The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci
Abstract
1. Introduction
2. Materials and Methods
2.1. Enterococcus faecalis Strain Isolation and Identification
2.2. Hemolysis and Enzyme Analysis Using API ZYM Test
2.3. Virulence Factor Gene Analysis
2.4. Biofilm-Forming Ability and Biofilm Gene Testing
2.5. Relation of Enterococcus faecalis Strains to Antibiotics
2.6. Treatment of Enterococcus faecalis Strains with Postbiotic Active Substances MK1/3 and MK2/8
3. Results
3.1. Species Strain Characterization
3.2. Hemolysis and Enzyme Analysis Using the API ZYM Test and Virulence Factor Gene Analysis
3.3. Biofilm-Forming Assay and Biofilm Gene Detection
3.4. Relation of Enterococcus faecalis Strains to Antibiotics and Susceptibility to Postbiotic Substances Produced by the Strains Lactococcus lactis MK2/8 and MK1/3
4. Discussion
4.1. Virulence Factor Genes
4.2. Antibiotic Resistance and Enzymes
4.3. Postbiotic Substances Against Contaminant Bacteria
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kourkouta, L.; Frantzana, A.; Koukorikos, K.; Illiadis, C.; Papathanasiou, V.I.; Tsaloglidou, A. Milk nutritional composition and its role in human health. J. Pharm. Pharmacol. 2021, 9, 10–15. [Google Scholar] [CrossRef] [Scilit]
- Adzitey, F.; Awini Tibile, B.; Addy, F.; Adu-Bonsu, G.; Senaru Atsu Amalogh, A.; Noyoro, E.J.; Tsigbey, V.E. Occurrence, antimicrobial susceptibility and genomic characterization of Salmonella Enterica isolated from milk and related sources. Cogent Food Agric. 2025, 11, 2486330. [Google Scholar] [CrossRef] [Scilit]
- Pereira, P.C. Milk nutritional composition and its role in human health. Nutrition 2014, 30, 619–627. [Google Scholar] [CrossRef] [Scilit]
- Uhrín, V.; Lauková, A.; Jančová, A.; Plintovič, V. Mlieko a mliečna žľaza (in Slovak) Milk and Mammary Gland; Publ. No. 92; Faculty of Natural Sciences of the University Constantinus Philosophus: Nitra, Slovakia, 2002; pp. 5–167. ISBN 80-8050-511-X. [Google Scholar]
- Lauková, A.; Focková, V.; Pogány Simonová, M. Enterococcal species associated with Slovak raw goat milk, their safety and susceptibility to lantibiotics and durancin ED26E/7. Processes 2021, 9, 681. [Google Scholar] [CrossRef] [Scilit]
- Worku, T.; Negera, E.; Nurfeta, A.; Walearegay, H. Microbiological quality and safety of raw milk collected from Borana pastoral community, Oromio regional state. Afr. J. Food Sci. Technol. 2012, 3, 213–222. [Google Scholar]
- Hanzelová, Z.; Dudríková, E.; Lovayová, V.; Výrostková, J.; Regecová, I.; Zigo, F.; Bartáková, K. Occurrence of enterococci in the process of artinasal cheesemaking and their antimicrobial resistance. Life 2024, 14, 890. [Google Scholar] [CrossRef] [Scilit]
- Bondi, M.; Lauková, A.; de Niederhausern, S.; Messi, P.; Papadopoulou, C.; Economou, V. Controversial aspects displayed by enterococci: Probiotics or pathogens? Biomed. Res. Int. 2020, 20, e9816185. [Google Scholar] [CrossRef] [Scilit]
- Švec, P.; Franz, C.M.A.P. The genus Enterococcus. In Lactic Acid Bacteria: Biodiversity and Taxonomy; Holzapfel, W.H., Wood, B.J.B., Eds.; Wiley Blackwell: Hoboken, NJ, USA, 2014; pp. 171–213. [Google Scholar]
- Alonso, V.P.P.; Quieroz, M.M.; Gualberto, M.L.; Nascimento, M.S. Klebsiella pneumonia carbapenemase (KPC), methicillin-resistant Staphylococcus aureus (MRSA), and vancomycin-resistant Enterococcus spp. (VRE) in the food production chain and biofilm formation on abiotic surfaces. Curr. Opin. Food Sci. 2019, 26, 79–86. [Google Scholar] [CrossRef] [Scilit]
- Zaheer, R.; Cook, S.R.; Barbieri, R.; Goji, N.; Cameron, A.; Petkau, A.; Polo, R.O.; Tymensen, L.; Stamm, C.; Song, J.; et al. Surveillance of Enterococcus spp. reveals distinct species and antimicrobial resistance diversity across a One-health continuu. Sci. Rep. 2020, 10, 3937. [Google Scholar]
- Popovic, N.; Dinic, M.; Tolinacki, M.; Mihajlovic, S.; Terzic-Vidojevic, A.; Bojic, S.; Djokic, J.; Golic, N.; Veljovic, K. New insight into biofilm formation ability, the presence of virulence genes and probiotic potential of Enterococcus spp. dairy isolates. Front. Microbiol. 2018, 9, 78. [Google Scholar] [CrossRef] [Scilit]
- Silvetti, T.; Morandi, S.; Brasca, M. Does Enterococcus faecalis from traditional raw milk cheeses serve as a reservoir of antibiotic resistance and pathogenic traits? Foodbor. Pathog. Dis. 2019, 16, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Nasiri, M.; Hhanifian, S. Enterococcus faecalis and Enterococcus faecium in pasteurized milk: Prevalence, genotyping, and characterization of virulence traits. LWT-Food Sci. Technol. 2022, 153, 112452. [Google Scholar] [CrossRef] [Scilit]
- Haubert, L.; da Cunha, C.E.P.; Lopes, G.V.; da Silva, W.P. Food isolate Listeria monocytogenes harboring tet M gene plasmid mediated exchangeable to Enterococcus faecalis on the surface of processed cheese. Food Res. Int. 2018, 107, 503–508. [Google Scholar] [CrossRef] [Scilit]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swan, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroent. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [Scilit]
- Chikindas, M.L.; Sichel, L.S.; Popov, I.V.; Tagg, J.R.; Lu, X.; Mitrokhin, O.V.; Todorov, S.D. Postbiotics:what are they? Ben. Microbes 2025, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Amobonye, A.; Pillaz, B.; Hlope, F.; Tofac Asong, S.; Pillai, S. Postbiotics: An insighfutful review of the latest category in functional biotics. World J. Microbiol. Biotechnol. 2025, 41, 293. [Google Scholar] [CrossRef] [Scilit]
- Lauková, A.; Tomáška, M.; Drončovský, M.; Mucha, R.; Dvorožňáková, E.; Kološta, M.; Pogány Simonová, M. The application potential of the raw goat milk-derived strain Lactococcus lactis MK1/3 for the dairy industry. Appl. Sci. 2025, 15, 6781. [Google Scholar] [CrossRef] [Scilit]
- Lauková, A.; Maďar, M.; Zábolyová, N.; Troscianczyk, A.; Pogány Simonová, M. Fortification of goat milk yogurts with encapsulated postbiotic active lactococci. Life 2025, 14, 1147. [Google Scholar] [CrossRef] [Scilit]
- Kačírová, J.; Horňáková, Ľ.; Maďari, A.; Mravcová, K.; Maďar, M. Cultivable oral microbiota in puppies. Folia Vet. 2021, 65, 69–74. [Google Scholar] [CrossRef] [Scilit]
- Lane, D.J. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematic; Stackebrandt, E., Goodfellow, M., Eds.; Wiley: Hoboken, NJ, USA, 1991; pp. 371–375. [Google Scholar]
- Semedo-Lemsaddek, T.; Nobrega, C.S.; Ribeiro, T.; Pedroso, N.M.; Sales-Luis, T.; Lemsaddek, A.; Tenreiro, R.; Tavares, L.; Vilela, C.L.; Oliveira, M. Virulence traits and antibiotic resistance among enterococci isolated from Eurasian otter (Lutra lutra). Vet. Microbiol. 2013, 163, 378–382. [Google Scholar] [CrossRef] [Scilit]
- Kubašová, I.; Strompfová, V.; Lauková, A. Safety assessment of commensal enterococci from dogs. Folia Microbiol. 2017, 20, 491–498. [Google Scholar] [CrossRef] [Scilit]
- Focková, V.; Styková, E.; Pogány Simonová, M.; Vargová, M.; Dvorožňáková, E.; Lauková, A. Safety assessment of fecal, bacteriocin-producing strains Enterococcus mundtii from horses. Austin J. Vet. Sci. Anim. Husb. 2022, 9, 1097. [Google Scholar]
- Chaieb, K.; Chehab, O.; Ymantar, T.; Rouabhia, M.; Mahdouani, K.; Bakhrouf, A. In vitro effect of pH and ethanol on biofilm formation by clinical ica-positive Staphylococcus epidermidis strains. Ann. Microbiol. 2007, 57, 431–437. [Google Scholar] [CrossRef] [Scilit]
- Lebreton, F.; Riboulet-Bisson, E.; Serror, P.; Sanguinetti, M.; Posteraro, B.; Torelli, R.; Hartke, A.; Auffray, Y.; Giard, J.-C. Ace, which encodes an adhesin in Enterococcus faecalis, is regulated by ers and is involved in virulence. Infect. Immun. 2009, 77, 2832–2839. [Google Scholar] [CrossRef] [Scilit]
- Hufnagel, M.; Koch, S.; Creti, R.; Baldassarri, L.; Huebner, J. A putative Sugar -binding transcriptional regulator in a novel gene locus in Enterococcus faecalis contributes to production of biofilm and prolonged bacteremia in mice. J. Infect. Dis. 2004, 189, 420–430. [Google Scholar] [CrossRef] [Scilit]
- Guiton, P.S.; Hannan, T.J.; Ford, B.; Caparon, M.G.; Hultgren, S.J. Enterococcus faecalis overcomes foreign body-mediated inflammation to establish urinary tract infection. Infect. Immun. 2013, 81, 329–339. [Google Scholar] [CrossRef] [Scilit]
- Hancock, L.E.; Perego, M. The Enterococcus faecalis fsr two component system controls biofilm-development through production of gelatinase. J. Bacterial. 2004, 186, 5629–5639. [Google Scholar] [CrossRef] [Scilit]
- Cucarella, C.; Solano, C.; Valle, J.; Amorena, B.; Lasa, I.; Penadés, J.R. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J. Bacteriol. 2001, 183, 2888–2896. [Google Scholar] [CrossRef] [Scilit]
- Hashem, Y.A.; Amin, H.M.; Essam, T.M.; Yassin, A.S.; Aziz, R.K. Biofilm formation in enterococci:genotype-phenotype correlations and inhibition by vancomycin. Sci. Rep. 2017, 7, 5733. [Google Scholar] [CrossRef] [Scilit]
- Lauková, A.; Focková, V.; Maďar, M.; Belzecki, G.; Miltko, R.; Pogány Simonová, M. Fecal strains Enterococcus mundtii from wild ruminants, their safety and postbiotic potential. Vet. Res. Com. 2025, 49, 141. [Google Scholar] [CrossRef] [Scilit]
- López-Salas, P.; Llaca-Díaz, J.; Morfin-Otero, R.; Tinoco, J.C.; Rodriguéz-Noriega, I.; Salcido-Gutierrez, L.; Gonzaléz, G.M.; Mendoza-Plazaran, S.; Garza-González, E. Virulence and antibiotic resistance of Enterococcus faecalis clinical isolates recovered from three states of Mexico. Arch. Med. Res. 2013, 44, 422–428. [Google Scholar] [CrossRef] [Scilit]
- Ghaziasgar, F.S.; Poursina, F.; Hassanzadeh, A. Virulence factors, biofilm formation and antibiotic resistance pattern in Enterococcus faecalis and Enterococcus faecium isolated from clinical and commensal human samples in Isfahan, Iran. Ann. Ig. 2019, 31, 156–164. [Google Scholar] [CrossRef] [Scilit]
- Ruhal, R.; Sahu, A.; Koujalagi, T.; Das, A.; Prasanth, H.; Kataria, R. Biofilm-specific determinants of enterococci pathogen. Arch. Microbiol. 2024, 206, 397. [Google Scholar] [CrossRef] [Scilit]
- Bonten, M.J.M.; Willems, R.; Weinstein, R.A. Vancomycin-resistant enterococci: Why are they here, and where do they come from? Lancet Infect. Dis. 2001, 1, 314–325. [Google Scholar] [CrossRef] [Scilit]
- Gandhi, N.U.; Chandra, S.B. A comparative analysis of three classes of bacterial non-specific acid phosphatase and archaeal phosphoesterases: Evolutionary perspective. Acta Inf. Medica 2012, 20, 167–173. [Google Scholar] [CrossRef] [Scilit]
- Amoozadeh, M.; Behbani, M.; Mohabatkar, H.; Keyhanfar, M. Analysis and comparison of alkaline and acid phosphatases of Gram-negative bacteria by bioinformatic and colorimetric methods. J. Biotechnol. 2020, 308, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Hu, S.; Ding, Q.; Zhang, W.; Kang, M.; Ma, J.; Zhao, L. Gut microbial β-glucuronidase:a vital regulator in female estrogen. Gut Microbes 2023, 15, 2236749. [Google Scholar] [CrossRef] [Scilit]
- Sabahi, S.; Homayouni, R.A.; Aghebati-Maleki, L.; Sangtarash, N.; Ozma, M.A.; Karimi, A.; Hosseini, H.; Abassi, A. Postbiotics as the new frontier in food and pharmaceutical research. Crit. Rev. Food Sci. Nutr. 2023, 63, 8375–8402. [Google Scholar] [CrossRef] [Scilit]
- Rogelj, I. Milk, dairy products, nutrition and health. Food Technol. Biotechnol. 2000, 38, 143–147. [Google Scholar]
- Venegas-Ortega, M.G.; Flores-Gallegos, A.; Martínez-Hernández, J.L.; Aguilar, C.N.; Nevárez-Moorillón, G.V. Production of bioactive peptides from lactic acid bacteria:a sustainable approach for healthier foods. Compr. Rev. Food Sci. Food Safety 2019, 18, 10391051. [Google Scholar] [CrossRef] [Scilit]
- Delves-Broughton, J. Nisin and its uses as a food preservative. Food Technol. 1990, 44, 100–117. [Google Scholar]
- McAuliffe, O.; Ryan, M.P.; Ross, P.R.; Hill, C.; Breeuwer, P.; Abee, T. Lacticin 3147, a broad-spectrum bacteriocin which selectively dissipates the membrane potential. Appl. Environ. Microbiol. 1998, 64, 439–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luenglusontigit, P.; Sathapondecha, P.; Saengsuwan, P.; Surachat, K.; Boonserm, P.; Singhamanan, K. Effects of postbiotic from bacteriocin-like inhibitory substance producing Enterococcus faecalis on toxigenic Clostridioides difficile. J. Health Sci. Med. Res. 2023, 41, e2023918. [Google Scholar] [CrossRef] [Scilit]
| Genes | Primer Locus Sequence | Product Size |
|---|---|---|
| gelE | F: ACCCCGTATCATTGGTTT R: ACGCATTGCTTTTCCATC | 419 bp |
| Element IS16 | F: CATGTTCCACGAACCAGAG R: TCAAAAAGTGGGCTTGGC | 547 bp |
| Cytolysin cylA | F: TAGCGAGTTATATCGTTCACTGTA R: CTCACCTCTTTGTATTTAAGCATG | 1282 bp |
| Enterococcal surface protein esp | F: TTGCTAATGCTAGTCCACGACC R: GCGTCAACACTTGCATTGCCGAA | 933 bp |
| Hyaluronidase | F: GAGTAGAGGAATATCTTAGC R: AGGCTCCAATTCTGT | 661 bp |
| Aggregation substance agg | F: AAGAAAAAGAAGTAGACCAAC R: AAACGGCAAGACAAGTAAATA | 1553 bp |
| ica | ica4F-TGGGATACTGATATGATTAC, ica4R-CCTCTGTCTGGGGCTTGACCATG | 568 bp |
| bap | Sasp7c-TGTTGAAGTTAATACTGTACCTGC, Sasp6m-CCCTATATCGAAGGTGTAGAATTGCAC | 970 bp |
| fsrA | F-5-GAGCCGTTATGCTCCTATGC-3 R-5-CTGCGGTAGTTGTTGGA-3 | 450 bp |
| ace | F-5-TTGATGCTGCTGCTGATGTG-3, R-5-ACGGATGAGCTTGTTGGGTA-3 | 400 bp |
| srt | F-5-TCTTGGTAGTGGGTCGTTGA-3 R-5-CGCAGTGTGTTTGATGTTGG-3 | 420 bp |
| bopD | F-5-GATCGTCTTCGCCATAGTAGG-3 R-5-RACACAACAGCCCTTGGCT-3 | 312 bp |
| Strain | % Identity BLASTn 16S rRNA Sequence |
|---|---|
| Enterococcus faecalis EE/K3 | 98.45% |
| Enterococcus faecalis EE/K5 | 99.56% |
| Enterococcus faecalis EE/G3 | 98.65% |
| Enterococcus faecalis EE/G6 | 99.91% |
| Enterococcus faecalis EE/G7 | 99.50% |
| EE/K3 | EE.EF/K5 | EE/G3 | EE/G6 | EE/G7 | |
|---|---|---|---|---|---|
| Alkaline phosphatase | 5 | 10 | 0 | 5 | 5 |
| Esterase (C4) | 20 | 40 | 30 | 30 | 20 |
| Esterase lipase (C8) | 20 | 30 | 20 | 20 | 30 |
| Leucine arylamidase | 10 | 10 | 10 | 10 | 10 |
| Valine arylamidase | 5 | 10 | 10 | 5 | 5 |
| Cystin arylamidase | 5 | 10 | 5 | 5 | 5 |
| Trypsin | 5 | 5 | 5 | 5 | 0 |
| α-chymotrypsin | 20 | 20 | 40 | 20 | 10 |
| Acid phosphatase | 40 | 40 | 20 | 30 | 20 |
| Naphtol-AS-BI-phosphohydrolase | 10 | 10 | 10 | 5 | 5 |
| α-galactosidase | 0 | 5 | 0 | 0 | 0 |
| β-galactosidase | 5 | 5 | 0 | 5 | 0 |
| α-glucosidase | 0 | 5 | 0 | 0 | 0 |
| β-glucosidase | 0 | 0 | 5 | 5 | 0 |
| Strains | gelE Gene | agg Gene | esp Gene |
|---|---|---|---|
| EE/K3 | + | − | − |
| EE/K5 | − | − | + |
| EE/G3 | + | − | − |
| EE/G6 | + | + | − |
| EE/G7 | − | − | + |
| Strains | ace Gene | bopD Gene | srtA Gene | Biofilm |
|---|---|---|---|---|
| EE/K3 | − | + | − | 0.153 ± 0.077 |
| EE/K5 | + | + | − | 0.157 ± 0.082 |
| EE/G3 | − | + | − | 0.246 ± 0.171 |
| EE/G6 | − | + | + | 0.242 ± 0.166 |
| EE/G7 | + | + | − | 0.137 ± 0.062 |
| EE/K3 | EE/K5 | EE/G3 | EE/G6 | EE/G7 | |
|---|---|---|---|---|---|
| Ampicillin (10 µg) | 15/22 | 23/15 | 20/10 | 20/10 | 22/10 |
| Penicillin (10 IU) | 20/20 | 20/20 | 20/20 | 16/16 | 19/19 |
| Erythromycin (15 µg) | 20/26 | 15/25 | 16/21 | 15/20 | 20/25 |
| Tetracycline (30 µg) | 20/25 | 15/23 | R (<10) | R (<10) | 20/23 |
| Vancomycin (30 µg) | 15/15 | 14/14 | R (<10) | R (<10) | R (<10) |
| Rifampicin (30 µg) | 25/25 | 20/23 | 22/25 | 21/27 | 20/22 |
| Chloramphenicol (30 µg) | 19/20 | 17/20 | 20/20 | 12/21 | 18/21 |
| Gentamicin (120 µg) | 12/11 | 12/12 | 15/11 | 17/17 | R (<10) |
| EE/K3 | EE/K5 | EE/G3 | EE/G6 | EE/G7 | |
|---|---|---|---|---|---|
| Ampicillin (256-0.016 µg/mL) | MIC: 0.25 µg (S) | 0.50 µg (S) | 0.50 µg (S) | 0.50 µg (S) | 0.50 µg (S) |
| Erythromycin (256-0.016 µg/mL) | 1.00 µg (S) | 1.00 µg (S) | 2.00 µg (S) | 2.00 µg (S) | 1.5 µg (S) |
| Tetracycline (256-0.016 µg/mL | 0.30 µg (S) | 0.38 µg (S) | 32.00 µg (S) | 48.00 µg (S) | 0.38 µg (S) |
| Vancomycin (256-0.016 µg/mL) | 1.00 µg (S) | 0.50 µg (S) | 4.00 µg (S) | 6.00 µg (S) | 1.3 µg (S) |
| Streptomycin (256-0.064 µg/mL) | 128.0 µg (R/S) | 256 µg (R) | 256 µg (R) | 256 µg (R) | 128.0 µg (R/S) |
| Chloramphenicol (256-0.016 µg/mL) | 12.00 µg (S) | 16.00 µg (S) | 8.00 µg (S) | 32.00 µg (S) | 12.00 µg (S) |
| Gentamicin (1024-0.064 µg/mL) | 16.00 µg (S) | 24.00 µg (S) | 32.00 µg (S) | 24.00 µg (S) | 32.00 µg (S) |
| Strains | Substance MK2/8 | Substance MK1/3 |
|---|---|---|
| EE/K3 | 400 AU/mL | 100 AU/mL |
| EE/K5 | 100 AU/mL | 400 AU/mL |
| EE/G3 | 400 AU/mL | 100 AU/mL |
| EE/G6 | 400 AU/mL | 400 AU/mL |
| EE/G7 | 400 AU/mL | 400 AU/mL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lauková, A.; Bino, E.; Zábolyová, N.; Maďar, M.; Pogány Simonová, M. The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes 2025, 13, 3552. https://doi.org/10.3390/pr13113552
Lauková A, Bino E, Zábolyová N, Maďar M, Pogány Simonová M. The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes. 2025; 13(11):3552. https://doi.org/10.3390/pr13113552
Chicago/Turabian StyleLauková, Andrea, Eva Bino, Natália Zábolyová, Marián Maďar, and Monika Pogány Simonová. 2025. "The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci" Processes 13, no. 11: 3552. https://doi.org/10.3390/pr13113552
APA StyleLauková, A., Bino, E., Zábolyová, N., Maďar, M., & Pogány Simonová, M. (2025). The Strains Enterococcus faecalis as Contaminants of Raw Goat Milk and Their Treatment with Postbiotic Active Substances Produced by Autochthonous Lactococci. Processes, 13(11), 3552. https://doi.org/10.3390/pr13113552

