Next Article in Journal
Investigation of Phenolic Composition and Anticancer Properties of Ethanolic Extracts of Japanese Quince Leaves
Next Article in Special Issue
NGS Techniques Reveal a High Diversity of RNA Viral Pathogens and Papillomaviruses in Fresh Produce and Irrigation Water
Previous Article in Journal
Development of Antioxidant and Antihypertensive Properties during Growth of Lactobacillus helveticus, Lactobacillus rhamnosus and Lactobacillus reuteri on Cow’s Milk: Fermentation and Peptidomics Study
Previous Article in Special Issue
The Unexplored Virome of Two Atlantic Coast Fish: Contribution of Next-Generation Sequencing to Fish Virology
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Milk

by
Ondrej Holý
1,*,
Julio Parra-Flores
2,*,
Sarah Lepuschitz
3,
María Paula Alarcón-Lavín
2,
Ariadnna Cruz-Córdova
4,
Juan Xicohtencatl-Cortes
4,
Jetsi Mancilla-Rojano
4,5,
Werner Ruppitsch
3 and
Stephen Forsythe
6
1
Department of Public Health, Palacký University Olomouc, 77515 Olomouc, Czech Republic
2
Department of Nutrition and Public Health, Universidad del Bío-Bío, Chillán 3800708, Chile
3
Austrian Agency for Health and Food Safety, Institute for Medical Microbiology and Hygiene, 1220 Vienna, Austria
4
Intestinal Bacteriology Research Laboratory, Hospital Infantil de México Federico Gómez, Mexico City 06720, Mexico
5
Biological Sciences Graduate Program, Facultad de Medicina, Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México, Mexico City 04510, Mexico
6
Adams Hill, Keyworth, Nottinghamshire NG12 5GY, UK
*
Authors to whom correspondence should be addressed.
Foods 2021, 10(1), 20; https://doi.org/10.3390/foods10010020
Submission received: 2 December 2020 / Revised: 14 December 2020 / Accepted: 19 December 2020 / Published: 23 December 2020

Abstract

Cronobacter spp. are opportunistic pathogens of the Enterobacteriaceae family. The organism causes infections in all age groups, but the most serious cases occur in outbreaks related to neonates with meningitis and necrotizing enterocolitis. The objective was to determine the in silico and in vitro putative virulence factors of six Cronobacter sakazakii strains isolated from powdered milk (PM) in the Czech Republic. Strains were identified by MALDI-TOF MS and whole-genome sequencing (WGS). Virulence and resistance genes were detected with the Ridom SeqSphere+ software task template and the Comprehensive Antibiotic Resistance Database (CARD) platform. Adherence and invasion ability were performed using the mouse neuroblastoma (N1E-115 ATCCCRL-2263) cell line. The CRISPR-Cas system was searched with CRISPRCasFinder. Core genome MLST identified four different sequence types (ST1, ST145, ST245, and ST297) in six isolates. Strains 13755-1B and 1847 were able to adhere in 2.2 and 3.2 × 106 CFU/mL, while 0.00073% invasion frequency was detected only in strain 1847. Both strains 13755-1B and 1847 were positive for three (50.0%) and four virulence genes, respectively. The cpa gene was not detected. Twenty-eight genes were detected by WGS and grouped as flagellar or outer membrane proteins, chemotaxis, hemolysins, and invasion, plasminogen activator, colonization, transcriptional regulator, and survival in macrophages. The colistin-resistance-encoding mcr-9.1 and cephalothin-resis-encoding blaCSA genes and IncFII(pECLA) and IncFIB(pCTU3) plasmids were detected. All strains exhibited CRISPR matrices and four of them two type I-E and I-F matrices. Combined molecular methodologies improve Cronobacter spp. decision-making for health authorities to protect the population.

1. Introduction

The Cronobacter genus was first defined by Iversen et al. [1] and further developed by Iversen et al. [2] and Joseph et al. [3] to include the C. sakazakii, C. malonaticus, C. universalis, C. turicensis, C. muytjensii, C. dublinensis, and C. condimenti species [3]. The population groups most affected by Cronobacter spp. are newborns and the elderly. Holý et al. [4] isolated Cronobacter spp. in 82 of 45,000 analyzed samples and found an incidence (×1000 samples) of 8.7, 8.2, and 4.8 in infants under 1 y of age, children between 1 and 4 y, and adults over 65, respectively. The fatality rates associated with general infection range from 42% to 80% and 15% to 25% for neonatal meningitis and septicemia, respectively [5]. The highest incidence and severity has occurred in infants, and a number of outbreaks in neonatal intensive care units have been reported [5,6]. Clinical symptoms in infants are primarily meningitis, septicemia, or necrotizing enteritis [7,8,9]. Other symptoms can include diarrhea and urinary tract infection.
Infections are often associated with the consumption of reconstituted powdered infant formula (RPIF) caused by either intrinsic contamination of powdered infant formula (PIF) or extrinsic contamination of preparation utensils and equipment [10]. Given that it is widespread, Cronobacter spp. can be isolated from PIF, powdered milk, infant cereals and other products, and water [11,12]. Controlling the organism during PIF production is important because Cronobacter spp. strains have been isolated up to 24 months after the PIF was packaged [13]. Studies of Cronobacter spp. incidence in PIF have shown an incidence ranging from 3% to 30% [14,15,16,17].
The antibiotic resistance profile of Cronobacter is important because the population group consuming PIF and infant products is immunologically vulnerable. Molloy et al. [18] reported that 51% of 33 C. sakazakii isolated strains were resistant to cephalothin. Carvalho et al. [19] indicated high resistance to cefazolin (94.4%) and low resistance to amoxicillin (9.45%), cefpodoxime (5.55%), streptomycin (1.35%), and trimethoprim/sulfamethoxazole (1.35%). An 80% resistance to cephalothin was reported in another study [20]. Fei et al. [21] found varying degrees of resistance to cefazolin and 100% resistance to amoxicillin-clavulanate, ampicillin, and cefazolin in 70 strains of C. sakazakii isolated from PIF and corresponding processing environments.
Many virulence traits have been identified in Cronobacter spp. [22,23], including the association with inositol fermentation [24], invasion and adherence in cellular lines such as HEp-2 and CaCo, the presence of endotoxins [25], detection of virulence genes cpa, hly, and sip [22,26], flagella [27], and the ompA and ompX genes [28]. In addition, there are other factors such as the use of sialic acid and the presence of a capsule [29]. Strains related to severe cases of meningitis are also associated with clonal complex 4 (CC4) [30]; therefore, it is suggested that not all C. sakazakii strains are equally virulent [6].
Molecular subtyping has long been considered as a useful tool in epidemiological surveillance to establish the similarity of bacteria colonizing a particular ecological habitat. Sub-typing of Cronobacter spp. has used pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and, recently, typing by CRISPR-Cas characterization systems [31]. This is possible because the matrices that constitute these systems can differ among closely related strains, since the genetic information acquired as a result of different exposures to phages and plasmids leads to variations in the repeated sequences and spacers that form them. Therefore, the CRISPR-cas profiles can show a better resolution compared with MLST and PFGE; for this reason, they are used to differentiate highly related strains such as Cronobacter spp. Recently, CRISPR-Cas typing was reported as a valuable tool when developing new methods for the early diagnosis of infectious diseases [32]. Whole-genome sequencing (WGS) is a modern tool for the genomic research of Cronobacter spp., and it can be used to expand the original 7-loci MLST scheme to 1836 loci of core genome MLST (cgMLST) [33]. The use of the MLST scheme for clinical, food, and environmental isolates has provided information that is relevant for Cronobacter spp. and its sources of isolation to analyze the severity of the clinical manifestation in several age groups [34].
The complete genome studies of pathogenic strains have greatly improved our knowledge about the virulence and antibiotic resistance genes [35]. This knowledge leads to an understanding of how pathogens survive by using various mechanisms to infect and elicit variable host disease responses. The aim of the present study was to perform a molecular characterization of six C. sakazakii strains isolated from powdered milk in the Czech Republic between 2010 and 2014 in order to identify their virulence potential and the possible presence of antibiotic resistance genes.

2. Materials and Methods

2.1. Strains Used in This Study

Strains 1847, 13755-1A, 13755-1B, 12683-2A, 12683-1, and 6227 were used in this study and were isolated from 1450 powdered milk samples produced in the Czech Republic between 2010 and 2014 by three manufacturers, A (n = 1), B (n = 4), and C (n = 1).

2.2. Isolation and Primary Species Identification of Cronobacter Sakazakii Isolates

The C. sakazakii strains were isolated according to the methodology described by Iversen et al. [36] and conserved at −18 °C. Isolates were cultured on Columbia blood agar plates (bioMérieux, Marcy-l’Étoile, France) overnight at 37 °C to identify them. Primary species identification from single colonies was performed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) (Bruker, Billerica, MA, USA) and with the MBT Compass IVD software 4.1.60 (Bruker) described by Lepuschitz et al. [37].

2.3. Whole-Genome Sequencing (WGS) Data Analysis

The DNA isolation, quantification, and preparation of sequence-ready libraries for whole-genome sequencing (WGS) were as indicated by Lepuschitz et al. [38]. The Sequencing Coverage Calculator (https://www.illumina.com) was used to calculate a desired mean coverage > fold-80.
Raw reads were de novo assembled with the SPAdes version 3.9.0 [39] and processed with the SeqSphere+ software version 5.1.0 (Ridom GmbH, GmbH, Münster, Germany). A gene-by-gene genome-wide comparison was performed for bacterial typing by the MLST+ task template function of SeqSphere+, as previously described [40], and the core genome multilocus sequence type (cgMLST) gene set was defined according to Lepuschitz et al. [38]. Based on the defined cgMLST scheme, isolates were visualized as a minimum spanning tree (MST) to identify genotypic relationships. Sequences of the seven housekeeping genes of the usual MLST scheme were extracted and queried against the Cronobacter MLST database and the sequence types (STs) in silico were determined [6].

2.4. O-Serotype Determination Analysis

The gene clusters of the gnd and galF loci are specific to the O-serotype region. They were identified by analyzing WGS sequences via the BIGSdb tools in the PubMLST database (http://pubmlst.org/cronobacter/) [31].

2.5. Adherence Assay

The mouse neuroblastoma (N1E-115 ATCC CRL-2263, Manassas, USA) cell line was used for the adherence assay. The N1E-115 cell line was cultured in Dulbecco’s Modified Eagle Medium (DMEM) with 4.5 g/L glucose (GIBCO, MA, USA). In addition, it was supplemented with 7% fetal bovine serum (FBS) (GIBCO, MA, USA) and differentiated in DMEM medium to which 2% FBS and 1.25% dimethyl sulfoxide was added for 5 d. The cells (1 × 105 cells/mL) were sown in 24-well plates (Corning Life Sciences, NY, USA) and infected at a multiplicity of infection100:1. All the studied isolates were previously cultured in Luria broth (LB). Infection was carried out at 37 °C for 4 h and 5% CO2. After incubation, the cells were washed with PBS 1× and the bacteria removed by adding 1 mL 0.1% Triton X-100 (Amresco, OH, USA). Afterward, serial dilutions were plated on LB to determine the colony-forming units (CFU) of bacteria adhering to the N1E-115 cell [22]. This assay was repeated twice and in duplicate; the data were expressed as the means plus the standard deviation of the assay results.

2.6. Invasion Assay

The conditioning of the monolayers of cell line N1E-115 and infection time were performed as previously described in Section 2.5. After a 4-h incubation, the infected monolayers were washed with PBS 1× and incubated with 1 mL DMEM with 300 µg/mL lysozyme (Sigma-Aldrich, MI, USA) and 100 µg/mL gentamicin (Sigma-Aldrich, MI, USA) at 37 °C for 2 h and 5% CO2. After incubation, cells were washed three times with PBS 1×, detached with 1 mL 0.1% Triton X-100, and plated on LB. Invasion frequencies were calculated as the number of bacteria surviving incubation with gentamicin and lysozyme divided by the total number of bacteria present when this antibiotic is not used (bacterial adherence) [22]. This assay was conducted twice and in duplicate; data were expressed as invasion frequency (%).

2.7. In Vitro Virulence Gene Detection

Plasminogen activator (cpa), hemolysin (hly), siderophore-interacting protein (sip), flagellin (fliC), autotransporter (aut), and outer membrane protein (ompA) genes were detected by polymerase chain reaction (PCR) [23]. Amplified products were stained and visualized on 1.5% agarose gel with a 1.0 mg/mL ethidium bromide solution using a gel imaging system [22,23].

2.8. Antibiotic Resistance Profile

The disk diffusion method was used in accordance with the recommendations of EUCAST 2019. Commercial antibiotic disks were used and consisted of ampicillin (10 μg), amikacin (30 μg), levofloxacin (5 μg), cephalothin (30 μg), cefotaxime (30 μg), ceftriaxone (30 μg), chloramphenicol (30 μg), gentamicin (10 μg), netilmicin (30 μg), nitrofurantoin (300 μg), cefepime (30 μg), and sulfamethoxazole trimethoprim (25 μg). The resistance/susceptibility profiles were determined according to the manufacturer’s instructions. The Escherichia coli ATCC 25922 strain was used as a control.

2.9. In Silico Detection of Virulence and Antibiotic Resistance Genes from Whole Genome Sequencing (WGS) Data

The existence of virulence genes was confirmed by the Task Template function in SeqSphere+ for WGS data included in the virulence factor database (http://www.mgc.ac.cn/VFs/). Thresholds for the target scan procedure were set at ≥ 90% to identify the reference sequence and ≥ 99% aligned to the reference sequence [38].
The presence of antimicrobial resistance genes was determined by the Comprehensive Antibiotic Resistance Database (CARD) with the “perfect” and “strict” default settings for sequence analysis [41] and Task Template AMRFinderPlus 3.2.3 available in the Ridom SeqSphere + 7.0 software using the EXACT method: 100% sequence match over 100% of the length of a protein in the database that is not a named allele. The BLAST alignment is >90% of length and >90% identified to a protein in the AMRFinderPlus database.

2.10. Plasmid Detection

We used the PlasmidFinder 1.3 function to detect the plasmids [42], available from the Center for Genomic Epidemiology (http://www.genomicepidemiology.org/).

2.11. Profiling of CRISPR-Cas Loci

The search and characterization of the CRISPR matrices and the associated cas genes were determined with CRISPRCasFinder [43], which is available from the Institut de Biologie Intégrative de la Cellule and Université Paris-Saclay server (https://crisprcas.i2bc.paris-saclay.fr). The CRISPRDigger program was used to determine the type of CRISPR-Cas system [44].

3. Results and Discussion

Primary species identification by MALDI-TOF MS identified the six strains isolated from powdered milk in the Czech Republic between 2010 and 2014 as C. sakazakii. Further analysis by WGS identified four different STs among the six isolates (ST1: 13755-1B, 12683-1; ST145: 6227; ST245: 1847, 13755-1A; ST297: 12683-2A) (Table 1), and isolates with concordant STs shared the same O-serotype-specific gene loci for gnd and galF (ST1: 2 (galF) and 1 (gnd); ST145: 25 and 23; ST245: 45 and 58; ST297: 17 and 18).
Calculation of a Minimum Spanning Tree (MST) (Figure 1) revealed four singleton isolates with a maximum allelic difference of 2642 and identified the presence of one cluster comprising two isolates, both belonging to ST245 and sharing the same set of cgMLST loci (isolates 13755-1A and 1847). To date, C. sakazakii ST245 has been primarily isolated from clinical cases; however, it has not been previously described in PIF. Meanwhile, C. sakazakii ST145 has been isolated in spices in China and soil in Germany (www.PubMLST.org/cronobacter/). Previously isolated from PIF, ST1 was detected twice in the present study and has been associated with fatal meningitis, septicemia, and urinary tract infections [45]. The detection of these C. sakazakii clones (ST1, ST245) in PIF and human samples confirms contaminated PIF as a possible source of infection and a potential health risk to infants. Lepuschitz et al. [38] concluded that the accurate identification of C. sakazakii is still a diagnostic challenge for many laboratories, and the current use of incorrect or outdated detection schemes would explain the low prevalence of C. sakazakii clinical isolates found in their EU study. Whole-genome sequencing can be applied to foodborne outbreaks to establish epidemiological links. It can also identify virulence loci, antibiotic resistance, and genotype, thus facilitating more accurate risk management [46].
Cronobacter spp. exhibit diverse virulence factors in the pathogenic process to intestinal cells such as adherence, invasion, toxin and hemolysin genes, and the ability to resist destruction by human serum [47,48,49,50]. Only strains 1847 (ST245) and 13755-1B (ST1) were selected to conduct the assays in a cell line because the STs were previously isolated from clinical cases. The strains were able to adhere to the cell line N1E-115 ATCC CRL-2263 with values of 2.2 and 3.2 × 106 CFU/mL for strains 13755 and 1847, respectively (Figure 2). Adherence to intestinal cells is the first step in the pathogenic process [51]. This virulence characteristic has been studied in different cell lines such as N1E-115, HEp-2, CaCo-2, HBMEC, and IEC-6; the results have shown different variations depending on the type of cell line and strain being used [48,49,52]. The C. sakazakii strains isolated in clinical cases exhibited adherence rates that are higher (0.915%) than those from other sources (0.0002%) [23]. For the invasion assay, only strain 1847 was able to invade at a lower rate (0.00073%) compared with results reported by Mange et al. [48], Townsend et al. [49], Parra-Flores et al. [20], and Holý et al. [23].
Virulence factors must be studied to understand the pathogenic process and its relationship with the host [53]. In the present study, when evaluating the presence of six virulence factors by PCR, strain 13755-1B amplified three genes ompA, aut, and fliC and strain 1847 amplified the four genes ompA, aut, fliC, and hlyA (Table 2).
The results of the analysis of the whole genome of the six C. sakazakii strains was the presence of 28 virulence genes; these were grouped as flagellar or outer membrane proteins, chemotaxis, hemolysins, and invasion (labp), plasminogen activator (cpa), colonization (mviN), transcriptional regulator (sdiA), and survival in macrophages (Table 3). Virulence values determined by WGS were comparable to the PCR results. For example, the hly gene was amplified by PCR only for strain 1847, although it was present in both strains when analyzed in silico by WGS. Meanwhile, the inv gene was not detected by PCR in neither of the two evaluated strains; however, it was present in strain 1847 when analyzed by WGS. These results in strains 1847 and 13755-1B concur with the previously mentioned invasion and adherence assays. The cpa gene was not amplified by PCR and was not present in WGS. This can be explained by the fact that a greater number of strain activations for experimental work have produced some mutations that cause changes or non-expression of a certain phenotypic or genotypic quality in the strains being evaluated [54]. The OmpA protein is more than 80% the same as has the E. coli K1 protein, which significantly participates in the invasion of neonatal blood–brain barrier cells [55]. The proteins OmpA and OmpX of Cronobacter spp are important for adhesion to the CaCo-2 and INT-407 cell lines; they are also capable of causing damage to intestinal cells and eliminating villi [28,48]. The Cpa protein is considered as a key virulence factor involved in serum resistance and invading C. sakazakii. Evolutionary evidence suggests that the cpa locus can be a specific locus for C. sakazakii and C. universalis [26]. However, some ST8 clinical strains of C. sakazakii that have the pESA3 virulence plasmid do not have cpa yet remain are considered extremely virulent. This suggests there are other virulence factors besides cpa that can be responsible for the infection [56]. The Hly (type III hemolysin) is a protein of the external membrane found in several pathogens with hemolytic ability [57,58]. It was present when analyzing the C. sakazakii BAA-894 strain isolated from the 2001 NICU outbreak in the United States [59]. The autotransporter gene (aut) has been identified in E. coli and other Enterobacteriaceae; it is associated with adherence, aggregation, invasion, biofilm formation, and toxicity [60]. The fliC gene is a flagellar protein and a subunit of the flagellar organelle; it is primarily responsible for bacterial motility, adherence ability, and virulence traits of microorganisms [61]. Hoeflinger and Miller [62] evaluated flagella-mediated autoaggregation and determined that the flagella play an important role in the pathogenesis of C. sakazakii. Aldubyan et al. [63] established the significant role of flagella in the adherence and invasion of pathogens that contain fliC. Decreased motility has been related to the loss of the fliC gene. Dingle et al. [64] determined the important role of the FliC and FliD flagellar subunit, which increased the adherence to Caco-2 cells compared with the wild type; mutants are also more virulent. These virulence factors established as flagella-associated genes, outer membrane protein genes, and some regulators can be related to motility, biofilm formation, and virulence characterization in Cronobacter [65].
When evaluating the antibiotic resistance profile of the two selected strains (1847 and 13755-1B), both were resistant to cephalothin, whereas strain 13755-1B was resistant to ceftazidime and strain 1847 to ampicillin. Several authors have identified the resistance of C. sakazakii to cephalothin, ceftazidime, and ampicillin [18,66,67]. Some strains were resistant to ampicillin, cephalothin, and cefotaxime in a collection of Cronobacter spp. strains isolated by Parra et al. [68]. In contrast, Holý et al. [23] found no resistant strains. A recent study by Parra et al. [17] found that 100% of the C. sakazakii strains isolated from powdered milk were resistant to cefotaxime and ampicillin. In addition, resistance to cefepime and amikacin was 60% and 40% for ceftriaxone. In addition, one strain was resistant to six of the 12 evaluated antibiotics (54.5%), while another C. sakazakii isolated strain was resistant to five (50%). Resistance values in the present study are higher than those reported in the current literature, and should be studied in the event of the appearance of multi-resistant C. sakazakii strains in powdered milk (PM) and the associated health risk to infants and children.
A total of 12 genes were detected in silico by CARD, thus conferring antibiotic resistance against beta-lactams, fluoroquinolones, aminoglycosides, and phosphonates (Table 4). Of the 12 antibiotic resistance genes, including antibiotic efflux (n = 8), antibiotic target alteration (3), and antibiotic target protection (1), 11 were present in all the isolates. The antibiotic target protection gene (vgaC) was present in only three of the six isolates and the marA gene, whose function is as a transcription factor that upregulates multidrug efflux and downregulates membrane permeability, was found in all the isolates. As in our study, Aly et al. [69] found msbA, emrR, H-NS, emrB, marA, CRP, and PBP3 to be associated with resistance to several antibiotics such as beta-lactams, tetracycline, macrolide, fluoroquinolone, penams, cephalosporin, and cephamycin. Active flow pumps provide a mechanism to increase resistance by improving the survival of enterobacteria in the gastrointestinal tract of the host and allowing the invasion of microvascular endothelial cells in the brain [70,71]. Studies have demonstrated that the abuse of antibiotics in food environments and the presence of several antibiotic resistant operons (mar) can cause Cronobacter spp. to develop resistance to many different antibiotics [66,67,72].
When complementing our research with the AMRFinderPlus tool, strains 1847, 13755-1A, 12683-1, and 12683-2A exhibited the mcr-9.1 gene associated with resistance to colistin and the gene blaCSA that provides resistance to cephalothin in 100% (6/6) of the strains evaluated in the study. The mcr-9.1 gene is considered as a new gene that can attribute phenotypic resistance to colistin in various Enterobacteriaceae spp. reported in Salmonella typhimurium, Escherichia coli, and Enterobacter hormaechei in 2019. They can circulate without being detected, unless induced by colistin [73,74,75]. The presence of mobile genes that are resistant to colistin (mcr) is a worldwide concern because colistin is perceived as a last resort antimicrobial to treat infections caused by multi-resistant Enterobacteriaceae [76]. The blaCSA family of genes, resistant to class C β-lactamase, was described by Müller et al. [77]. The members of this family of β-lactamases are not inducible and are regarded as cephalosporinases. Jang et al. [56] found that the C. sakazakii strains isolated from houseflies had class C blaCSA resistance genes. They also encountered variants of class C bla resistance genes identified as CSA-2 or CSA-1.
Strains 1847 and 13755-1A, present in IncFII (pECLA) plasmid (Table 5), are associated with antibiotic resistance genes in Cronobacter, such as carbapenemase genes ∆intI1–blaIMP-26, blaCSA, blaCMA, and IS26 flanking blaSFO-1 [77,78].
Strain 12683-2A exhibited an IncFIB (pCTU1) plasmid, which is also associated with antibiotic resistance (Table 4). Meanwhile, pCTU1 encodes similar gene groups or gene clusters comprising the plasmid backbone, a replication gene similar to RepFIB (repA), two iron acquisition systems, a siderophore similar to aerobactin (called cronobactin), a group of iron ABC transport genes, and several species-specific virulence gene determinants such as the cpa gene [79]. Therefore, the absence of pCTU1 type plasmids in strains 1847 and 13755-1A can explain the non-detection of the cpa gene by PCR and WGS [56].
The CRISPR-Cas systems are associated with the acquisition of mobile genetic material through horizontal transfer; they are regarded as an immunity system. These contain information that the bacteria have acquired through the virus and plasmids. They consist of two principal components: a guide RNA (gRNA) and a non-specific endonuclease associated with genes that code for cas, both of which are indispensable for the activity and incorporation of genetic material [80]. When analyzing the genomes of the six C. sakazakii strains in the present study, we found that 100% (6/6) exhibited a series of repeated sequences and spacers, which constitute matrices associated with type I-F and I-E CRISPR systems; the four strains 13755-1A, 13755-1B, 12683-2A, and 12683-1 were included in both systems (Table 6). Regarding the characteristics of the CRISPR matrices, we encountered five different repeated consensus sequences associated with the type I-E system, and the sequence GTGTTCCCCGCGCGAGCGGGGATAAACCG was the most frequent because it was associated with four of the six strains under study; however, strains 13755-1A and 6227 exhibited only one repeated consensus sequence. For the type I-F system, three different repeated sequences were found; the sequence GTTCACTGCCGTACAGGCAGCTTAGAAA was the most frequent and sequence TTTCTAAGCTGCCTGTACGGCAGTGAAC was distinctive of strain 12683-A. Although the sequences that characterize each system can be identical, one aspect that differs from strain to strain is the number of repeated sequences and spacers that characterize them. The above-mentioned strain had the largest matrices, with a maximum of up to 49 repeated sequences and 53 spacers for the I-F system and 58 repeated sequences and 62 spacers for the I-E system. This provides us with knowledge about the information this microorganism is acquiring from the bacteriophages and plasmids.
The strains that exhibit the same sequence type can have different CRISPR matrices; for example, strains 1847 and 13755-1A associated with ST245 exhibited different types of CRISPR-Cas systems, whereas the opposite was observed in strains 12683-1 and 13755-1B, which had the same sequence type and the same CRISPR matrices. This is relevant because this system has been used as a typing method in different microorganisms. When analyzing 29 genomes of C. sakazakii ST1, Ogrodzki and Forsythe [81] found that all the strains exhibited the same type I-E system and three spacer matrices with conserved patterns. In addition, the use of CRISPR spacer matrix profiles compared with MLST show greater intra-species discrimination power; it is a useful tool to study future Cronobacter outbreaks by more accurately relating clinical cases, food sources, and production sites associated with and outbreak [82]. While it was initially believed that C. sakazakii had only one type of CRISPR system, Zeng et al. [83] indicated that 94.5% of the analyzed C. sakazakii strains showed more than one CRISPR and these were in conserved zones of its genome. Although each type of CRISPR-Cas system is characterized by certain associated cas genes, the cas1 and cas2 genes are indispensable for integrating and processing the information acquired by the bacterium. It has also been suggested that if any of these genes are not present, the system loses the ability to acquire information, and therefore can no longer integrate information into the CRISPR locus [84].

4. Conclusions

Cronobacter sakazakii was confirmed in six of the 1450 evaluated powdered milk samples (PM). The C. sakazakii isolates exhibited virulence factors, resistance genes to beta-lactam antibiotics, and a colistin (mrc 9.1) strain, which represent risk for infants consuming this product. Combined molecular methodologies based on WGS improve C. sakazakii identification and provide more reliable information for decision-making by health authorities to protect the infant population that consumes PM.

Author Contributions

Conceptualization, O.H. and J.P.-F.; methodology, O.H., J.P.-F., S.L., W.R., A.C.-C., J.M.-R and S.F.; software, S.L., J.P.-F., J.M.-R. and W.R.; validation, O.H., J.P.-F. and S.F.; formal analysis, O.H., J.P.-F. and S.F.; investigation, O.H., J.P.-F., A.C.-C., M.P.A.-L., S.L., W.R. and S.F.; resources, S.L., W.R., A.C.-C., M.P.A.-L., O.H., J.X.-C and J.P.-F.; data curation, S.L., O.H., J.M.-R. and J.P.-F.; writing—original draft preparation, O.H., J.P.-F., S.L., A.C.-C., M.P.A.-L., J.M.-R. and S.F.; supervision, S.L., W.R., O.H., J.X.-C., A.C.-C and J.P.-F.; project administration, O.H. and J.P.-F., S.L.; funding acquisition, O.H.; S.L., J.P.-F., W.R.; writing—review and editing, O.H., J.P.-F., S.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded the Research Directorate of the Universidad del Bío-Bío, Projects 191520 4/R and GI 195420/EF and, Research Support Foundation, Vaduz (991100531/39).

Acknowledgments

We thank the Institute of Medical Microbiology and Hygiene AGES-Austrian Agency for Health and Food Safety for their support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Iversen, C.; Lehner, A.; Mullane, N.; Bidlas, E.; Cleenwerck, I.; Marugg, J.; Fanning, S.; Stephan, R.; Joosten, H. The taxonomy of Enterobacter sakazakii: Proposal of a new genus Cronobacter gen. nov.and descriptions of Cronobacter sakazakii comb. nov. Cronobacter sakazakii subsp. sakazakii, comb. nov., Cronobacter sakazakii subsp. malonaticus subsp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov.and Cronobacter genomospecies 1. BMC Evol. Biol. 2007, 7, 64–74. [Google Scholar]
  2. Iversen, C.; Mullane, N.; Mc Cardell, B.; Tall, B.; Lehner, A.; Fanning, S.; Stephan, R.; Joosten, H. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov.comb. nov., C. malonaticus sp. nov., C. turicensis sp. nov., C. muytjensii sp. nov., C. dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, C. dublinensis sp. nov.subsp. dublinensis subsp. nov., C. dublinensis sp. nov.subsp. lausannensis subsp. nov., and C. dublinensis sp. nov.subsp. lactaridi subsp. nov. Int. J. Syst. Evol. Microbiol. 2008, 58, 1442–1447. [Google Scholar]
  3. Joseph, S.; Cetinkaya, E.; Drahovska, H.; Levican, A.; Figueras, M.; Forsythe, S. Cronobacter condimenti sp. Nov., isolated from spiced meat, and Cronobacter universalis sp. Nov., a species designation for Cronobacter sp. Geneomoespecies 1, recovered from a leg infection, water and food ingredients. Int. J. Syst. Evol. Microbiol. 2012, 62, 1277–1283. [Google Scholar] [CrossRef] [Scilit]
  4. Holý, O.; Petrželová, J.; Hanulík, V.; Chromá, M.; Matoušková, I.; Forsythe, S. Epidemiology of Cronobacter spp. isolates from patients admitted to the Olomouc University Hospital (Czech Republic). Epidemiol. Mikrobiol. Imunol. 2014, 63, 69–72. [Google Scholar] [PubMed]
  5. Holý, O.; Forsythe, S. Cronobacter spp. as emerging causes of healthcare-associated infection. J. Hosp. Infect. 2014, 86, 169–177. [Google Scholar] [CrossRef] [Scilit]
  6. Forsythe, S.J. Updates on the Cronobacter Genus. Annu. Rev. Food Sci. Technol. 2018, 25, 23–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Bowen, A.; Braden, C. Invasive Enterobacter sakazakii disease in infants. Emerg. Infect. Dis. 2006, 12, 1185–1189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Stoll, B.J.; Hansen, N.; Fanaroff, A.; Lemons, J.A. Enterobacter sakazakii is a rare cause of neonatal septicemia or meningitis in VLBW infants. J. Pediatr. 2004, 144, 821–823. [Google Scholar] [PubMed]
  9. Hunter, C.J.; Bean, J.F. Cronobacter: An emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis. J. Perinatol. 2013, 33, 581–585. [Google Scholar] [CrossRef] [Scilit]
  10. FAO; WHO. Enterobacter Sakazakii (Cronobacter spp) in Powdered Follow-Up Formulae; Microbiological Risk Assessment Series; WHO Press Publisher: Italy, Rome, 2008; Volume 15, pp. 1–105. [Google Scholar]
  11. Baumgartner, A.; Grand, M.; Liniger, M.; Iversen, C. Detection and frequency of Cronobacter spp. (Enterobacter sakazakii) in different categories of ready-to-eat foods other than infant formula. Int. J. Food Microbiol. 2009, 136, 189–192. [Google Scholar] [CrossRef] [Scilit]
  12. Kalyantanda, G.; Shumyak, L.; Archibald, L.K. Cronobacter species contamination of powdered infant formula and the implications for neonatal health. Front. Pediatr. 2015, 3, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Caubilla-Barron, J.; Forsythe, S. Dry stress and survival time of Enterobacter sakazakii and other Enterobacteriaceae in dehydrated powdered infant formula. J. Food Prot. 2007, 70, 2111–2117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Chap, J.; Jackson, P.; Siqueira, R.; Gaspar, N.; Quintas, C.; Park, J.; Osaili, T.; Shaker, R.; Jaradat, Z.; Hartantyo, S.; et al. International survey of Cronobacter sakazakii and other Cronobacter spp. in follow up formulas and infant foods. Int. J. Food Microbiol. 2009, 136, 185–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Siqueira, R.F.; da Silva, N.; Junqueira, V.; Kajsik, M.; Forsythe, S.; Pereira, J. Screening for Cronobacter species in powdered and reconstituted infant formulas and from equipment used in formula preparation in maternity hospitals. Ann. Nut. Met. 2013, 63, 62–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Parra, J.; Oliveras, L.; Rodriguez, A.; Riffo, F.; Jackson, E.; Forsythe, S. Riesgo por Cronobacter sakazakii en leches en polvo para la nutrición de lactantes. Rev. Chil. Nut. 2015, 42, 83–89. [Google Scholar] [CrossRef] [Scilit]
  17. Parra-Flores, J.; Maury-Sintjago, E.; Rodriguez-Fernández, A.; Acuña, S.; Cerda, F.; Aguirre, J.; Holý, O. Microbiological quality of powdered infant formula in Latin America. J. Food. Prot. 2020, 83, 534–541. [Google Scholar] [CrossRef] [Scilit]
  18. Molloy, C.; Cagney, C.; O’Brien, S.; Iversen, C.; Fanning, S.; Duffy, G. Surveillance and characterization by Pulsed-Field Gel Electrophoresis of Cronobacter spp in farming and domestic environments, food production animals and retails foods. Int. J. Food Microbiol. 2009, 136, 198–238. [Google Scholar] [CrossRef] [Scilit]
  19. Carvalho, G.; Calarga, A.; Teodoro, J.; Queiroz, M.; Astudillo-Trujillo, C.; Levy, C.; Brocchi, M.; Kabuki, D. Isolation, comparison of identification methods and antibiotic resistance of Cronobacter spp. in infant foods. Food Res. Int. 2020, 137, 109643. [Google Scholar] [CrossRef] [Scilit]
  20. Parra-Flores, J.; Aguirre, J.; Juneja, V.; Jackson, E.; Cruz, A.; Silva, J.; Forsythe, S. Virulence and Antibiotic Resistance Profiles of Cronobacter sakazakii and Enterobacter spp. Involved in the Diarrheic Hemorrhagic Outbreak in Mexico. Front. Microbiol. 2018, 9, 2206. [Google Scholar] [CrossRef] [Scilit]
  21. Fei, P.; Jiang, Y.; Yuan, X.; Yang, T.; Chen, J.; Wang, Z.; Kang, H.; Forsythe, S. Antibiotic and Desiccation Resistance of Cronobacter sakazakii and C. malonaticus Isolates from Powdered Infant Formula and Processing Environments. Front. Microbiol. 2017, 8, 316. [Google Scholar] [CrossRef] [Scilit]
  22. Cruz, A.; Xicohtencatl, J.; Gonzalez, B.; Bobadilla, M.; Eslava, C.; Rosas, I. Virulence traits in Cronobacter species isolated from different sources. Can. J. Microbiol. 2011, 7, 735–744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Holý, O.; Cruz-Cordova, A.; Xicohtencatl-Cortés, J.; Hochel, I.; Parra-Flores, J.; Petrzelova, J.; Facevicova, K.; Forsythe, S.; Alsonosi, A. Occurrence of virulence factors in Cronobacter sakazakii and Cronobacter malonaticus originated from clinical samples. Microb. Pathog. 2019, 127, 250–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Hamby, S.; Joseph, S.; Forsythe, S.; Chuzhanova, N. In Silico identification of pathogenic strains of Cronobacter from biochemical data reveals association of inositol fermentation with pathogenicity. BMC Microbiol. 2011, 11, 204–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Townsend, S.; Hurrell, E.; Forsythe, S. Virulence studies of Enterobacter sakazakii isolates associated with a neonatal intensive care unit outbreak. BMC Microbiol. 2008, 8, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Franco, A.; Kothary, M.; Gopinath, G.; Jarvis, K.; Grim, C.; Hu, L.; Datta, A.; McCardell, B.A.; Tall, B.D. Cpa, the outer membrane protease of Cronobacter sakazakii, activates plasminogen and mediates resistance to serum bactericidal activity. Infect. Immun. 2011, 79, 1578–1587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Cruz-Córdova, A.; Rocha-Ramírez, L.; Ochoa, S.; Gónzalez-Pedrajo, B.; Espinosa, N.; Eslava, C.; Hernández-Chiñas, U.; Mendoza-Hernández, G.; Rodríguez-Leviz, A.; Valencia-Mayoral, P.; et al. Flagella from five Cronobacter species induce pro-inflammatory cytokines in macrophage derivatives from human monocytes. PLoS ONE 2012, 7, e52091. [Google Scholar] [CrossRef] [Scilit]
  28. Kim, K.; Kim, K.; Choi, J.; Lim-Jeong, A.; Lee, J.; Hwang, S.; Ryu, S. Outer Membrane Proteins A (OmpA) and X (OmpX) Are Essential for Basolateral Invasion of Cronobacter sakazakii. Appl. Environ. Microbiol. 2010, 76, 5188–5198. [Google Scholar] [CrossRef] [Scilit]
  29. Ogrodzki, P.; Forsythe, S. Capsular profiling of the Cronobacter genus and the association of specific Cronobacter sakazakii and C. malonaticus capsule types with neonatal meningitis and necrotizing enterocolitis. BMC Genom. 2015, 16, 758. [Google Scholar] [CrossRef] [Scilit]
  30. Masood, N.; Moore, K.; Farbos, A.; Hariri, S.; Block, C.; Paszkiewicz, K.; Dickins, B.; McNally, A.; Forsythe, S. Draft Genome Sequence of a Meningitic Isolate of Cronobacter sakazakii Clonal Complex 4, Strain 8399. Genome Announc. 2013, 1, e00833-13. [Google Scholar] [CrossRef] [Scilit]
  31. Ogrodzki, P.; Forsythe, S.J. DNA-Sequence Based Typing of the Cronobacter Genus Using MLST, CRISPR-cas Array and Capsular Profiling. Front. Microbiol. 2017, 8, 1875. [Google Scholar] [CrossRef] [Scilit]
  32. Jolany vangah, S.; Katalani, C.; Boone, H.; Abbas Hajizade, A.; Ahmadian, G. CRISPR-Based Diagnosis of Infectious and Noninfectious Diseases. Biol. Proced. Online 2020, 22, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Baldwin, A.; Loughlin, M.; Caubilla-Barron, J.; Kucerova, E.; Manning, G.; Dowson, C.; Forsythe, S. Multilocus sequence typing of Cronobacter sakazakii and Cronobacter malonaticus reveals stable clonal structures with clinical significance, which do not correlate with biotypes. BMC Microbiol. 2009, 9, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Forsythe, S.J.; Dickins, B.; Jolley, K.A. Cronobacter, the emergent bacterial pathogen Enterobacter sakazakii comes of age; MLST and whole genome sequence analysis. BMC Genom. 2014, 15, 1121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Grad, Y.; Lipsitch, M. Epidemiologic data and pathogen genome sequences: A powerful synergy for public health. Genome Biol. 2014, 15, 538. [Google Scholar] [CrossRef] [Scilit]
  36. Iversen, C.; Forsythe, S.J. Isolation of Enterobacter sakazakii and other Enterobacteriaceae from powdered infant formula milk and related products. Food Microbiol. 2004, 21, 771–776. [Google Scholar] [CrossRef] [Scilit]
  37. Lepuschitz, S.; Sorschag, S.; Springer, B.; Allerberger, F.; Ruppitsch, W. Draft genome sequence of carbapenemase-producing Serratia marcescens isolated from a patient with chronic obstructive pulmonary disease. Genome Announc. 2017, 5, e01288-17. [Google Scholar] [CrossRef] [Scilit]
  38. Lepuschitz, S.; Ruppitsch, W.; Pekard-Amenitsch, S.; Forsythe, S.J.; Cormican, M.; Mach, R.L.; Piérard, D.; Allerberger, F.; the EUCRONI Study Group. Multicenter Study of Cronobacter sakazakii Infections in Humans, Europe, 2017. Emerg. Infect. Dis. 2019, 25, 515–522. [Google Scholar] [CrossRef] [Scilit]
  39. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.; Pham, S.; Prjibelski, A.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Scilit]
  40. Ruppitsch, W.; Pietzka, A.; Prior, K.; Bletz, S.; Fernandez, H.L.; Allerberger, F.; Harmsen, D.; Mellmann, A. Defining and evaluating a core genome MLST scheme for whole genome sequence-based typing of Listeria monocytogenes. J. Clin. Microbiol. 2015, 53, 2869–2876. [Google Scholar] [CrossRef] [Scilit]
  41. Jia, B.; Raphenya, A.R.; Alcock, B.; Waglechner, N.; Guo, P.; Tsang, K.; Lago, B.; Dave, B.; Pereira, S.; Sharma, A.; et al. CARD 2017: Expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2017, 45, D566–D573. [Google Scholar] [CrossRef] [Scilit]
  42. Carattoli, A.; Zankari, E.; García-Fernández, A.; Voldby-Larsen, M.; Lund, O.; Villa, L.; Møller-Aarestrup, F.; Hasman, H. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob. Agents Chemother. 2014, 58, 3895–3903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Couvin, D.; Bernheim, A.; Toffano-Nioche, C.; Touchon, M.; Michalik, J.; Néron, B.; Rocha, E.; Vergnaud, G.; Gautheret, D.; Pourcel, C. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018, 46, 246–251. [Google Scholar] [CrossRef] [Scilit]
  44. Ge, R.; Mai, G.; Wang, P.; Zhou, M.; Luo, Y.; Cai, Y.; Zhou, F. CRISPRdigger: Detecting CRISPRs with better direct repeat annotations. Sci. Rep. 2016, 6, 32942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Joseph, S.; Forsythe, S. Insights into the emergent bacterial pathogen Cronobacter spp., generated by multilocus sequence typing and analysis. Front. Food Microbiol. 2012, 3, 397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Dugan, K. Advances in Understanding Bacterial Pathogenesis Gained from Whole-Genome Sequencing and Phylogenetics. Cell Host Microbe 2016, 19, 599–610. [Google Scholar]
  47. Hunter, C.J.; Singamsetty, V.K.; Chokshi, N.K.; Boyle, P.; Camerini, V.; Grishin, A.V.; Upperman, J.S.; Ford, H.R.; Prasadarao, N.V. Enterobacter sakazakii enhances epithelial cell injury by inducing apoptosis in a rat model of necrotizing enterocolitis. J Infect. Dis. 2008, 198, 586–593. [Google Scholar] [CrossRef] [Scilit]
  48. Mange, J.P.; Stephan, R.; Borel, L.; Wild, P.; Kim, K.S.; Pospischil, A.; Lenher, A. Adhesive properties of Enterobacter sakazakii to human epithelial and brain microvascular endothelial cells. BMC Microbiol. 2006, 6, 58–68. [Google Scholar] [CrossRef] [Scilit]
  49. Townsend, S.; Hurrell, E.; Gonzalez-Gomez, I.; Lowe, J.; Frye, J.; Forsythe, S.; Badger, J. Enterobacter sakazakii invades brain capillary endothelial cells, persists in human macrophages influencing cytokine secretion and induces severe brain pathology in the neonatal rat. Microbiology 2007, 153, 3538–3547. [Google Scholar] [CrossRef] [Scilit]
  50. Ye, Y.; Li, H.; Ling, N.; Han, Y.; Wu, Q.; Xu, X.; Jiao, R.; Gao, J. Identification of potential virulence factors of Cronobacter sakazakii isolates by comparative proteomic analysis. Int. J. Food Microbiol. 2016, 217, 182–188. [Google Scholar] [CrossRef] [Scilit]
  51. Quintero-Villegas, M.; Wittke, A.; Hutkins, R. Adherence Inhibition of Cronobacter sakazakii to Intestinal Epithelial Cells by Lactoferrin. Curr. Microbiol. 2014, 69, 574–579. [Google Scholar] [CrossRef] [Scilit]
  52. Alsonosi, A.; Holý, O.; Forsythe, S. Characterization of the pathogenicity of clinical Cronobacter malonaticus strains based on the tissue culture investigations. Antonie Leeuwenhoek. 2019, 112, 435–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Wu, H.; Andrew, H.-J.; Wang, A.; Jennings, M. Discovery of virulence factors of pathogenic bacteria. Curr. Opin. Chem. Biol. 2008, 12, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Papadopoulos, D.; Schneider, D.; Meier-Eiss, J.; Arber, W.; Lenski, R.; Blot, M. Genomic evolution during a 10,000-generation experiment with bacteria. Proc. Natl. Acad. Sci. USA 1999, 96, 3807–3812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Nair, M.K.M.; Venkitanarayanan, K. Role of bacterial OmpA and host citoskeleton in the invasion of human intestinal epithelial cells by Enterobacter sakazakii. Pediatr. Res. 2007, 62, 664–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Jang, H.; Chase, H.R.; Gangiredla, J.; Grim, C.J.; Patel, I.R.; Kothary, M.H.; Jackson, S.; Mammel, M.K.; Carter, L.; Negrete, F.; et al. Analysis of the molecular diversity among Cronobacter species isolated from filth flies using targeted PCR, pan genomic DNA microarray, and whole genome sequencing analyses. Front. Microbiol. 2020, 11, 561204. [Google Scholar] [CrossRef] [Scilit]
  57. Baida, G.E.; Kuzmin, N.P. Mechanism of action of hemolysin III from Bacillus cereus. Biochim. Biophys. Acta 1996, 1284, 22–124. [Google Scholar] [CrossRef] [Scilit]
  58. Chen, Y.C.; Chang, M.C.; Chuang, Y.C.; Jeang, C.L. Characterization and virulence of hemolysin III from Vibrio vulnificus. Curr. Microbiol. 2004, 49, 175–179. [Google Scholar] [CrossRef] [Scilit]
  59. Himelright, I.; Harris, E.; Lorch, V.; Anderson, M. Enterobacter sakazakii infections associated with the use of powdered infant formula—Tennessee, 2001. J. Am. Med. Assoc. 2002, 287, 2204–2205. [Google Scholar]
  60. Abreu, A.; Bueris, V.; Porangaba, T.; Sircili, M.; Navarro-Garcia, F.; Elias, W. Autotransporter Protein-Encoding Genes of Diarrheagenic Escherichia coli Are Found in both Typical and Atypical Enteropathogenic E. coli Strains. Appl. Environ. Microbiol. 2013, 79, 411–414. [Google Scholar] [CrossRef] [Scilit]
  61. Proudy, I.; Bouglé, D.; Coton, E.; Coton, M.; Leclercq, R.; Vergnaud, M. Genotypic characterization of Enterobacter sakazakii isolates by PFGE, BOX-PCR and sequencing of the fliC gene. J. Appl. Microbiol. 2008, 104, 26–34. [Google Scholar] [CrossRef] [Scilit]
  62. Hoeflinger, J.L.; Miller, M.J. Cronobacter sakazakii ATCC 29544 Autoaggregation requires FliC flagellation, not motility. Front. Microbiol. 2017, 8, 301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Aldubyan, M.; Almami, I.; Benslimane, F.; Alsonosi, A.; Forsythe, S. Comparative Outer Membrane Protein Analysis of High and Low-Invasive Strains of Cronobacter malonaticus. Front. Microbiol. 2017, 8, 2268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Dingle, T.; Mulvey, G.; Armstrong, G. Mutagenic analysis of the Clostridium difficile flagellar proteins, FliC and FliD, and their contribution to virulence in hamsters. Infect. Immun. 2011, 79, 4061–4067. [Google Scholar] [CrossRef] [Scilit]
  65. Ye, Y.; Zhang, X.; Zhang, M.; Ling, N.; Zeng, H.; Gao, J.; Jiao, R.; Wu, Q.; Zhang, J. Potential factors involved in virulence of Cronobacter sakazakii isolates by comparative transcriptome analysis. J. Dairy Sci. 2017, 100, 8826–8837. [Google Scholar] [CrossRef] [Scilit]
  66. Kim, K.; Jang, S.; Kim, S.; Park, J.; Heu, S.; Ryu, S. Prevalence and genetic diversity of Enterobacter sakazakii in ingredients of infant foods. Int. J. Food Microbiol. 2008, 122, 196–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Chon, J.; Song, K.; Kim, S.; Hyeon, J.; Seo, K. Isolation and characterization of Cronobacter from desiccated foods in Korea. J. Food Sci. 2012, 77, 354–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Parra-Flores, J.; Arvizu, S.; Silva, J.; Fernández, E. Two cases of hemorrhagic diarrhea caused by Cronobacter sakazakii in hospitalized nursing infants associated with the consumption of powdered infant formula. J. Food Prot. 2011, 74, 2177–2181. [Google Scholar] [CrossRef] [Scilit]
  69. Aly, M.A.; Domig, K.J.; Kneifel, W.; Reimhult, E. Whole Genome Sequencing-Based Comparison of Food Isolates of Cronobacter sakazakii. Front. Microbiol. 2019, 10, 1464. [Google Scholar] [CrossRef] [Scilit]
  70. Touze, T.; Eswaran, J.; Bokma, E.; Koronakis, E.; Hughes, C.; Koronakis, V. Interactions underlying assembly of the Escherichia coli AcrAB-TolC multidrug efflux system. Mol. Microbiol. 2004, 53, 697–706. [Google Scholar] [CrossRef] [Scilit]
  71. Kucerova, E.; Clifton, S.W.; Xia, X.Q.; Long, F.; Porwollik, S.; Fulton, L.; Feng, D.; Wollam, A.; Shah, N.; Bhonogiri, V.; et al. Genome sequence of Cronobacter sakazakii BAA-894 and comparative genomic hybridization analysis with other Cronobacter species. PLoS ONE 2010, 5, e9556. [Google Scholar] [CrossRef] [Scilit]
  72. El-Sharoud, W.; O’Brien, S.; Negredo, C.; Iversen, C.; Fanning, S.; Healy, B. Characterization of Cronobacter recovered from dried milk and related products. BMC Microbiol. 2009, 9, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Carroll, L.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.; Wiedmann, M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio 2019, 10, e00853-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Kieffer, N.; Royer, G.; Decousser, J.-W.; Bourrel, A.-S.; Palmieri, M.; Ortiz De La Rosa, J.-M.; Jacquier, H.; Denamur, E.; Nordmann, P.; Poirel, L. mcr-9, an Inducible Gene Encoding an Acquired Phosphoethanolamine Transferase in Escherichia coli, and Its Origin. Antimicrob. Agents Chemother. 2019, 63, e00965-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Yuan, Y.; Li, Y.; Wang, G.; Li, C.; Xiang, L.; She, J.; Yang, Y.; Zhong, F.; Zhang, L. Coproduction of MCR-9 and NDM-1 By Colistin-Resistant Enterobacter hormaechei Isolated from Bloodstream Infection. Infect. Drug Resist. 2019, 12, 2979–2985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Cheng, Y.; Chen, Y.; Liu, Y.; Guo, Y.; Zhou, Y.; Xiao, T.; Zhang, S.; Xu, H.; Chen, Y.; Shan, T.; et al. Identification of novel tetracycline resistance gene tet(X14) and its co-occurrence with tet(X2) in a tigecycline-resistant and colistin-resistant Empedobacter stercoris. Emerg. Microbes Infect. 2020, 9, 1843–1852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Müller, A.; Hächler, H.; Stephan, R.; Lehner, A. Presence of AmpC beta-lactamases, CSA-1, CSA-2, CMA-1, and CMA-2 conferring an unusual resistance phenotype in Cronobacter sakazakii and Cronobacter malonaticus. Microb. Drug Resist. 2014, 20, 275–280. [Google Scholar] [CrossRef] [Scilit]
  78. Zhou, K.; Zhou, Y.; Zhang, C.; Song, J.; Cao, X.; Yu, X.; Shen, P.; Xiao, Y. Dissemination of a ‘rare’ extended-spectrum β-lactamase gene blaSFO-1 mediated by epidemic clones of carbapenemase-producing Enterobacter hormaechei in China. Int. J. Antimicrob. Agents 2020, 56, 106079. [Google Scholar] [CrossRef] [Scilit]
  79. Eshwar, A.K.; Tall, B.D.; Gangiredla, J.; Gopinath, G.R.; Patel, I.R.; Neuhauss, S.; Stephan, R.; Lehner, A. Linking Genomo- and Pathotype: Exploiting the Zebrafish Embryo Model to Investigate the Divergent Virulence Potential among Cronobacter spp. PLoS ONE 2016, 11, e0158428. [Google Scholar] [CrossRef] [Scilit]
  80. Makarova, K.S.; Koonin, E.V. Annotation and Classification of CRISPR-Cas Systems. Methods Mol. Biol. 2015, 1311, 47–75. [Google Scholar]
  81. Ogrodzki, P.; Forsythe, J. CRISPR–cas loci profiling of Cronobacter sakazakii pathovars. Future Microbiol. 2016, 11, 1507–1519. [Google Scholar] [CrossRef] [Scilit]
  82. Zeng, H.; Li, C.; He, W.; Zhang, J.; Chen, M.; Lei, T.; Wu, H.; Ling, N.; Cai, S.; Wang, J.; et al. Cronobacter sakazakii, Cronobacter malonaticus, and Cronobacter dublinensis Genotyping Based on CRISPR Locus Diversity. Front. Microbiol. 2019, 10, 1989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Zeng, H.; Zhang, J.; Li, C.; Xie, T.; Ling, N.; Wu, Q.; Ye, Y. The driving force of prophages and CRISPR-Cas system in the evolution of Cronobacter sakazakii. Sci. Rep. 2017, 7, 40206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Zeng, H.; Zhang, J.; Wu, Q.; He, W.; Wu, H.; Ye, Y.; Li, C.; Ling, N.; Chen, M.; Wang, J.; et al. Reconstituting the History of Cronobacter Evolution Driven by Differentiated CRISPR Activity. Appl. Environ. Microbiol. 2018, 84, e00267-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Minimum spanning tree (MST) of six Cronobacter sakazakii strains isolated from powdered milk (PM). The MST calculation was based on the defined cgMLST scheme comprising 2831 target genes. Isolates are represented as colored circles according to classical multilocus sequence typing (MLST). Blue numbers accord to the allelic difference between isolates. The isolates with closely related genotypes are marked as a cluster.
Figure 1. Minimum spanning tree (MST) of six Cronobacter sakazakii strains isolated from powdered milk (PM). The MST calculation was based on the defined cgMLST scheme comprising 2831 target genes. Isolates are represented as colored circles according to classical multilocus sequence typing (MLST). Blue numbers accord to the allelic difference between isolates. The isolates with closely related genotypes are marked as a cluster.
Foods 10 00020 g001
Figure 2. Bacterial adherence (A) and invasion frequency (B) of Cronobacter sakazakii on the neuroblastoma (NT) cell line.
Figure 2. Bacterial adherence (A) and invasion frequency (B) of Cronobacter sakazakii on the neuroblastoma (NT) cell line.
Foods 10 00020 g002
Table 1. Cronobacter sakazakii strains isolated from powdered milk.
Table 1. Cronobacter sakazakii strains isolated from powdered milk.
StrainNGS IDIdentificationSTSourceCountryYear of IsolationManufacturer
* 1847510284-18C. sakazakii245Powdered milk Czech Republic2010A
13755-1A510192-19C. sakazakii245Powdered milkCzech Republic2014B
13755-1B510193-19C. sakazakii1Powdered milkCzech Republic2014B
12683-1510285-19C. sakazakii1Powdered milkCzech Republic2014B
12683-2A510194-19C. sakazakii297Powdered milkCzech Republic2014B
6227510555-19C. sakazakii145Powdered milkCzech Republic2014C
* ID 1482: PubMLST/Cronobacter. NGS ID: Next Generation Sequencing Identification; ST: sequence type.
Table 2. Presence of virulence factors by polymerase chain reaction (PCR).
Table 2. Presence of virulence factors by polymerase chain reaction (PCR).
C. sakazakii Strain (ST) Gene
hlyAompAautfliCinvcpa
13755-1B (1)+++
1847 (245)++++
823 (ATCC BAA-894) (1) control strain++++++
The presence of a gene is represented by “+” and the absence of a gene is represented by “−”.
Table 3. Virulence gene distribution among six strains of Cronobacter sakazakii by whole-genome sequencing (WGS).
Table 3. Virulence gene distribution among six strains of Cronobacter sakazakii by whole-genome sequencing (WGS).
Virulence GeneFunction1847
(ST245)
13755-1A (ST245)13755-1B
(ST1)
12683-1 (ST1)12683-2A (ST 297)6227
(ST145)
flgBmotility++++++
flgKflagellar hook-associated protein 1++++++
flgLflagellar hook-associated protein 3++++++
flgMnegative regulator of flagellin synthesis++++++
flgNflagella synthesis FlgN protein ++++++
flhDflagellar hook-associated protein 2++++++
fliAflagellar operon FliA++++++
fliCflagellin++++++
fliDflagellar hook-associated protein 2++++++
fliRflagellar biosynthetic FliR protein ++++++
fliTflagella FliT protein ++++++
fliZFliZ protein++++++
lolAouter membrane lipoprotein carrier protein++++++
motBchemotaxis MotA protein +++++
ompWtransmembrane transport++++++
sdiALuxR family transcriptional regulator++++++
slyBouter membrane lipoprotein SlyB+++++
tolCouter membrane channel protein++++++
MsgAsurvival in macrophage++++++
MviNprotective immunity and colonization in Salmonella ++++++
cpaplasminogen activator++++
hhahemolysin expression modulating protein++++++
hly IIIhemolysin III++++++
ompAadhesion cell; cell death induction; biofilm formation++++++
ompXadhesion cell++++++
blcouter membrane lipoprotein ++++++
cheRchemotaxis protein methyltransferase +++++
cheYresponse regulator of chemotaxis family ++++++
labpepithelial cell invasion and lipid A production by LpxA++
ST: Sequence type. The presence of a gene is represented by “+” and the absence of a gene is represented by “−”.
Table 4. Antibiotic-resistant genes identified by Comprehensive Antibiotic Resistance Database (CARD).
Table 4. Antibiotic-resistant genes identified by Comprehensive Antibiotic Resistance Database (CARD).
Best Hit Antibiotic Resistance Ontology (ARO)Drug ClassResistance Mechanism1847 (ST245)13755-1A (ST245)13755-1B (ST1)12683-1 (ST1)12683-2A (ST297)6227 (ST145)
CRPfluoroquinolone antibiotic; macrolide antibiotic; penamantibiotic efflux++++++
marRmonobactam; triclosan; rifamycin antibiotic; penem; cephamycin; fluoroquinolone antibiotic; penam; phenicol antibiotic; glycylcycline; tetracycline antibiotic; cephalosporin; carbapenemantibiotic efflux; reduced antibiotic permeability ++++++
H-NSfluoroquinolone antibiotic; macrolide antibiotic; penam; tetracycline antibiotic; cephalosporin; cephamycinantibiotic efflux++++++
EF-Tuelfamycin antibioticantibiotic target alteration++++++
marAfluoroquinolone antibiotic; triclosan; rifamycin antibiotic; penam; phenicol antibiotic; glycylcycline; tetracycline antibiotic; cephalosporinantibiotic target alteration; antibiotic efflux++++++
mrBfluoroquinolone antibioticantibiotic efflux++++++
emrRfluoroquinolone antibioticantibiotic efflux++++++
adeFtetracycline antibiotic; fluoroquinolone antibioticantibiotic efflux++++++
msbAnitroimidazole antibioticantibiotic efflux++++++
vgaCstreptogramin antibiotic; pleuromutilin antibioticantibiotic target protection+++
GlpTfosfomycinantibiotic target alteration++++++
PBP3penam; cephalosporin; cephamycin; monobactam; carbapenemantibiotic target alteration++++++
The presence of a gene is represented by “+” and the absence of a gene is represented by “−”.
Table 5. Presence of plasmids in Cronobacter sakazakii strains by whole genome sequencing (WGS).
Table 5. Presence of plasmids in Cronobacter sakazakii strains by whole genome sequencing (WGS).
Strains (ST)PlasmidsAccession NumberFunction
1847 (1); 13755-1A (245)IncFII(pECLA)CP001919Antibiotic resistance
12683-2A (297)IncFIB(pCTU3)FN543096
Table 6. Profiling of CRISPR-Cas loci among Cronobacter sakazakii strains.
Table 6. Profiling of CRISPR-Cas loci among Cronobacter sakazakii strains.
StrainsSequence
Type (ST)
Operon Structure TypeNumber of CRISPR
Arrays per Strain
Maximum Number of Spacers per StrainSequences with Cas ClusterRepeat Consensus/cas Genes
1847245Type I-E Cas29/732/91GTTCACTGCCGTACAGGCAGCTTAGAAA/CTGTTCCCCGCGCGAGCGGGGATAAACCG/
Cas3_0_I, Cse1_0_IE, Cse2_0_IE, Cas7_0_IE, Cas5_0_IE, Cas6_0_IE, Cas1_0_IE, Cas2_0_IE.
13755-1A245Type I-F Cas
Type I-E Cas
10
18
9
17
1
1
GTTCACTGCCGTACAGGCAGCTTAGAAA/
Cas1_0_IF, Cas3-Cas2_0_IF, Cas6_0_IF, Csy1_0_IF, Csy2_0_IF, Csy3_0_IF.
CGGTTTATCCCCGCTCGCGCGGGGAACAC/
Cas3_0_I, Cse1_0_IE, Cse2_0_IE, Cas7_0_IE, Cas5_0_IE, Cas6_0_IE, Cas1_0_IE, Cas2_0_IE.
13755-1B1Type I-E Cas
Type I-F Cas
22/30
14
24/32
16
1
1
CTGTTCCCCGCGCGAGCGGGGATAAACCG/GTGTTCCCCGCGCGAGCGGGGATAAACCG/
Cas3_0_I, Cse1_0_IE, Cse2_0_IE, Cas7_0_IE, Cas5_0_IE, Cas6_0_IE, Cas1_0_IE, Cas2_0_IE.
GTTCACTGCCGTACAGGCAGCTTAGAAA/
Cas1_0_IF, Cas3-Cas2_0_IF, Cas6_0_IF, Csy1_0_IF, Csy2_0_IF, Csy3_0_IF.
12683-2A297Type I-F Cas
Type I-E Cas
49
20/58
53
22/62
1
1
TTTCTAAGCTGCCTGTACGGCAGTGAAC/
Cas1_0_IF, Cas3-Cas2_0_IF, Cas6_0_IF, Csy1_0_IF, Csy2_0_IF, Csy3_0_IF.
CTGTTCCCCGCGCGAGCGGGGATAAACCG/GTGTTCCCCGCGCGAGCGGGGATAAACCG/
Cas3_0_I, Cse1_0_IE, Cse2_0_IE, Cas7_0_IE, Cas5_0_IE, Cas6_0_IE, Cas1_0_IE, Cas2_0_IE.
12683-11Type I-E Cas
Type I-F Cas
28/31
14
29/32
15
1
1
CTGTTCCCCGCGCGAGCGGGGATAAACCG/GTGTTCCCCGCGCGAGCGGGGATAAACCG/ Cas3_0_I, Cse1_0_IE, Cse2_0_IE, Cas7_0_IE, Cas5_0_IE, Cas6_0_IE, Cas1_0_IE, Cas2_0_IE.
GTTCACTGCCGTACAGGCAGCTTAGAAA/
Cas1_0_IF, Cas3-Cas2_0_IF, Cas6_0_IF, Csy1_0_IF, Csy2_0_IF, Csy3_0_IF.
6227145Type I-E Cas15/1316/121CGGTTTATCCCCGCTCGCGCGGGGAACGG/GTGTTCCCCGCGCGAGCGGGGATAAACCG// Cas1_0_IE, Cas2_0_IE, Cas5_0_IE, Cas6_0_IE, Cas7_0_IE, Cse1_0_IE, Cse2_0_IE.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Holý, O.; Parra-Flores, J.; Lepuschitz, S.; Alarcón-Lavín, M.P.; Cruz-Córdova, A.; Xicohtencatl-Cortes, J.; Mancilla-Rojano, J.; Ruppitsch, W.; Forsythe, S. Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Milk. Foods 2021, 10, 20. https://doi.org/10.3390/foods10010020

AMA Style

Holý O, Parra-Flores J, Lepuschitz S, Alarcón-Lavín MP, Cruz-Córdova A, Xicohtencatl-Cortes J, Mancilla-Rojano J, Ruppitsch W, Forsythe S. Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Milk. Foods. 2021; 10(1):20. https://doi.org/10.3390/foods10010020

Chicago/Turabian Style

Holý, Ondrej, Julio Parra-Flores, Sarah Lepuschitz, María Paula Alarcón-Lavín, Ariadnna Cruz-Córdova, Juan Xicohtencatl-Cortes, Jetsi Mancilla-Rojano, Werner Ruppitsch, and Stephen Forsythe. 2021. "Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Milk" Foods 10, no. 1: 20. https://doi.org/10.3390/foods10010020

APA Style

Holý, O., Parra-Flores, J., Lepuschitz, S., Alarcón-Lavín, M. P., Cruz-Córdova, A., Xicohtencatl-Cortes, J., Mancilla-Rojano, J., Ruppitsch, W., & Forsythe, S. (2021). Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Milk. Foods, 10(1), 20. https://doi.org/10.3390/foods10010020

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop