diphosphate |
| PDP | phytyldiphosphate |
| HPT | homogentisate phytyltransferase |
| TC | tocopherol cyclase |
| MPBQ | 2-methyl-6-phytylquinol |
| MPBQ-MT | 2-methyl-6-phytylquinol methyltransferase |
| DMPBQ | 2,3-dimethyl-5-phytylquinol |
| γ-TMT | γ-tocopherol methyltransferase |
| HGGT | homogentisate geranylgeranyltransferase |
| GGBM | 6-geranylgeranyl-2-methylbenzene-1,4-diol |
| GGDMB | 6-geranylgeranyl-2,3-dimethylbenzene-1,4-diol |
References
- Ishfaq, M.; Akbar, N.; Zulfiqar, U.; Ali, N.; Ahmad, M.; Anjum, S.A.; Farooq, M. Influence of water management techniques on milling recovery, grain quality and mercury uptake in different rice production systems. Agr. Water Manag. 2021, 243, 106500. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Xie, W.; Huang, Z.; Ashraf, U.; Mo, Z. Light quality during booting stage modulates fragrance, grain yield and quality in fragrant rice. J. Plant Interact. 2021, 16, 42–52. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.; Robards, K.; Helliwell, S.; Blanchard, C. Composition and functional properties of rice. Int. J. Food Sci. Technol. 2010, 37, 849–868. [Google Scholar] [CrossRef] [Scilit]
- Lamberts, L.; Bie, E.D.; Vandeputte, G.E.; Veraverbeke, W.S.; Derycke, V.; Man, W.D.; Delcour, J.A. Effect of milling on colour and nutritional properties of rice. Food Chem. 2007, 99, 1496–1503. [Google Scholar] [CrossRef] [Scilit]
- Cheng, S.; Ashraf, U.; Zhang, T.T.; Mo, Z.; Kong, L.; Mai, Y.; Huang, H.; Tang, X. Different seedling raising methods affect characteristics of machine-transplanted rice seedlings. Appl. Ecol. Env. Res. 2018, 16, 1399–1412. [Google Scholar] [CrossRef] [Scilit]
- Esa, N.M.; Kadir, K.A.; Amom, Z.; Azlan, A. Improving the lipid profile in hypercholesterolemia-induced rabbit by supplementation of germinated brown rice. J. Agr. Food Chem. 2011, 59, 7985–7991. [Google Scholar]
- Spanier, A.M.; Shahidi, F.; Parliament, T.H.; Mussinan, C.; Ho, C.T.; Contis, E.T.; Kayahara, H.; Tsukahara, K.; Tatai, T. Flavor, health and nutritional quality of pre-germinated brown rice. In Food Flavors and Chemistry: Advances of the New Millennium, 1st ed.; Spanier, A.M., Shahidi, F., Parliament, T.H., Mussinan, C., Ho, C.T., Contis, E.T., Eds.; Royal Society of Chemistry: London, UK, 2001; pp. 546–551. [Google Scholar]
- Liang, H.; Cheng, P.; Lin, H.; Hao, C.; Ke, L.; Chou, H.; Tseng, Y.; Yen, H.; Shen, K. Extract of pre-germinated brown rice protects against cardiovascular dysfunction by reducing levels of inflammation and free radicals in a rat model of type II diabetes. J. Funct. Foods 2020, 75, 104218. [Google Scholar] [CrossRef] [Scilit]
- Wunjuntuk, K.; Kettawan, A.; Rungruang, T.; Charoenkiatkul, S. Anti-fibrotic and anti-inflammatory effects of parboiled germinated brown rice (Oryza sativa ‘KDML 105’) in rats with induced liver fibrosis. J. Funct. Foods 2016, 26, 363–372. [Google Scholar] [CrossRef] [Scilit]
- Miura, D.; Ito, Y.; Mizukuchi, A.; Kise, M.; Aoto, H.; Yagasaki, K. Hypocholesterolemic action of pre-germinated brown rice in hepatoma-bearing rats. Life Sci. 2006, 79, 259–264. [Google Scholar] [CrossRef] [Scilit]
- Roohinejad, S.; Omidizadeh, A.; Mirhosseini, H.; Saari, N. Effect of pre-germination time of brown rice on serum cholesterol levels of hypercholesterolaemic rats. J. Sci. Food Agr. 2010, 90, 245–251. [Google Scholar] [CrossRef] [Scilit]
- Chalermchaiwat, P.; Jangchud, K.; Jangchud, A.; Charunuch, C.; Prinyawiwatkul, W. Antioxidant activity, free gamma-aminobutyric acid content, selected physical properties and consumer acceptance of germinated brown rice extrudates as affected by extrusion process. LWT Food Sci. Technol. 2015, 64, 490–496. [Google Scholar] [CrossRef] [Scilit]
- Kendall, C.W.; Esfahani, A.; Jenkins, D.J. The link between dietary fibre and human health. Food Hydrocolloid. 2010, 24, 42–48. [Google Scholar] [CrossRef] [Scilit]
- Choe, H.; Sung, J.; Lee, J.; Kim, Y. Effects of calcium chloride treatment on bioactive compound accumulation and antioxidant capacity in germinated brown rice. J. Cereal Sci. 2021, 101, 103294. [Google Scholar] [CrossRef] [Scilit]
- Shaikhali, J.; Baier, M. Ascorbate regulation of 2-Cys peroxiredoxin-A promoter activity is light-dependent. J. Plant Physiol. 2010, 167, 461–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, X.; Liu, J.; Li, W.; Wen, T.; Li, T.; Guo, X.; Liu, R. Biosynthesis and accumulation of multi-vitamins in black sweet corn (Zea mays L.) during kernel development. J. Sci. Food Agr. 2020, 100, 5230–5238. [Google Scholar] [CrossRef] [Scilit]
- Mène-Saffrané, L.; Pellaud, S. Current strategies for vitamin E biofortification of crops. Curr. Opin. Biotech. 2017, 44, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Rohmer, M. Mevalonate-independent methylerythritol phosphate pathway for isoprenoid biosynthesis. Elucidation and distribution. Pure Appl. Chem. 2003, 75, 375–388. [Google Scholar] [CrossRef] [Scilit]
- Cahoon, E.B.; Hall, S.E.; Ripp, K.G.; Ganzke, T.S.; Hitz, W.D.; Coughlan, S.J. Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and increased antioxidant content. Nat. Biotechnol. 2003, 21, 1082–1087. [Google Scholar] [CrossRef] [Scilit]
- Rohmer, M.; Knani, M.; Simonin, P.; Sutter, B.; Sahm, H. Isoprenoid biosynthesis in bacteria: A novel pathway for the early steps leading to isopentenyl diphosphate. Biochem. J. 1993, 295, 517–524. [Google Scholar] [CrossRef] [Scilit]
- Schwender, J.; Gemünden, C.; Lichtenthaler, H.K. Chlorophyta exclusively use the 1-deoxyxylulose 5-phosphate/2-C-methylerythritol 4-phosphate pathway for the biosynthesis of isoprenoids. Planta 2001, 212, 416–423. [Google Scholar] [CrossRef] [Scilit]
- Garcia, I.; Rodgers, M.; Pepin, R.; Hsieh, T.; Matringe, M. Characterization and subcellular compartmentation of recombinant 4-hydroxyphenylpyruvate dioxygenase from arabidopsis in transgenic tobacco. Plant Physiol. 1999, 119, 1507–1516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dellapenna, D. A decade of progress in understanding vitamin E synthesis in plants. J. Plant Physiol. 2005, 162, 729–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dellapenna, D. Progress in the dissection and manipulation of vitamin E synthesis. Trends Plant Sci. 2005, 10, 574–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DellaPenna, D.; Pogson, B.J. Vitamin synthesis in plants: Tocopherols and carotenoids. Annu. Rev. Plant Biol. 2006, 57, 711–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, X.; Tang, Y.; Sun, X.; Tang, K. Metabolic regulation of vitamins C and E in higher plants. Plant Physiol. Commun. 2011, 47, 731–744. [Google Scholar]
- Chaudhary, N.; Khurana, P. Vitamin E biosynthesis genes in rice: Molecular characterization, expression profiling and comparative phylogenetic analysis. Plant Sci. 2009, 177, 479–491. [Google Scholar] [CrossRef] [Scilit]
- Xiang, N.; Li, C.; Li, G.; Yu, Y.; Hu, J.; Guo, X. Comparative evaluation on vitamin E and carotenoid accumulation in sweet corn (Zea mays L.) seedlings under temperature stress. J. Agric. Food Chem. 2019, 67, 9772–9781. [Google Scholar] [CrossRef] [Scilit]
- Xie, L.; Yu, Y.; Mao, J.; Liu, H.; Hu, J.; Li, T.; Guo, X.; Liu, R. Evaluation of biosynthesis, accumulation and antioxidant activity of vitamin E in sweet corn (Zea mays L.) during kernel development. Int. J. Mol. Sci. 2017, 18, 2780. [Google Scholar] [CrossRef] [Scilit]
- Shin, T.; Godber, J.S. Improved high-performance liquid chromatography of vitamin E vitamers on normal-phase columns. J. Am. Oil Chem. Soc. 1993, 70, 1289–1291. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Mo, Z.; Li, Y.; Nie, J.; Kong, L.; Ashraf, U.; Pan, S.; Duan, M.; Tian, H.; Tang, X. Additional nitrogen application under different water regimes at tillering stage enhanced rice yield and 2-acetyl-1-pyrroline (2AP) content in fragrant rice. J. Plant Growth Regul. 2022, 41, 954–964. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Tian, H.; Zhang, M.; Fan, P.; Ashraf, U.; Liu, H.; Chen, X.; Duan, M.; Tang, X.; Wang, Z.; et al. Deep placement of nitrogen fertilizer increases rice yield and nitrogen use efficiency with fewer greenhouse gas emissions in a mechanical direct-seeded cropping system. Crop J. 2021, 9, 1386–1396. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Wang, R.; Chen, P.; He, T.; Bai, B. Study on zinc accumulation, bioavailability, physicochemical and structural characteristics of brown rice combined with germination and zinc fortification. Food Res. Int. 2022, 158, 111450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.; Kim, O.W.; Ahn, J.H.; Kim, B.M.; Oh, J.; Kim, H.J. Metabolomic analysis of germinated brown rice at different germination stages. Foods 2020, 9, 1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.; Han, J.; Lim, S.; Cho, D. Effects of germination and roasting on physicochemical and sensory characteristics of brown rice for tea infusion. Food Chem. 2021, 350, 129240. [Google Scholar] [CrossRef] [Scilit]
- Do Nascimento, L.Á.; Abhilasha, A.; Singh, J.; Elias, M.C.; Colussi, R. Rice germination and its impact on technological and nutritional properties: A review. Rice Sci. 2022, 29, 201–215. [Google Scholar] [CrossRef] [Scilit]
- Gao, Z.; Xie, W.; Ashraf, U.; Li, Y.; Ma, L.; Gui, R.; Pan, S.; Tian, H.; Duan, M.; Wang, S.; et al. Exogenous γ-aminobutyric acid (GABA) application at different growth stages regulates 2-acetyl-1-pyrroline, yield, quality and antioxidant attributes in fragrant rice. J. Plant Interact. 2020, 15, 139–152. [Google Scholar] [CrossRef] [Scilit]
- Xie, W.; Kong, L.; Ma, L.; Ashraf, U.; Pan, S.; Duan, M.; Tian, H.; Wu, L.; Tang, X.; Mo, Z. Enhancement of 2-acetyl-1-pyrroline (2AP) concentration, total yield, and quality in fragrant rice through exogenous γ-aminobutyric acid (GABA) application. J. Cereal Sci. 2020, 91, 102900. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.Y.; Lee, S.H.; Jang, G.Y.; Li, M.; Lee, Y.R.; Lee, J.; Jeong, H.S. Changes of phenolic-acids and vitamin E profiles on germinated rough rice (Oryza sativa L.) treated by high hydrostatic pressure. Food Chem. 2017, 217, 106–111. [Google Scholar] [CrossRef] [Scilit]
- Yodpitak, S.; Mahatheeranont, S.; Boonyawan, D.; Sookwong, P.; Roytrakul, S.; Norkaew, O. Cold plasma treatment to improve germination and enhance the bioactive phytochemical content of germinated brown rice. Food Chem. 2019, 289, 328–339. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.Y.; Hwang, I.G.; Kim, T.M.; Woo, K.S.; Dong, S.P.; Kim, J.H.; Kim, D.L.; Lee, L.; Lee, Y.R.; Leong, H.S. Chemical and functional components in different parts of rough rice (Oryza sativa L.) before and after germination. Food Chem. 2012, 134, 288–293. [Google Scholar] [CrossRef] [Scilit]







| Gene Name | Primers |
|---|---|
| Osγ-TMT (LOC_Os02g47310) | F 5′-CCAGACTGGTGCTCTCCTTC-3′ |
| R 5′-CATCAGAGGCATCACCATTG-3′ | |
| OsHPPD (LOC_Os02g07160) | F 5′-AGGAGACAGGCCAACCTTTT-3′ |
| R 5′-TGAACTGTAGGGGCTTGCTT-3′ | |
| OsTC (LOC_Os02g17650) | F 5′-ATGTCTTCTCAGGCGCATCT-3′ |
| R 5′-GTGCCTGGTTCTTTTGTGGT-3′ | |
| OsHPT (LOC_Os06g44840) | F 5′-GTCCGATGTGTCTCCCTTGT-3′ |
| R 5′-TCCCCAGATGCTAATGGAAG-3′ | |
| OsHGGT (LOC_Os06g43880) | F 5′-AACAAAGTCGGTGGTTTTCG-3′ |
| R 5′-GATGATGCTCCAGCCAAAAT-3′ | |
| OsMPBQ/MT2 (LOC_Os12g42090) | F 5′-AGTTCTTATGAGCTTAATCAAGGT-3′ |
| R 5′-TTTCTGTCAGTTCTGTATTTACTTCTGTTG-3′ | |
| OsDXS1 (NM_001062059) | F 5′-ACCAAACGCTCATCAGGAGG-3′ |
| R 5′- GTGGTCGATGTACCTGTCGG -3′ | |
| Ubi-Q | F 5′- ACCACTTCGACCGCCACTACT -3′ |
| R 5′- ACGCCTAAGCCTGCTGGTT -3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, L.; Lin, Y.; Liang, J.; Hu, X.; Ashraf, U.; Guo, X.; Bai, S. Dynamic Changes in Vitamin E Biosynthesis during Germination in Brown Rice (Oryza sativa L.). Foods 2022, 11, 3200. https://doi.org/10.3390/foods11203200
Kong L, Lin Y, Liang J, Hu X, Ashraf U, Guo X, Bai S. Dynamic Changes in Vitamin E Biosynthesis during Germination in Brown Rice (Oryza sativa L.). Foods. 2022; 11(20):3200. https://doi.org/10.3390/foods11203200
Chicago/Turabian StyleKong, Leilei, Yingxin Lin, Jiayan Liang, Xiaodan Hu, Umair Ashraf, Xinbo Guo, and Song Bai. 2022. "Dynamic Changes in Vitamin E Biosynthesis during Germination in Brown Rice (Oryza sativa L.)" Foods 11, no. 20: 3200. https://doi.org/10.3390/foods11203200
APA StyleKong, L., Lin, Y., Liang, J., Hu, X., Ashraf, U., Guo, X., & Bai, S. (2022). Dynamic Changes in Vitamin E Biosynthesis during Germination in Brown Rice (Oryza sativa L.). Foods, 11(20), 3200. https://doi.org/10.3390/foods11203200

