Xanthohumol: Anti-Inflammatory Effects in Mechanically Stimulated Periodontal Ligament Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture and Mechanical Stimulation
2.3. MTS Assay
2.4. Isolation and Purification of RNA
2.5. RT-qPCR
2.6. Western Blot
2.7. ELISA
2.8. Statistical Analysis
3. Results
3.1. Compressive Force Led to Decreased Growth Density
3.2. The Viability of hPDLSCs Was Increased and Decreased by Xanthohumol in a Time- and Dose-Dependent Manner
3.3. XN Reduces IL-6 mRNA Expression in Compressively Stimulated hPDLSCs
3.4. Xanthohumol Increased the Levels of IL-6 Protein Expression from Compressively Stimulated hPDLSCs
3.5. The Phosphorylation of AKT and ERK Induced by Compressive Stimulation Was Re-Established by Xanthohumol
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Weiskirchen, R.; Mahli, A.; Weiskirchen, S.; Hellerbrand, C. The Hop Constituent Xanthohumol Exhibits Hepatoprotective Effects and Inhibits the Activation of Hepatic Stellate Cells at Different Levels. Front. Physiol. 2015, 6, 140. [Google Scholar] [CrossRef] [PubMed]
- Torrens-Mas, M.; Alorda-Clara, M.; Martínez-Vigara, M.; Roca, P.; Sastre-Serra, J.; Oliver, J.; Pons, D.G.; Mart Inez-Vigara, M. Xanthohumol Reduces Inflammation and Cell Metabolism in HT29 Primary Colon Cancer Cells. Int. J. Food Sci. Nutr. 2022, 73, 471–479. [Google Scholar] [CrossRef]
- Huangfu, Y.; Yu, X.; Wan, C.; Zhu, Y.; Wei, Z.; Li, F.; Wang, Y.; Zhang, K.; Li, S.; Dong, Y.; et al. Xanthohumol Alleviates Oxidative Stress and Impaired Autophagy in Experimental Severe Acute Pancreatitis through Inhibition of AKT/MTOR. Front. Pharmacol. 2023, 14, 1105726. [Google Scholar] [CrossRef] [PubMed]
- Sławińska-Brych, A.; Zdzisińska, B.; Czerwonka, A.; Mizerska-Kowalska, M.; Dmoszyńska-Graniczka, M.; Stepulak, A.; Gagoś, M. Xanthohumol Exhibits Anti-Myeloma Activity in Vitro through Inhibition of Cell Proliferation, Induction of Apoptosis via the ERK and JNK-Dependent Mechanism, and Suppression of SIL-6R and VEGF Production. Biochim. Biophys. Acta Gen. Subj. 2019, 1863, 129408. [Google Scholar] [CrossRef]
- Mi, X.; Wang, C.; Sun, C.; Chen, X.; Huo, X.; Zhang, Y.; Li, G.; Xu, B.; Zhang, J.; Xie, J.; et al. Xanthohumol Induces Paraptosis of Leukemia Cells through P38 Mitogen Activated Protein Kinase Signaling Pathway. Oncotarget 2017, 8, 31297–31304. [Google Scholar] [CrossRef] [PubMed]
- Guo, D.; Zhang, B.; Liu, S.; Jin, M. Xanthohumol Induces Apoptosis via Caspase Activation, Regulation of Bcl-2, and Inhibition of PI3K/Akt/MTOR-Kinase in Human Gastric Cancer Cells. Biomed. Pharmacother. 2018, 106, 1300–1306. [Google Scholar] [CrossRef] [PubMed]
- Niederau, C.; Bhargava, S.; Schneider-Kramman, R.; Jankowski, J.; Craveiro, R.B.; Wolf, M. Xanthohumol Exerts Anti-Inflammatory Effects in an in Vitro Model of Mechanically Stimulated Cementoblasts. Sci. Rep. 2022, 12, 14970. [Google Scholar] [CrossRef]
- Yamamoto, T.; Hasegawa, T.; Yamamoto, T.; Hongo, H.; Amizuka, N. Histology of Human Cementum: Its Structure, Function, and Development. Jpn. Dent. Sci. Rev. 2016, 52, 63–74. [Google Scholar] [CrossRef]
- Nanci, A.; Bosshardt, D.D. Structure of Periodontal Tissues in Health and Disease. Periodontol. 2000 2006, 40, 11–28. [Google Scholar] [CrossRef]
- HASSELL, T.M. Tissues and Cells of the Periodontium. Periodontology 2000 1993, 3, 9–38. [Google Scholar] [CrossRef]
- Burstone, C.J. The Biomechanics of Tooth Movement. In Vistas in Orthodontics; Lea & Febiger: Philadelphia, PA, USA, 1962; pp. 197–213. [Google Scholar]
- Aveic, S.; Craveiro, R.B.; Wolf, M.; Fischer, H. Current Trends in In Vitro Modeling to Mimic Cellular Crosstalk in Periodontal Tissue. Adv. Healthc. Mater. 2021, 10, 2001269. [Google Scholar] [CrossRef]
- Craveiro, R.B.; Florea, A.; Niederau, C.; Brenji, S.; Kiessling, F.; Sahnoun, S.E.M.; Morgenroth, A.; Mottaghy, F.M.; Wolf, M. [68Ga]Ga-Pentixafor and Sodium [18F]Fluoride PET Can Non-Invasively Identify and Monitor the Dynamics of Orthodontic Tooth Movement in Mouse Model. Cells 2022, 11, 2949. [Google Scholar] [CrossRef] [PubMed]
- Kirschneck, C.; Meier, M.; Bauer, K.; Proff, P.; Fanghänel, J. Meloxicam Medication Reduces Orthodontically Induced Dental Root Resorption and Tooth Movement Velocity: A Combined in Vivo and in Vitro Study of Dental-Periodontal Cells and Tissue. Cell Tissue Res. 2017, 368, 61–78. [Google Scholar] [CrossRef] [PubMed]
- Kaklamanos, E.G.; Makrygiannakis, M.A.; Athanasiou, A.E. Does Medication Administration Affect the Rate of Orthodontic Tooth Movement and Root Resorption Development in Humans? A Systematic Review. Eur. J. Orthod. 2019, 42, 407–414. [Google Scholar] [CrossRef] [PubMed]
- Bartzela, T.; Türp, J.C.; Motschall, E.; Maltha, J.C. Medication Effects on the Rate of Orthodontic Tooth Movement: A Systematic Literature Review. Am. J. Orthod. Dentofac. Orthop. 2009, 135, 16–26. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, K.; Shibata, Y.; Imai, S.; Tani, Y.; Yoshinobu, S.; Fukuhara, T. Clinical Application of Prostaglandin El (PGE,) upon Orthodontic Tooth Movement. Am. J. Orthod. 1984, 85, 508–518. [Google Scholar] [CrossRef]
- Weltman, B.; Vig, K.W.L.; Fields, H.W.; Shanker, S.; Kaizar, E.E. Root Resorption Associated with Orthodontic Tooth Movement: A Systematic Review. Am. J. Orthod. Dentofac. Orthop. 2010, 137, 462–476. [Google Scholar] [CrossRef]
- Mahida, K.; Agrawal, C.; Baswaraj, H.; Tandur, A.; Patel, B.; Chokshi, H. Root Resorption: An Abnormal Consequence of the Orthodontic Treatment. Int. J. Contemp. Dent. 2015, 6, 7–9. [Google Scholar]
- Brezniak, N.; Wasserstein, A. Orthodontically Induced Inflammatory Root Resorption. Part I: The Basic Science Aspects. Angle Orthod. 2002, 72, 175–179. [Google Scholar]
- Janjic, M.; Docheva, D.; Trickovic Janjic, O.; Wichelhaus, A.; Baumert, U. In Vitro Weight-Loaded Cell Models for Understanding Mechanodependent Molecular Pathways Involved in Orthodontic Tooth Movement: A Systematic Review. Stem Cells Int. 2018, 2018, 3208285. [Google Scholar] [CrossRef]
- Ichioka, H.; Yamamoto, T.; Yamamoto, K.; Honjo, K.I.; Adachi, T.; Oseko, F.; Mazda, O.; Kanamura, N.; Kita, M. Biomechanical Force Induces the Growth Factor Production in Human Periodontal Ligament-Derived Cells. Odontology 2016, 104, 27–34. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, T.; Kita, M.; Kimura, I.; Oseko, F.; Terauchi, R.; Takahashi, K.; Kubo, T.; Kanamura, N. Mechanical Stress Induces Expression of Cytokines in Human Periodontal Ligament Cells. Oral Dis. 2006, 12, 171–175. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, C.A.; Gubrij, I.; Lin, S.C.; Saylors, R.L.; Manolagas, S.C. STAT3 Activation in Stromal/Osteoblastic Cells Is Required for Induction of the Receptor Activator of NF-ΚB Ligand and Stimulation of Osteoclastogenesis by Gp130-Utilizing Cytokines or Interleukin-1 but Not 1,25-Dihydroxyvitamin D3 or Parathyroid Hormone. J. Biol. Chem. 1999, 274, 19301–19308. [Google Scholar] [CrossRef]
- Dougall, W.C.; Glaccum, M.; Charrier, K.; Rohrbach, K.; Brasel, K.; De Smedt, T.; Daro, E.; Smith, J.; Tometsko, M.E.; Maliszewski, C.R.; et al. RANK Is Essential for Osteoclast and Lymph Node Development. Genes Dev. 1999, 13, 2412–2424. [Google Scholar] [CrossRef] [PubMed]
- Ono, T.; Hayashi, M.; Sasaki, F.; Nakashima, T. RANKL Biology: Bone Metabolism, the Immune System, and Beyond. Inflamm. Regen. 2020, 40, 2. [Google Scholar] [CrossRef] [PubMed]
- Roth, C.E.; Craveiro, R.B.; Niederau, C.; Malyaran, H.; Neuss, S.; Jankowski, J.; Wolf, M. Mechanical Compression by Simulating Orthodontic Tooth Movement in an In Vitro Model Modulates Phosphorylation of AKT and MAPKs via TLR4 in Human Periodontal Ligament Cells. Int. J. Mol. Sci. 2022, 23, 8062. [Google Scholar] [CrossRef]
- Liu, H.; Huang, Y.; Zhang, Y.; Han, Y.; Zhang, Y.; Jia, L.; Zheng, Y.; Li, W. Long Noncoding RNA Expression Profile of Mouse Cementoblasts under Compressive Force. Angle Orthod. 2019, 89, 455–463. [Google Scholar] [CrossRef]
- Azraq, I.; Craveiro, R.B.; Niederau, C.; Brockhaus, J.; Bastian, A.; Knaup, I.; Neuss, S.; Wolf, M. Gene Expression and Phosphorylation of ERK and AKT Are Regulated Depending on Mechanical Force and Cell Confluence in Murine Cementoblasts. Ann. Anat. 2021, 234, 151668. [Google Scholar] [CrossRef]
- Niederau, C.; Craveiro, R.B.; Azraq, I.; Brockhaus, J.; Bastian, A.; Kirschneck, C.; Wolf, M. Selection and Validation of Reference Genes by RT-QPCR for Murine Cementoblasts in Mechanical Loading Experiments Simulating Orthodontic Forces in Vitro. Sci. Rep. 2020, 10, 10893. [Google Scholar] [CrossRef]
- Li, M.; Zhang, C.; Yang, Y. Effects of Mechanical Forces on Osteogenesis and Osteoclastogenesis in Human Periodontal Ligament Fibroblasts. Bone Jt. Res. 2019, 8, 19–31. [Google Scholar] [CrossRef]
- Roth, C.E.; Niederau, C.; Radermacher, C.; Rizk, M.; Neuss, S.; Jankowski, J.; Apel, C.; Craveiro, R.B.; Wolf, M. Knockout of Bone Sialoprotein in Cementoblasts Cell Lines Affects Specific Gene Expression in Unstimulated and Mechanically Stimulated Conditions. Ann. Anat. 2023, 249, 152102. [Google Scholar] [CrossRef] [PubMed]
- Costa, R.; Negrão, R.; Valente, I.; Castela, Â.; Duarte, D.; Guardão, L.; Magalhães, P.J.; Rodrigues, J.A.; Guimarães, J.T.; Gomes, P.; et al. Xanthohumol Modulates Inflammation, Oxidative Stress, and Angiogenesis in Type 1 Diabetic Rat Skin Wound Healing. J. Nat. Prod. 2013, 76, 2047–2053. [Google Scholar] [CrossRef]
- Saito, K.; Matsuo, Y.; Imafuji, H.; Okubo, T.; Maeda, Y.; Sato, T.; Shamoto, T.; Tsuboi, K.; Morimoto, M.; Takahashi, H.; et al. Xanthohumol Inhibits Angiogenesis by Suppressing Nuclear Factor-ΚB Activation in Pancreatic Cancer. Cancer Sci. 2018, 109, 132–140. [Google Scholar] [CrossRef]
- Dorn, C.; Kraus, B.; Motyl, M.; Weiss, T.S.; Gehrig, M.; Schölmerich, J.; Heilmann, J.; Hellerbrand, C. Xanthohumol, a Chalcon Derived from Hops, Inhibits Hepatic Inflammation and Fibrosis. Mol. Nutr. Food Res. 2010, 54, S205–S213. [Google Scholar] [CrossRef] [PubMed]
- Stevens, J.F.; Taylor, A.W.; Deinzer, M.L. Quantitative Analysis of Xanthohumol and Related Prenylflavonoids in Hops and Beer by Liquid Chromatography-Tandem Mass Spectrometry. J. Chromatogr. A 1999, 832, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Biendl, M. Method for Isolating Xanthohumol in Hops; Hopfen-Rundschau International: Wolnzach, Germany, 2003; pp. 33–36. [Google Scholar]
- Legette, L.; Karnpracha, C.; Reed, R.L.; Choi, J.; Bobe, G.; Christensen, J.M.; Rodriguez-Proteau, R.; Purnell, J.Q.; Stevens, J.F. Human Pharmacokinetics of Xanthohumol, an Antihyperglycemic Flavonoid from Hops. Mol. Nutr. Food Res. 2014, 58, 248–255. [Google Scholar] [CrossRef]
- Kirkwood, J.S.; Legette, L.C.L.; Miranda, C.L.; Jiang, Y.; Stevens, J.F. A Metabolomics-Driven Elucidation of the Anti-Obesity Mechanisms of Xanthohumol. J. Biol. Chem. 2013, 288, 19000–19013. [Google Scholar] [CrossRef]
- Legette, L.L.; Moreno Luna, A.Y.; Reed, R.L.; Miranda, C.L.; Bobe, G.; Proteau, R.R.; Stevens, J.F. Xanthohumol Lowers Body Weight and Fasting Plasma Glucose in Obese Male Zucker Fa/Fa Rats. Phytochemistry 2013, 91, 236–241. [Google Scholar] [CrossRef]
- Hussong, R.; Frank, N.; Knauft, J.; Ittrich, C.; Owen, R.; Becker, H.; Gerhäuser, C. A Safety Study of Oral Xanthohumol Administration and Its Influence on Fertility in Sprague Dawley Rats. Mol. Nutr. Food Res. 2005, 49, 861–867. [Google Scholar] [CrossRef]
- Hanske, L.; Hussong, R.; Frank, N.; Gerhäuser, C.; Blaut, M.; Braune, A. Xanthohumol Does Not Affect the Composition of Rat Intestinal Microbiota. Mol. Nutr. Food Res. 2005, 49, 868–873. [Google Scholar] [CrossRef]
- Vanhoecke, B.W.; Delporte, F.; Van Braeckel, E.; Heyerick, A.; Depypere, H.T.; Nuytinck, M.; De Keukeleire, D.; Bracke, M.E. A Safety Study of Oral Tangeretin and Xanthohumol Administration to Laboratory Mice. In Vivo 2005, 19, 103–108. [Google Scholar] [PubMed]
- Janjic Rankovic, M.; Docheva, D.; Wichelhaus, A.; Baumert, U. Effect of Static Compressive Force on in Vitro Cultured PDL Fibroblasts: Monitoring of Viability and Gene Expression over 6 Days. Clin. Oral Investig. 2020, 24, 2497–2511. [Google Scholar] [CrossRef] [PubMed]
- Kirschneck, C.; Batschkus, S.; Proff, P.; Köstler, J.; Spanier, G.; Schröder, A. Valid Gene Expression Normalization by RT-QPCR in Studies on HPDL Fibroblasts with Focus on Orthodontic Tooth Movement and Periodontitis. Sci. Rep. 2017, 7, 14751. [Google Scholar] [CrossRef] [PubMed]
- Schröder, A.; Küchler, E.C.; Omori, M.; Spanier, G.; Proff, P.; Kirschneck, C. Effects of Ethanol on Human Periodontal Ligament Fibroblasts Subjected to Static Compressive Force. Alcohol 2019, 77, 59–70. [Google Scholar] [CrossRef]
- Liu, X.; An, L.J.; Li, Y.; Wang, Y.; Zhao, L.; Lv, X.; Guo, J.; Song, A.L. Xanthohumol Chalcone Acts as a Powerful Inhibitor of Carcinogenesis in Drug-Resistant Human Colon Carcinoma and These Effects Are Mediated via G2/M Phase Cell Cycle Arrest, Activation of Apoptotic Pathways, Caspase Activation and Targeting Ras/MEK/ERK Pa. J. BUON 2019, 24, 2442–2447. [Google Scholar]
- Sławińska-Brych, A.; Zdzisińska, B.; Dmoszyńska-Graniczka, M.; Jeleniewicz, W.; Kurzepa, J.; Gagoś, M.; Stepulak, A. Xanthohumol Inhibits the Extracellular Signal Regulated Kinase (ERK) Signalling Pathway and Suppresses Cell Growth of Lung Adenocarcinoma Cells. Toxicology 2016, 357–358, 65–73. [Google Scholar] [CrossRef]
- Liu, X.; Song, M.; Wang, P.; Zhao, R.; Chen, H.; Zhang, M.; Shi, Y.; Liu, K.; Liu, F.; Yang, R.; et al. Targeted Therapy of the AKT Kinase Inhibits Esophageal Squamous Cell Carcinoma Growth in Vitro and in Vivo. Int. J. Cancer 2019, 145, 1007–1019. [Google Scholar] [CrossRef]
- Lee, S.I.; Park, K.H.; Kim, S.J.; Kang, Y.G.; Lee, Y.M.; Kim, E.C. Mechanical Stress-Activated Immune Response Genes via Sirtuin 1 Expression in Human Periodontal Ligament Cells. Clin. Exp. Immunol. 2012, 168, 113–124. [Google Scholar] [CrossRef]
- Qin, X.; Li, J.; Sun, J.; Liu, L.; Chen, D.; Liu, Y. Low Shear Stress Induces ERK Nuclear Localization and YAP Activation to Control the Proliferation of Breast Cancer Cells. Biochem. Biophys. Res. Commun. 2019, 510, 219–223. [Google Scholar] [CrossRef]
- Cheng, P.; Alberts, I.; Li, X. The Role of ERK1/2 in the Regulation of Proliferation and Differentiation of Astrocytes in Developing Brain. Int. J. Dev. Neurosci. 2013, 31, 783–789. [Google Scholar] [CrossRef]
- Miyamoto, T.; Mori, T.; Yoshimura, A.; Toyama, T. STAT3 Is Critical to Promote Inflammatory Cytokines and RANKL Expression in Inflammatory Arthritis. Arthritis Res. Ther. 2012, 14, P43. [Google Scholar] [CrossRef]



| Gene Symbol | Gene Name (Homo Sapiens) | Gene Function | Accession Number (NCBI Gene Bank) | Chromosome Location (Length) | 5′ Forward Primer-3′ (Length/Tm/GC) | 5′ Reverse Primer-3′ (Length/Tm/GC) | Primer Location | Amplicon Length | Amplicon Location (bp of Start/Stop) | Intron-Flanking (Length) | Variants Targeted (Transcript/Splice) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| RPL22 | ribosomal protein L22 | translation of mRNA in protein | NM_000983 | 1; 1p36.31 | TGATTGCACCCACCCTGTAG | GGTTCCCAGCTTTTCCGTTC | Exon 2/3 | 98 | 91/188 | yes | yes |
| (2061 bp) | (20 bp/59.67 °C/55%GC) | (20 bp/59.4 °C/55%GC) | |||||||||
| IL-6 | Interleukin 6 | important role in bone metabolism; osteoclastogenesis | NM_000600 | 7; 7p15.3 | CATCCTCGACGGCATCTCAG | TCACCAGGCAAGTCTCCTCA | Exon 2/4 | 164 | 240/403 | yes | yes |
| (1127 bp) | (20 bp/60.32 °C/60%GC) | (20 bp/60.47 °C/55%GC) | |||||||||
| MMP9 | matrix metalloprotease 9 | breakdown of extracellular matrix; reproduction and tissue remodelling | NM_004994.3 | 20q13.12 | ATTTCTGCCAGGACCGCTTC | TCATAGGTCACGTAGCCCACT | Exon 13 | 85 | 2053/2118 | no | no |
| (2336 bp) | (20 bp/60.68 °C/55%GC) | (21 bp/60.34 °C/52,38%GC) | |||||||||
| VEGFA | vascular endothelial growth factor A | induces proliferation and migration of vascular endothelial cells | NM_001171623 | 6p21.1 | GGAGGGCAGAATCATCACGAA | GGTACTCCTGGAAGATGTCCAC | Exon 2/3 | 100 | 1153/1211 | yes | yes |
| (3660 bp) | (21 bp/60.1 °C/52.3%GC) | (22 bp/59.8 °C/54.5%GC) | |||||||||
| PTGS2 (COX2) | prostaglandin-endoperoxide synthase 2 | involved in prostaglandin synthesis | NM_000963 | 1q31.1 | GATGATTGCCCGACTCCCTT | GGCCCTCGCTTATGATCTGT | Exon 4/5 | 185 | 560/725 | yes | yes |
| (4510 pb) | (20 bp/59.8 °C/55%GC) | (20 pb/59.6 °C/55%GC) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niederau, C.; Tolba, R.H.; Jankowski, J.; Marx, N.; Wolf, M.; Craveiro, R.B. Xanthohumol: Anti-Inflammatory Effects in Mechanically Stimulated Periodontal Ligament Stem Cells. Biomedicines 2024, 12, 2688. https://doi.org/10.3390/biomedicines12122688
Niederau C, Tolba RH, Jankowski J, Marx N, Wolf M, Craveiro RB. Xanthohumol: Anti-Inflammatory Effects in Mechanically Stimulated Periodontal Ligament Stem Cells. Biomedicines. 2024; 12(12):2688. https://doi.org/10.3390/biomedicines12122688
Chicago/Turabian StyleNiederau, Christian, René H. Tolba, Joachim Jankowski, Nikolaus Marx, Michael Wolf, and Rogerio Bastos Craveiro. 2024. "Xanthohumol: Anti-Inflammatory Effects in Mechanically Stimulated Periodontal Ligament Stem Cells" Biomedicines 12, no. 12: 2688. https://doi.org/10.3390/biomedicines12122688
APA StyleNiederau, C., Tolba, R. H., Jankowski, J., Marx, N., Wolf, M., & Craveiro, R. B. (2024). Xanthohumol: Anti-Inflammatory Effects in Mechanically Stimulated Periodontal Ligament Stem Cells. Biomedicines, 12(12), 2688. https://doi.org/10.3390/biomedicines12122688

