N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota
Abstract
:1. Introduction
2. Material and Methods
2.1. Chemicals
2.2. Bacterial Strains, Culture, Medium
2.3. Disruption and Complementation of Ncpah in B. thetaiotaomicron
2.4. High-Performance Liquid Chromatography (HPLC) Analysis of Polyamines in Cells and Culture Supernatant
2.5. Expression, Purification, and Characterization of Recombinant NCPAH
2.6. Enzymatic Assay Using Recombinant NCPAH
3. Results
3.1. Disruption of Ncpah Abolishes Accumulation of Intracellular Spermidine in B. thetaiotaomicron
3.2. NCPAH Converts N-carbamoylputrescine to Putrescine and the Activity Is Regulated by Polyamines and the Polyamine Precursor Agmatine
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Igarashi, K.; Kashiwagi, K. Polyamines: Mysterious modulators of cellular functions. Biochem. Biophys. Res. Commun. 2000, 271, 559–564. [Google Scholar] [CrossRef]
- Soda, K.; Dobashi, Y.; Kano, Y.; Tsujinaka, S.; Konishi, F. Polyamine-rich food decreases age-associated pathology and mortality in aged mice. Exp. Gerontol. 2009, 44, 727–732. [Google Scholar] [CrossRef]
- Eisenberg, T.; Knauer, H.; Schauer, A.; Buttner, S.; Ruckenstuhl, C.; Carmona-Gutierrez, D.; Ring, J.; Schroeder, S.; Magnes, C.; Antonacci, L.; et al. Induction of autophagy by spermidine promotes longevity. Nat. Cell. Biol. 2009, 11, 1305–1314. [Google Scholar] [CrossRef]
- Matsumoto, M.; Kurihara, S.; Kibe, R.; Ashida, H.; Benno, Y. Longevity in mice is promoted by probiotic-induced suppression of colonic senescence dependent on upregulation of gut bacterial polyamine production. PLoS ONE 2011, 6, e23652. [Google Scholar] [CrossRef] [Green Version]
- Soda, K.; Kano, Y.; Chiba, F.; Koizumi, K.; Miyaki, Y. Increased polyamine intake inhibits age-associated alteration in global DNA methylation and 1,2-dimethylhydrazine-induced tumorigenesis. PLoS ONE 2013, 8, e64357. [Google Scholar] [CrossRef] [Green Version]
- Kibe, R.; Kurihara, S.; Sakai, Y.; Suzuki, H.; Ooga, T.; Sawaki, E.; Muramatsu, K.; Nakamura, A.; Yamashita, A.; Kitada, Y.; et al. Upregulation of colonic luminal polyamines produced by intestinal microbiota delays senescence in mice. Sci. Rep. 2014, 4, 4548. [Google Scholar] [CrossRef] [Green Version]
- Gupta, V.K.; Scheunemann, L.; Eisenberg, T.; Mertel, S.; Bhukel, A.; Koemans, T.S.; Kramer, J.M.; Liu, K.S.; Schroeder, S.; Stunnenberg, H.G.; et al. Restoring polyamines protects from age-induced memory impairment in an autophagy-dependent manner. Nat. Neurosci. 2013, 16, 1453–1460. [Google Scholar] [CrossRef]
- Eisenberg, T.; Abdellatif, M.; Schroeder, S.; Primessnig, U.; Stekovic, S.; Pendl, T.; Harger, A.; Schipke, J.; Zimmermann, A.; Schmidt, A.; et al. Cardioprotection and lifespan extension by the natural polyamine spermidine. Nat. Med. 2016, 22, 1428–1438. [Google Scholar] [CrossRef]
- Nakamura, A.; Kurihara, S.; Takahashi, D.; Ohashi, W.; Nakamura, Y.; Kimura, S.; Onuki, M.; Kume, A.; Sasazawa, Y.; Furusawa, Y.; et al. Symbiotic polyamine metabolism regulates epithelial proliferation and macrophage differentiation in the colon. Nat. Commun. 2021, 12, 2105. [Google Scholar] [CrossRef]
- Al-Habsi, M.; Chamoto, K.; Matsumoto, K.; Nomura, N.; Zhang, B.; Sugiura, Y.; Sonomura, K.; Maharani, A.; Nakajima, Y.; Wu, Y.; et al. Spermidine activates mitochondrial trifunctional protein and improves antitumor immunity in mice. Science 2022, 378, eabj3510. [Google Scholar] [CrossRef]
- Wirth, M.; Schwarz, C.; Benson, G.; Horn, N.; Buchert, R.; Lange, C.; Kobe, T.; Hetzer, S.; Maglione, M.; Michael, E.; et al. Effects of spermidine supplementation on cognition and biomarkers in older adults with subjective cognitive decline (SmartAge)-study protocol for a randomized controlled trial. Alzheimers Res. Ther. 2019, 11, 36. [Google Scholar] [CrossRef]
- Gerner, E.W.; Meyskens, F.L., Jr. Polyamines and cancer: Old molecules, new understanding. Nat. Rev. Cancer 2004, 4, 781–792. [Google Scholar] [CrossRef] [Green Version]
- Casero, R.A., Jr.; Murray Stewart, T.; Pegg, A.E. Polyamine metabolism and cancer: Treatments, challenges and opportunities. Nat. Rev. Cancer 2018, 18, 681–695. [Google Scholar] [CrossRef]
- Matsumoto, M.; Kibe, R.; Ooga, T.; Aiba, Y.; Kurihara, S.; Sawaki, E.; Koga, Y.; Benno, Y. Impact of intestinal microbiota on intestinal luminal metabolome. Sci. Rep. 2012, 2, 233. [Google Scholar] [CrossRef] [Green Version]
- Tabor, C.W.; Tabor, H. Polyamines in microorganisms. Microbiol. Rev. 1985, 49, 81–99. [Google Scholar] [CrossRef]
- Michael, A.J. Biosynthesis of Polyamines in Eukaryotes, Archaea, and Bacteria. In Polyamines: A Universal Molecular Nexus for Growth, Survival, and Specialized Metabolism; Tomonobu Kusano, H.S., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 3–14. [Google Scholar]
- Boyle, S.M.; Markham, G.D.; Hafner, E.W.; Wright, J.M.; Tabor, H.; Tabor, C.W. Expression of the cloned genes encoding the putrescine biosynthetic enzymes and methionine adenosyltransferase of Escherichia coli (speA, speB, speC and metK). Gene 1984, 30, 129–136. [Google Scholar] [CrossRef]
- Tabor, C.W.; Tabor, H.; Xie, Q.W. Spermidine synthase of Escherichia coli: Localization of the speE gene. Proc. Natl. Acad. Sci. USA 1986, 83, 6040–6044. [Google Scholar] [CrossRef] [Green Version]
- Pistocchi, R.; Kashiwagi, K.; Miyamoto, S.; Nukui, E.; Sadakata, Y.; Kobayashi, H.; Igarashi, K. Characteristics of the operon for a putrescine transport system that maps at 19 minutes on the Escherichia coli chromosome. J. Biol. Chem. 1993, 268, 146–152. [Google Scholar] [CrossRef]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Green Version]
- Kurihara, S.; Tsuboi, Y.; Oda, S.; Kim, H.G.; Kumagai, H.; Suzuki, H. The putrescine Importer PuuP of Escherichia coli K-12. J. Bacteriol. 2009, 191, 2776–2782. [Google Scholar] [CrossRef] [Green Version]
- Kurihara, S.; Suzuki, H.; Oshida, M.; Benno, Y. A novel putrescine importer required for type 1 pili-driven surface motility induced by extracellular putrescine in Escherichia coli K-12. J. Biol. Chem. 2011, 286, 10185–10192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugiyama, Y.; Nakamura, A.; Matsumoto, M.; Kanbe, A.; Sakanaka, M.; Higashi, K.; Igarashi, K.; Katayama, T.; Suzuki, H.; Kurihara, S. A Novel Putrescine Exporter SapBCDF of Escherichia coli. J. Biol. Chem. 2016, 291, 26343–26351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kashiwagi, K.; Miyamoto, S.; Suzuki, F.; Kobayashi, H.; Igarashi, K. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 1992, 89, 4529–4533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kashiwagi, K.; Shibuya, S.; Tomitori, H.; Kuraishi, A.; Igarashi, K. Excretion and uptake of putrescine by the PotE protein in Escherichia coli. J. Biol. Chem. 1997, 272, 6318–6323. [Google Scholar] [CrossRef] [Green Version]
- Higashi, K.; Ishigure, H.; Demizu, R.; Uemura, T.; Nishino, K.; Yamaguchi, A.; Kashiwagi, K.; Igarashi, K. Identification of a spermidine excretion protein complex (MdtJI) in Escherichia coli. J. Bacteriol. 2008, 190, 872–878. [Google Scholar] [CrossRef] [Green Version]
- Shaibe, E.; Metzer, E.; Halpern, Y.S. Metabolic pathway for the utilization of L-arginine, L-ornithine, agmatine, and putrescine as nitrogen sources in Escherichia coli K-12. J. Bacteriol. 1985, 163, 933–937. [Google Scholar] [CrossRef] [Green Version]
- Kurihara, S.; Oda, S.; Kato, K.; Kim, H.G.; Koyanagi, T.; Kumagai, H.; Suzuki, H. A novel putrescine utilization pathway involves gamma-glutamylated intermediates of Escherichia coli K-12. J. Biol. Chem. 2005, 280, 4602–4608. [Google Scholar] [CrossRef] [Green Version]
- Schneider, B.L.; Reitzer, L. Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. J. Bacteriol. 2012, 194, 4080–4088. [Google Scholar] [CrossRef] [Green Version]
- Kurihara, S.; Oda, S.; Tsuboi, Y.; Kim, H.G.; Oshida, M.; Kumagai, H.; Suzuki, H. gamma-Glutamylputrescine synthetase in the putrescine utilization pathway of Escherichia coli K-12. J. Biol. Chem. 2008, 283, 19981–19990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurihara, S.; Oda, S.; Kumagai, H.; Suzuki, H. Gamma-glutamyl-gamma-aminobutyrate hydrolase in the putrescine utilization pathway of Escherichia coli K-12. FEMS Microbiol. Lett. 2006, 256, 318–323. [Google Scholar] [CrossRef] [PubMed]
- Kurihara, S.; Kato, K.; Asada, K.; Kumagai, H.; Suzuki, H. A putrescine-inducible pathway comprising PuuE-YneI in which gamma-aminobutyrate is degraded into succinate in Escherichia coli K-12. J. Bacteriol. 2010, 192, 4582–4591. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanfrey, C.C.; Pearson, B.M.; Hazeldine, S.; Lee, J.; Gaskin, D.J.; Woster, P.M.; Phillips, M.A.; Michael, A.J. Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J. Biol. Chem. 2011, 286, 43301–43312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, J.; Li, R.; Raes, J.; Arumugam, M.; Burgdorf, K.S.; Manichanh, C.; Nielsen, T.; Pons, N.; Levenez, F.; Yamada, T.; et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010, 464, 59–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Llacer, J.L.; Polo, L.M.; Tavarez, S.; Alarcon, B.; Hilario, R.; Rubio, V. The gene cluster for agmatine catabolism of Enterococcus faecalis: Study of recombinant putrescine transcarbamylase and agmatine deiminase and a snapshot of agmatine deiminase catalyzing its reaction. J. Bacteriol. 2007, 189, 1254–1265. [Google Scholar] [CrossRef] [Green Version]
- Suarez, C.; Espariz, M.; Blancato, V.S.; Magni, C. Expression of the agmatine deiminase pathway in Enterococcus faecalis is activated by the AguR regulator and repressed by CcpA and PTS(Man) systems. PLoS ONE 2013, 8, e76170. [Google Scholar] [CrossRef] [Green Version]
- Wrzosek, L.; Miquel, S.; Noordine, M.L.; Bouet, S.; Joncquel Chevalier-Curt, M.; Robert, V.; Philippe, C.; Bridonneau, C.; Cherbuy, C.; Robbe-Masselot, C.; et al. Bacteroides thetaiotaomicron and Faecalibacterium prausnitzii influence the production of mucus glycans and the development of goblet cells in the colonic epithelium of a gnotobiotic model rodent. BMC Biol. 2013, 11, 61. [Google Scholar] [CrossRef] [Green Version]
- Delday, M.; Mulder, I.; Logan, E.T.; Grant, G. Bacteroides thetaiotaomicron Ameliorates Colon Inflammation in Preclinical Models of Crohn’s Disease. Inflamm. Bowel Dis. 2019, 25, 85–96. [Google Scholar] [CrossRef] [Green Version]
- Kelly, D.; Campbell, J.I.; King, T.P.; Grant, G.; Jansson, E.A.; Coutts, A.G.; Pettersson, S.; Conway, S. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nat. Immunol. 2004, 5, 104–112. [Google Scholar] [CrossRef]
- Mishra, V.; Banga, J.; Silveyra, P. Oxidative stress and cellular pathways of asthma and inflammation: Therapeutic strategies and pharmacological targets. Pharmacol. Ther. 2018, 181, 169–182. [Google Scholar] [CrossRef]
- Alsharairi, N.A. The Role of Short-Chain Fatty Acids in the Interplay between a Very Low-Calorie Ketogenic Diet and the Infant Gut Microbiota and Its Therapeutic Implications for Reducing Asthma. Int. J. Mol. Sci. 2020, 21, 9580. [Google Scholar] [CrossRef]
- Vangay, P.; Johnson, A.J.; Ward, T.L.; Al-Ghalith, G.A.; Shields-Cutler, R.R.; Hillmann, B.M.; Lucas, S.K.; Beura, L.K.; Thompson, E.A.; Till, L.M.; et al. US Immigration Westernizes the Human Gut Microbiome. Cell 2018, 175, 962–972.e10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valles-Colomer, M.; Falony, G.; Darzi, Y.; Tigchelaar, E.F.; Wang, J.; Tito, R.Y.; Schiweck, C.; Kurilshikov, A.; Joossens, M.; Wijmenga, C.; et al. The neuroactive potential of the human gut microbiota in quality of life and depression. Nat. Microbiol. 2019, 4, 623–632. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, K.; Kashiwagi, K. Characteristics of cellular polyamine transport in prokaryotes and eukaryotes. Plant. Physiol. Biochem. 2010, 48, 506–512. [Google Scholar] [CrossRef] [PubMed]
- Sakanaka, M.; Sugiyama, Y.; Kitakata, A.; Katayama, T.; Kurihara, S. Carboxyspermidine decarboxylase of the prominent intestinal microbiota species Bacteroides thetaiotaomicron is required for spermidine biosynthesis and contributes to normal growth. Amino Acids 2016, 48, 2443–2451. [Google Scholar] [CrossRef] [PubMed]
- Koropatkin, N.M.; Martens, E.C.; Gordon, J.I.; Smith, T.J. Starch catabolism by a prominent human gut symbiont is directed by the recognition of amylose helices. Structure 2008, 16, 1105–1115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gotoh, A.; Nara, M.; Sugiyama, Y.; Sakanaka, M.; Yachi, H.; Kitakata, A.; Nakagawa, A.; Minami, H.; Okuda, S.; Katoh, T.; et al. Use of Gifu Anaerobic Medium for culturing 32 dominant species of human gut microbes and its evaluation based on short-chain fatty acids fermentation profiles. Biosci. Biotechnol. Biochem. 2017, 81, 2009–2017. [Google Scholar] [CrossRef] [Green Version]
- Baumann, S.; Sander, A.; Gurnon, J.R.; Yanai-Balser, G.M.; Van Etten, J.L.; Piotrowski, M. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway. Virology 2007, 360, 209–217. [Google Scholar] [CrossRef] [Green Version]
- Hosoya, R.; Hamana, K. Distribution of two triamines, spermidine and homospermidine, and an aromatic amine, 2-phenylethylamine, within the phylum Bacteroidetes. J. Gen. Appl. Microbiol. 2004, 50, 255–260. [Google Scholar] [CrossRef] [Green Version]
- Hamana, K.; Itoh, T.; Benno, Y.; Hayashi, H. Polyamine distribution profiles of new members of the phylum Bacteroidetes. J. Gen. Appl. Microbiol. 2008, 54, 229–236. [Google Scholar] [CrossRef] [Green Version]
- Bell, S.C.; Turner, J.M. Bacterial catabolism of threonine. Threonine degradation initiated by l-threonine hydrolyase (deaminating) in a species of Corynebacterium. Biochem. J. 1977, 164, 579–587. [Google Scholar] [CrossRef] [Green Version]
- Nakada, Y.; Itoh, Y. Identification of the putrescine biosynthetic genes in Pseudomonas aeruginosa and characterization of agmatine deiminase and N-carbamoylputrescine amidohydrolase of the arginine decarboxylase pathway. Microbiology 2003, 149, 707–714. [Google Scholar] [CrossRef] [PubMed]
- Piotrowski, M.; Janowitz, T.; Kneifel, H. Plant C-N hydrolases and the identification of a plant N-carbamoylputrescine amidohydrolase involved in polyamine biosynthesis. J. Biol. Chem. 2003, 278, 1708–1712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, S.; Poonpairoj, P.; Ko, K.C.; Takatuska, Y.; Yamaguchi, Y.; Abe, N.; Kaneko, J.; Kamio, Y. Occurrence of agmatine pathway for putrescine synthesis in Selenomonas ruminatium. Biosci. Biotechnol. Biochem. 2008, 72, 445–455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekula, B.; Ruszkowski, M.; Malinska, M.; Dauter, Z. Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the Ultimate Step of Putrescine Biosynthesis in Plants. Front. Plant. Sci. 2016, 7, 350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugiyama, Y.; Nara, M.; Sakanaka, M.; Gotoh, A.; Kitakata, A.; Okuda, S.; Kurihara, S. Comprehensive analysis of polyamine transport and biosynthesis in the dominant human gut bacteria: Potential presence of novel polyamine metabolism and transport genes. Int. J. Biochem. Cell. Biol. 2017, 93, 52–61. [Google Scholar] [CrossRef]
- Nakada, Y.; Jiang, Y.; Nishijyo, T.; Itoh, Y.; Lu, C.D. Molecular characterization and regulation of the aguBA operon, responsible for agmatine utilization in Pseudomonas aeruginosa PAO1. J. Bacteriol. 2001, 183, 6517–6524. [Google Scholar] [CrossRef] [Green Version]
- Haas, D.; Matsumoto, H.; Moretti, P.; Stalon, V.; Mercenier, A. Arginine degradation in Pseudomonas aeruginosa mutants blocked in two arginine catabolic pathways. Mol. Gen. Genet. 1984, 193, 437–444. [Google Scholar] [CrossRef]
- Chou, H.T.; Kwon, D.H.; Hegazy, M.; Lu, C.D. Transcriptome analysis of agmatine and putrescine catabolism in Pseudomonas aeruginosa PAO1. J. Bacteriol. 2008, 190, 1966–1975. [Google Scholar] [CrossRef] [Green Version]
Strain | Description | Reference or Source |
---|---|---|
Escherichia coli | ||
BL21 (DE3) | Host for protein expression | Novagen |
S17-1 λpir | Donor host in bacterial conjugation (for RP4 oriT/oriR6K derivative plasmids) | National BioResource Project (NIG, Japan) |
MS108 | pMSK5/ S17-1 λpir | This study |
MS110 | pMSK6/ S17-1 λpir | This study |
MS821 | pMSK106/BL21(DE3) | This study |
Bacteroides thetaiotaomicron | ||
JCM5827T | Same strain as ATCC 29148T | Japan Collection of Microorganisms |
MS39 | ATCC 29148T except Δtdk, GmR | [46] |
MS123 | MS39 except Δncpah, GmR | This study |
MS140 | MS123 except att1::ncpah+, GmR, EmR | This study |
Plasmid | ||
pET23b | Plasmid for protein expression, ColE1 replicon, ApR | Novagen |
pExchange-tdk | Plasmid for gene disruption, RP4 oriT/oriR6K, tdk+, ApR, EmR | [46] |
pMSK5 | Plasmid for ncpah disruption, derivative of pExchange-tdk | This study |
pMSK6 | Plasmid for ncpah complementation, derivative of pNBU2-bla-ermGb | This study |
pMSK106 | C-terminal His6-tagged NCPAH expression plasmid, derivative of pET23b | This study |
pNBU2-bla-ermGb | Plasmid for gene complementation, RP4 oriT/oriR6K, ApR, EmR | [46] |
Primer | Nucleotide Sequence (5′-3′) |
---|---|
Pr-MS46 | TAACATTCGAGTCGAggtgtgatttattgaatacgcctg |
Pr-MS47 | AAATAATTATTCATCcgagcagaatcacaattaatcac |
Pr-MS48 | gatgaataattatttaatatgctactgaaatg |
Pr-MS49 | TATCGATACCGTCGAttcacattcaacggctgg |
Pr-MS50 | ATCTGTTTTTAAAGAatgaaaaagataaaagtaggattaatc |
Pr-MS51 | ACCGCGGTGGCGGCCgtttatttacggagctgccaac |
Pr-MS52 | TGATATCGAATTCCTtgatctggaagaagcaatg |
Pr-MS53 | tctttaaaaacagatttggagtg |
Pr-MS435 | AAGGAGATATACATAtgaaaaagataaaagtagga |
Pr-MS436 | GGTGGTGGTGCTCGAgatccaaaaaacgtttggtg |
Species | Optimal Temperature (°C) | Optimal pH | Km (mM) | kcat (s−1) | kcat/Km (mM−1 s−1) | References |
---|---|---|---|---|---|---|
Bacteroides thetaiotaomicron | 50 | 7.0 | 0.73 | 0.76 | 1.0 | This study |
Pseudomonas aeruginosa | 40 | 8.0 | 0.50 | 3.3 | 6.6 | [52] |
Selenomonas ruminatium | 45 | 7.0 | 0.22 | 0.18 | 0.81 | [54] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shimokawa, H.; Sakanaka, M.; Fujisawa, Y.; Ohta, H.; Sugiyama, Y.; Kurihara, S. N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota. Biomedicines 2023, 11, 1123. https://doi.org/10.3390/biomedicines11041123
Shimokawa H, Sakanaka M, Fujisawa Y, Ohta H, Sugiyama Y, Kurihara S. N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota. Biomedicines. 2023; 11(4):1123. https://doi.org/10.3390/biomedicines11041123
Chicago/Turabian StyleShimokawa, Hiromi, Mikiyasu Sakanaka, Yuki Fujisawa, Hirokazu Ohta, Yuta Sugiyama, and Shin Kurihara. 2023. "N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota" Biomedicines 11, no. 4: 1123. https://doi.org/10.3390/biomedicines11041123
APA StyleShimokawa, H., Sakanaka, M., Fujisawa, Y., Ohta, H., Sugiyama, Y., & Kurihara, S. (2023). N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota. Biomedicines, 11(4), 1123. https://doi.org/10.3390/biomedicines11041123