Microbiome Structure of Activated Sludge after Adaptation to Landfill Leachate Treatment in a Lab-Scale Sequencing Batch Reactor
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Methods and Reagents
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kumar, V.; Sharma, N.; Umesh, M.; Chakraborty, P.; Kaur, K.; Duhan, L.; Sarojini, S.; Thazeem, B.; Pasrija, R.; Vangnai, A.S.; et al. Micropollutants Characteristics, Fate, and Sustainable Removal Technologies for Landfill Leachate: A Technical Perspective. J. Water Process Eng. 2023, 53, 103649. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; Peng, Y.; Wang, Z.; Jiang, H.; Ren, S.; Qiu, J. New Insights into Co-Treatment of Mature Landfill Leachate with Municipal Sewage via Integrated Partial Nitrification, Anammox and Denitratation. J. Hazard Mater. 2021, 415, 125506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilmasari, D.; Kamyab, H.; Yuzir, A.; Riyadi, F.A.; Khademi, T.; Al-Qaim, F.F.; Kirpichnikova, I.; Krishnan, S. A Review of the Biological Treatment of Leachate: Available Technologies and Future Requirements for the Circular Economy Implementation. Biochem. Eng. J. 2022, 187, 108605. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Shafy, H.I.; Ibrahim, A.M.; Al-Sulaiman, A.M.; Okasha, R.A. Landfill Leachate: Sources, Nature, Organic Composition, and Treatment: An Environmental Overview. Ain. Shams Eng. J. 2023, 15, 102293. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.; Zhao, Y.; Bisinella, V.; Damgaard, A.; Christensen, T.H. Climate change impacts of conventional sewage sludge treatment and disposal. Water Res. 2023, 240, 120109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gabr, M.E. Impact of climatic changes on future irrigation water requirement in the Middle East and North Africa’s region: A case study of upper Egypt. Appl. Water Sci. 2023, 13, 158. [Google Scholar] [CrossRef] [Scilit]
- Bandala, E.R.; Liu, A.; Wijesiri, B.; Zeidman, A.B.; Goonetilleke, A. Emerging Materials and Technologies for Landfill Leachate Treatment: A Critical Review. Environ. Pollut. 2021, 291, 118133. [Google Scholar] [CrossRef] [Scilit]
- Ren, Y.; Ferraz, F.; Lashkarizadeh, M.; Yuan, Q. Comparing Young Landfill Leachate Treatment Efficiency and Process Stability Using Aerobic Granular Sludge and Suspended Growth Activated Sludge. J. Water Process Eng. 2017, 17, 161–167. [Google Scholar] [CrossRef] [Scilit]
- Vaverková, M.D.; Elbl, J.; Koda, E.; Adamcová, D.; Bilgin, A.; Lukas, V.; Podlasek, A.; Kintl, A.; Wdowska, M.; Brtnický, M.; et al. Chemical Composition and Hazardous Effects of Leachate from the Active Municipal Solid Waste Landfill Surrounded by Farmlands. Sustainability 2020, 12, 4531. [Google Scholar] [CrossRef] [Scilit]
- Baun, A.; Ledin, A.; Reitzel, L.A.; Bjerg, P.L.; Christensen, T.H. Xenobiotic Organic Compounds in Leachates from Ten Danish MSW Landfills-Chemical Analysis and Toxicity Tests. Water Res. 2004, 38, 3845–3858. [Google Scholar] [CrossRef] [Scilit]
- Yan, H.; Cousins, I.T.; Zhang, C.; Zhou, Q. Perfluoroalkyl Acids in Municipal Landfill Leachates from China: Occurrence, Fate during Leachate Treatment and Potential Impact on Groundwater. Sci. Total Environ. 2015, 524, 23–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Busch, J.; Ahrens, L.; Sturm, R.; Ebinghaus, R. Polyfluoroalkyl Compounds in Landfill Leachates. Environ. Pollut. 2010, 158, 1467–1471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belouhova, M.; Yotinov, I.; Schneider, I.; Dinova, N.; Todorova, Y.; Lyubomirova, V.; Mihaylova, V.; Daskalova, E.; Lincheva, S.; Topalova, Y. Purposely Development of the Adaptive Potential of Activated Sludge from Municipal Wastewater Treatment Plant Focused on the Treatment of Landfill Leachate. Processes 2022, 10, 460. [Google Scholar] [CrossRef] [Scilit]
- Torretta, V.; Ferronato, N.; Katsoyiannis, I.A.; Tolkou, A.K.; Airoldi, M. Novel and Conventional Technologies for Landfill Leachates Treatment: A Review. Sustainability 2016, 9, 9. [Google Scholar] [CrossRef] [Scilit]
- Scandelai, A.P.J.; Sloboda Rigobello, E.; de Oliveira, B.L.C.; Tavares, C.R.G. Identification of Organic Compounds in Landfill Leachate Treated by Advanced Oxidation Processes. Environ. Technol. 2019, 40, 730–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmaadawy, K.; Liu, B.; Hu, J.; Hou, H.; Yang, J. Performance Evaluation of Microbial Fuel Cell for Landfill Leachate Treatment: Research Updates and Synergistic Effects of Hybrid Systems. J. Environ. Sci. 2020, 96, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Jagaba, A.H.; Kutty, S.R.M.; Lawal, I.M.; Abubakar, S.; Hassan, I.; Zubairu, I.; Umaru, I.; Abdurrasheed, A.S.; Adam, A.A.; Ghaleb, A.A.S.; et al. Sequencing Batch Reactor Technology for Landfill Leachate Treatment: A State-of-the-Art Review. J. Environ. Manag. 2021, 282, 111946. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Zhang, Y.; Sims, A.; Bernards, M.; Hu, Z. Fate and Toxicity of Melamine in Activated Sludge Treatment Systems after a Long-Term Sludge Adaptation. Water Res. 2013, 47, 2307–2314. [Google Scholar] [CrossRef] [Scilit]
- Cheng, L.; Yang, W.; Liang, H.; Nabi, M.; Li, Y.; Wang, H.; Hu, J.; Chen, T.; Gao, D. Nitrogen Removal from Mature Landfill Leachate through Enhanced Partial Nitrification-Anammox Process in an Innovative Multi-Stage Fixed Biofilm Reactor. Sci. Total Environ. 2023, 877, 162959. [Google Scholar] [CrossRef] [Scilit]
- ISO 18749:2004; Water Quality—Adsorption of Substances on Activated Sludge—Batch Test Using Specific Analytical Methods. ISO: Geneva, Switzerland, 2004.
- BDS ISO 7150/1; Water Quality—Determination of Ammonium—Part 1: Manual Spectrometric Method. ISO: Sofia, Bulgaria, 2002.
- BDS EN 26777; Water Quality—Determination of Nitrite—Molecular Absorption Spectrometric Method. ISO: Sofia, Bulgaria, 1997.
- ISO 7890-3; Water Quality—Determination of Nitrate—Part 3: Spectrometric Method Using Sulfosalicylic Acid. ISO: Sofia, Bulgaria, 1998.
- BDS EN 1189; Water Quality—Determination of Phosphorus—Ammonium Molybdate Spectrometric Method. ISO: Sofia, Bulgaria, 2002.
- Bulgarian Institute for Standardization. Available online: https://bds-bg.org/en/ (accessed on 25 December 2023).
- BDS 17.1.4.02-77; Nature Protection. Hydrosphere. Water Quality Indicators. Method for Determination of Oxidizability. ISO: Sofia, Bulgaria, 1977.
- Amann, R.; Ludwig, W.; Schleifer, K.-H. Phylogenetic Identification and in Situ Detection of Individual Microbial Cells without Cultivation. Microbiol. Rev. 1995, 59, 143–169. [Google Scholar] [CrossRef]
- Nielsen, P.H.; Daims, H.; Lemmer, H.; Arslan-Alaton, I.; Olmez-Hanci, T. FISH Handbook for Biological Wastewater Treatment: Identification and Quantification of Microorganisms in Activated Sludge and Biofilms by FISH; IWA Publishing: London, UK, 2009; p. 123. [Google Scholar]
- Schleifer, K.-H.; Amann, R.; Ludwig, W.; Rothemund, C.; Springer, N.; Dorn, S. Nucleic Acid Probes for the Identification and In-Situ Detection of Pseudomonads. In Pseudomonas: Molecular Biology and Biotechnology; Galli, E., Silver, S., Witholt, B., Federation of European Microbiological Societies, Eds.; FEMS Symposium; American Society for Microbiology: Washington, DC, USA, 1992; ISBN 9781555810511. [Google Scholar]
- Neef, A.; Zaglauer, A.; Meier, H.; Amann, R.; Lemmer, H.; Schleifer, K.H. Population Analysis in a Denitrifying Sand Filter: Conventional and in Situ Identification of Paracoccus spp. in Methanol-Fed Biofilms. Appl. Environ. Microbiol. 1996, 62, 4329–4339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabus, R.; Wilkes, H.; Schramm, A.; Harms, G.; Behrends, A.; Amann, R.; Widdel, F. Anaerobic Utilization of Alkylbenzenes and N-Alkanes from Crude Oil in an Enrichment Culture of Denitrifying Bacteria Affiliating with the Beta-Subclass of Proteobacteria. Environ. Microbiol. 1999, 1, 145–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Friedrich, U.; Van Langenhove, H.; Altendorf, K.; Lipski, A. Microbial Community and Physicochemical Analysis of an Industrial Waste Gas Biofilter and Design of 16S RRNA-Targeting Oligonucleotide Probes. Environ. Microbiol. 2003, 5, 183–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wallner, G.; Amann, R.; Beisker, W. Optimizing Fluorescent in Situ Hybridization with RRNA-Targeted Oligonucleotide Probes for Flow Cytometric Identification of Microorganisms. Cytometry 1993, 14, 136–143. [Google Scholar] [CrossRef] [Scilit]
- Daims, H.; Lücker, S.; Wagner, M. Daime, a Novel Image Analysis Program for Microbial Ecology and Biofilm Research. Environ. Microbiol. 2006, 8, 200–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wright, E.S. Using DECIPHER v2.0 to Analyze Big Biological Sequence Data in R. R J. 2016, 8, 352–359. [Google Scholar] [CrossRef] [Scilit]
- Parks, D.H.; Chuvochina, M.; Chaumeil, P.-A.; Rinke, C.; Mussig, A.J.; Hugenholtz, P. A Complete Domain-to-Species Taxonomy for Bacteria and Archaea. Nat. Biotechnol. 2020, 38, 1079–1086. [Google Scholar] [CrossRef] [Scilit]
- Parks, D.H.; Chuvochina, M.; Waite, D.W.; Rinke, C.; Skarshewski, A.; Chaumeil, P.-A.; Hugenholtz, P. A Standardized Bacterial Taxonomy Based on Genome Phylogeny Substantially Revises the Tree of Life. Nat. Biotechnol. 2018, 36, 996–1004. [Google Scholar] [CrossRef] [Scilit]
- Willetts, A.J.; Cain, R.B. Microbial Metabolism of Alkylbenzene Sulphonates. Bacterial Metabolism of Undecylbenzene-p-Sulphonate and Dodecylbenzene-p-Sulphonate. Biochem. J. 1972, 129, 389–402. [Google Scholar] [CrossRef] [Scilit]
- Farr, D.R.; Cain, R.B. Catechol Oxygenase Induction in Pseudomonas Aeruginosa. Biochem. J. 1968, 106, 879–885. [Google Scholar] [CrossRef] [Scilit]
- Fujisawa, H.; Hayaishi, O. Protocatechuate 3,4-Dioxygenase. I. Crystallization and Characterization. J. Biol. Chem. 1968, 243, 2673–2681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lenhard, G.; Nourse, L.D.; Scwartz, M. The Measurement of Dehydrogenase Activity of Activated Sludge. In Proceedings of the 2nd International Conference on Water Pollution Research, Tokyo, Japan, 24–28 August 1964. [Google Scholar]
- Wang, Y.; Zhang, Y.; Hu, Y.; Liu, L.; Liu, S.J.; Zhang, T. Genome-Centric Metagenomics Reveals the Host-Driven Dynamics and Ecological Role of CPR Bacteria in an Activated Sludge System. Microbiome 2023, 11, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, H.; Fernando, C.E.; Crupper, S.S.; Fields, S.D. Genome Sequence of a Novel Soil Actinomycete, Protaetiibacter sp. Strain SSC-01. Microbiol. Resour. Announc. 2021, 10, e01029-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tarlachkov, S.V.; Ospennikov, Y.V.; Demidov, A.V.; Starodumova, I.P.; Dorofeeva, L.V.; Prisyazhnaya, N.V.; Chizhov, V.N.; Subbotin, S.A.; Evtushenko, L.I. Draft Genome Sequences of 9 Actinobacteria from the Family Microbacteriaceae Associated with Insect- and Nematode-Damaged Plants. Microbiol. Resour. Announc. 2022, 11, e00487-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Cortés, J.J.; Valle, A.; Ramírez, M.; Cantero, D. Characterization of Bacterial and Archaeal Communities by DGGE and Next Generation Sequencing (NGS) of Nitrification Bioreactors Using Two Different Intermediate Landfill Leachates as Ammonium Substrate. Waste Biomass Valorization 2022, 13, 3753–3766. [Google Scholar] [CrossRef] [Scilit]
- Remmas, N.; Roukouni, C.; Ntougias, S. Bacterial Community Structure and Prevalence of Pusillimonas-like Bacteria in Aged Landfill Leachate. Environ. Sci. Pollut. Res. 2017, 24, 6757–6769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, X.; Mohammed, A.; Gao, M.; Liu, Y. Mature Landfill Leachate Treatment Using Granular Sludge-Based Reactor (GSR) via Nitritation/Denitritation: Process Startup and Optimization. Sci. Total Environ. 2022, 844, 157078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tice, H.; Mayilraj, S.; Sims, D.; Lapidus, A.; Nolan, M.; Lucas, S.; Glavina Del Rio, T.; Copeland, A.; Cheng, J.F.; Meincke, L.; et al. Complete Genome Sequence of Nakamurella Multipartita Type Strain (Y-104). Stand Genomic. Sci. 2010, 2, 168–175. [Google Scholar] [CrossRef] [Scilit]
- McIlroy, S.J.; Onetto, C.A.; McIlroy, B.; Herbst, F.A.; Dueholm, M.S.; Kirkegaard, R.H.; Fernando, E.; Karst, S.M.; Nierychlo, M.; Kristensen, J.M.; et al. Genomic and in Situ Analyses Reveal the Micropruina spp. as Abundant Fermentative Glycogen Accumulating Organisms in Enhanced Biological Phosphorus Removal Systems. Front. Microbiol. 2018, 9, 337530. [Google Scholar] [CrossRef] [Scilit]
- Lopez-Vazquez, C.M.; Oehmen, A.; Hooijmans, C.M.; Brdjanovic, D.; Gijzen, H.J.; Yuan, Z.; van Loosdrecht, M.C.M. Modeling the PAO–GAO Competition: Effects of Carbon Source, PH and Temperature. Water Res. 2009, 43, 450–462. [Google Scholar] [CrossRef] [Scilit]
- Kong, Y.H.; Beer, M.; Seviour, R.J.; Lindrea, K.C.; Rees, G.N. Structure and Functional Analysis of the Microbial Community in an Aerobic: Anaerobic Sequencing Batch Reactor (SBR) with No Phosphorus Removal. Syst. Appl. Microbiol. 2001, 24, 597–609. [Google Scholar] [CrossRef] [Scilit]
- Puri, A.; Bajaj, A.; Singh, Y.; Lal, R. Harnessing Taxonomically Diverse and Metabolically Versatile Genus Paracoccus for Bioplastic Synthesis and Xenobiotic Biodegradation. J. Appl. Microbiol. 2022, 132, 4208–4224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Q.; Chen, Y.; Li, X.; Li, C.; Li, X. Low C/N Promotes Stable Partial Nitrification by Enhancing the Cooperation of Functional Microorganisms in Treating High-Strength Ammonium Landfill Leachate. J. Environ. Manag. 2023, 329, 116972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, L.; Lin, H.; Dong, Y.; Li, B.; Lu, Y. A Promising Approach for Simultaneous Removal of Ammonia and Multiple Heavy Metals from Landfill Leachate by Carbonate Precipitating Bacterium. J. Hazard Mater. 2023, 456, 131662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carrareto Alves, L.M.; De Souza, J.A.M.; Varani, A.D.M.; Lemos, E.G.D.M. The Family Rhizobiaceae. In The Prokaryotes; Springer: Berlin/Heidelberg, Germany, 2014; pp. 419–437. [Google Scholar] [CrossRef] [Scilit]
- Jahan, K.; Hoque, S.; Ahmed, T. Activated Sludge and Other Suspended Culture Processes. Water Environ. Res. 2012, 84, 1029–1080. [Google Scholar] [CrossRef] [Scilit]
- Palma, T.L.; Shylova, A.; Costa, M.C. Isolation and Characterization of Bacteria from Activated Sludge Capable of Degrading 17α-Ethinylestradiol, a Contaminant of High Environmental Concern. Microbiology 2021, 167, 001038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, F.; Sun, B.; Li, Q.; Deng, X.; Hu, J.; Wu, W. Pilot-Scale Nitrogen Removal from Leachate by Ex Situ Nitrification and in Situ Denitrification in a Landfill Bioreactor. Chemosphere 2014, 101, 77–85. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Chen, R.; Huang, L.; Ma, H.; Mu, D.; Zhao, Q. Microbial Characteristics of Landfill Leachate Disposed by Aerobic Moving Bed Biofilm Reactor. Water Sci. Technol. 2018, 77, 1089–1097. [Google Scholar] [CrossRef] [Scilit]
- Remmas, N.; Melidis, P.; Katsioupi, E.; Ntougias, S. Effects of High Organic Load on AmoA and NirS Gene Diversity of an Intermittently Aerated and Fed Membrane Bioreactor Treating Landfill Leachate. Bioresour. Technol. 2016, 220, 557–565. [Google Scholar] [CrossRef] [Scilit]
- Michalska, J.; Piński, A.; Zur, J.; Mrozik, A. Selecting Bacteria Candidates for the Bioaugmentation of Activated Sludge to Improve the Aerobic Treatment of Landfill Leachate. Water 2020, 12, 140. [Google Scholar] [CrossRef] [Scilit]
- Xie, B.; Xiong, S.; Liang, S.; Hu, C.; Zhang, X.; Lu, J. Performance and Bacterial Compositions of Aged Refuse Reactors Treating Mature Landfill Leachate. Bioresour. Technol. 2012, 103, 71–77. [Google Scholar] [CrossRef] [Scilit]
- Song, L.; Wang, Y.; Tang, W.; Lei, Y. Bacterial Community Diversity in Municipal Waste Landfill Sites. Appl. Microbiol. Biotechnol. 2015, 99, 7745–7756. [Google Scholar] [CrossRef] [Scilit]
- Remmas, N.; Melidis, P.; Zerva, I.; Kristoffersen, J.B.; Nikolaki, S.; Tsiamis, G.; Ntougias, S. Dominance of Candidate Saccharibacteria in a Membrane Bioreactor Treating Medium Age Landfill Leachate: Effects of Organic Load on Microbial Communities, Hydrolytic Potential and Extracellular Polymeric Substances. Bioresour. Technol. 2017, 238, 48–56. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Dong, R.; Guo, J.; Wang, L.; Zhao, J. Effects of Mn2+ and Humic Acid on Microbial Community Structures, Functional Genes for Nitrogen and Phosphorus Removal, and Heavy Metal Resistance Genes in Wastewater Treatment. J. Environ. Manag. 2022, 313, 115028. [Google Scholar] [CrossRef] [Scilit]
- Tong, J.; Cui, L.; Wang, D.; Wang, X.; Liu, Z. Assessing the Performance and Microbial Structure of Biofilms in Membrane Aerated Biofilm Reactor for High P-Nitrophenol Concentration Treatment. J. Environ. Chem. Eng. 2022, 10, 108635. [Google Scholar] [CrossRef] [Scilit]






| Target Microorganisms | Probes for FISH | Nucleotide Sequence | FA, % | Reference |
|---|---|---|---|---|
| Pseudomonas sp. | Ps | GCT GGC CTA GCC TTC | 20 | Schleifer, 1992 [29] |
| Paracoccus spp. | PAR1244 | GGA TTA ACC CAC TGT CAC C | 20 | Neef, 1996 [30] |
| Azoarcus-Thauera cluster | AT1458 | GAA TCT CAC CGT GGT AAG CGC | 50 | Rabus, 1999 [31] |
| Alcaligenes spp. | ALBO577 | CCG AAC CGC CTG CGC AC Competitor—GCG AAC CGC CTG CGC AC | 35 | Friedrich, 2003 [32] |
| None (nonsense probe) | NON-EUB | ACT CCT ACG GGA GGC AGC | 0–80 | Wallner, 1993 [33] |
| Primer Name | Sequence |
|---|---|
| 341F | ACTCCTACGGGAGGCAGCAG |
| 806R | GGACTACHVGGGTWTCTAAT |
| Control Point | Leachate Dilution | SVI, mL/g | COD, mgO2/L | NH4, mg/L | NO2, mg/L | NO3, mg/L | PO4, mg/L |
|---|---|---|---|---|---|---|---|
| 0 h | - | 30 ± 2 | 1858 ± 55 | 20.1 ± 2.1 | 0.02 ± 0.01 | 452.1 ± 24.3 | 0.25 ± 0.06 |
| 7th day | ×50 | 66 ± 3 | 309 ± 22 | 2.8 ± 0.8 | 0.03 ± 0.02 | 154.4 ± 14.4 | 0.07 ± 0.02 |
| 14th day | ×25 | 105 ± 5 | 890 ± 6 | 5.9 ± 1.1 | 0.02 ± 0.01 | 235.3 ± 18.7 | 0.07 ± 0.03 |
| 21st day | ×1 | 5 ± 1 | 2321 ± 9 | 573.2 ± 18.3 | 0.97 ± 0.1 | 4.4 ± 0.9 | 15.27 ± 3.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kirilova, M.; Yotinov, I.; Todorova, Y.; Dinova, N.; Lincheva, S.; Schneider, I.; Topalova, Y. Microbiome Structure of Activated Sludge after Adaptation to Landfill Leachate Treatment in a Lab-Scale Sequencing Batch Reactor. Processes 2024, 12, 159. https://doi.org/10.3390/pr12010159
Kirilova M, Yotinov I, Todorova Y, Dinova N, Lincheva S, Schneider I, Topalova Y. Microbiome Structure of Activated Sludge after Adaptation to Landfill Leachate Treatment in a Lab-Scale Sequencing Batch Reactor. Processes. 2024; 12(1):159. https://doi.org/10.3390/pr12010159
Chicago/Turabian StyleKirilova, Mihaela, Ivaylo Yotinov, Yovana Todorova, Nora Dinova, Stilyana Lincheva, Irina Schneider, and Yana Topalova. 2024. "Microbiome Structure of Activated Sludge after Adaptation to Landfill Leachate Treatment in a Lab-Scale Sequencing Batch Reactor" Processes 12, no. 1: 159. https://doi.org/10.3390/pr12010159
APA StyleKirilova, M., Yotinov, I., Todorova, Y., Dinova, N., Lincheva, S., Schneider, I., & Topalova, Y. (2024). Microbiome Structure of Activated Sludge after Adaptation to Landfill Leachate Treatment in a Lab-Scale Sequencing Batch Reactor. Processes, 12(1), 159. https://doi.org/10.3390/pr12010159

