Phenylalanine and Tyrosine as Exogenous Precursors of Wheat (Triticum aestivum L.) Secondary Metabolism through PAL-Associated Pathways
Abstract
1. Introduction
2. Results
2.1. Free Phenylalanine and Tyrosine Content in Wheat
2.2. Phenolic Compound Content
2.3. Enzyme Activity
2.4. Gene Expression
3. Discussion
4. Materials and Methods
4.1. Triticum aestivum L. Cultivation and Experimental Design
4.2. Reagents
4.3. Tyrosine and Phenylalanine Assay
4.4. Phenolic Compound Assays
4.4.1. Total Catechins Content (TCC)
4.4.2. Total Proanthocyanidins (PAs) Content
4.4.3. Total Phenolic Content (TPC)
4.5. Assays of Enzyme Activities
4.5.1. PAL and TAL activity assays
4.5.2. Peroxidase Activity Assay
4.6. Gene Expression
4.7. Statistical analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
4CL—4-coumarate CoA ligase; |
ARF—ADP-ribosylation factor; |
C3H—p-coumaroyl shikimate/quinate 3′-hydroxylase; |
C4H—cinnamate 4-hydroxylase; |
CHI—chalcone isomerase; |
CHS—chalcone synthase; |
DFR—dihydroflavonol 4-reductase; |
F3H—Flavanone 3-hydroxylase; |
PAL—phenylalanine ammonia lyase; |
PCA—p-coumaric acid; |
POD—peroxidase; |
qRT-PCR—quantitative real-time PCR; |
TAL—tyrosine ammonia-lyase; |
TCA—trans-cinnamic acid. |
References
- Lien, G.; Hardaker, J.B.; Flaten, O. Risk and economic sustainability of crop farming systems. Agric. Syst. 2007, 94, 541–552. [Google Scholar] [CrossRef]
- Faraji, J. Wheat cultivar blends: A step forward to sustainable agriculture. Afr. J. Agric. Res. 2011, 6, 6780–6789. [Google Scholar] [CrossRef]
- Feizabady, A.Z. Effects of crop rotation and residue management on bread wheat. Afr. J. Plant Sci. 2013, 7, 176–184. [Google Scholar] [CrossRef]
- Ghasemzadeh, A.; Ghasemzadeh, N. Flavonoids and phenolic acids: Role and biochemical activity in plants and human. J. Med. Plant Res. 2011, 5, 6697–6703. [Google Scholar] [CrossRef]
- Keski-Saari, S. Phenolic Compounds in Birch Seedlings during Early Ontogeny: Regulation of Biosynthesis and Accumulation in Response to Nutrient Availability and Uv–B Radiation. Ph.D. Thesis, University Joensuu, Joensuu, Kuopio, Eastern Finland, Finland, 2005. [Google Scholar]
- Bonawitz, N.D.; Chapple, C. The genetics of lignin biosynthesis: Connecting genotype to phenotype. Annu. Rev. Genet. 2010, 44, 337–363. [Google Scholar] [CrossRef]
- Maeda, H.A. Lignin biosynthesis: Tyrosine shortcut in grasses. Nat. Plants 2016, 2, 1–2. [Google Scholar] [CrossRef]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef]
- Xu, C.; Arancon, R.A.D.; Labidi, J.; Luque, R. Lignin depolymerisation strategies: Towards valuable chemicals and fuels. Chem. Soc. Rev. 2014, 43, 7485–7500. [Google Scholar] [CrossRef]
- Fraser, C.M.; Chapple, C. The phenylpropanoid pathway in Arabidopsis. Arabidopsis Book. 2011, 9, e0152. [Google Scholar] [CrossRef]
- Rohde, A.; Morreel, K.; Ralph, J.; Goeminne, G.; Hostyn, V.; De Rycke, R.; Kushnir, S.; Van Doorsselaere, J.; Joseleau, J.-P.; Vuylsteke, M.; et al. Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. Plant Cell 2004, 16, 2749–2771. [Google Scholar] [CrossRef]
- Chen, F.; Srinivasa Reddy, M.S.; Temple, S.; Jackson, L.; Shadle, G.; Dixon, R.A. Multi-site genetic modulation of monolignol biosynthesis suggests new routes for formation of syringyl lignin and wall-bound ferulic acid in alfalfa (Medicago sativa L.). Plant J. 2006, 48, 113–124. [Google Scholar] [CrossRef] [PubMed]
- Vanholme, R.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin engineering. Curr. Opin. Plant Biol. 2008, 11, 278–285. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.P.; Matthews, M.L.; Williams, C.M.; Shi, R.; Yang, C.; Tunlaya-Anukit, S.; Chen, H.-C.; Li, Q.; Liu, J.; Lin, C.-Y.; et al. Improving wood properties for wood utilization through multi-omics integration in lignin biosynthesis. Nat. Commun. 2018, 9, 1579. [Google Scholar] [CrossRef] [PubMed]
- Shigeto, J.; Itoh, Y.; Hirao, S.; Ohira, K.; Fujita, K.; Tsutsumi, Y. Simultaneously disrupting AtPrx2, AtPrx25 and AtPrx71 alters lignin content and structure in Arabidopsis stem. J. Integr. Plant Biol. 2015, 57, 349–356. [Google Scholar] [CrossRef] [PubMed]
- Kong, J.Q. Phenylalanine ammonia-lyase, a key component used for phenylpropanoids production by metabolic engineering. RSC Adv. 2015, 5, 62587–62603. [Google Scholar] [CrossRef]
- Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef]
- Appert, C.J.; Amrhein, N. Kinetic analysis of the inhibition of phenylalanine ammonia-lyase by 2-aminoindan-2-phosphonic acid and other phenylalanine analogues. Phytochemistry 2003, 62, 415–422. [Google Scholar] [CrossRef]
- Barros, J.; Serrani-Yarce, J.C.; Chen, F.; Baxter, D.; Venables, B.J.; Dixon, R.A. Role of bifunctional ammonia-lyase in grass cell wall biosynthesis. Nat. Plants 2016, 2, 16050. [Google Scholar] [CrossRef]
- Shadle, G.L.; Wesley, S.V.; Korth, K.L.; Chen, F.; Lamb, C.; Dixon, R.A. Phenylpropanoid compounds and disease resistance in transgenic tobacco with altered expression of L-phenylalanine ammonia-lyase. Phytochemistry 2003, 64, 153–161. [Google Scholar] [CrossRef]
- Facchini, P.J.; St-Pierre, B. Synthesis and trafficking of alkaloid biosynthetic enzymes. Curr. Opin. Plant Biol. 2005, 8, 657–666. [Google Scholar] [CrossRef]
- Amthor, J.S. Efficiency of lignin biosynthesis: A quantitative analysis. Ann. Bot. 2003, 91, 673–695. [Google Scholar] [CrossRef] [PubMed]
- Dreßen, A.; Hilberath, T.; Mackfeld, U.; Billmeier, A.; Rudat, J.; Pohl, M. Phenylalanine ammonia lyase from Arabidopsis thaliana (AtPAL2): A potent MIO-enzyme for the synthesis of non-canonical aromatic alpha-amino acids: Part I: Comparative characterization to the enzymes from Petroselinum crispum (PcPAL1) and Rhodosporidium toruloides (RtPAL). J. Biotechnol. 2017, 258, 148–157. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Zheng, L. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef] [PubMed]
- Chubukov, V.; Uhr, M.; Le Chat, L.; Kleijn, R.J.; Jules, M.; Link, H.; Sauer, U. Transcriptional regulation is insufficient to explain substrate-induced flux changes in Bacillus subtilis. Mol Syst Biol. 2013, 9. [Google Scholar] [CrossRef]
- Seshasayee, A.S.; Fraser, G.M.; Babu, M.M.; Luscombe, N.M. Principles of transcriptional regulation and evolution of the metabolic system in E. coli. Genome Res. 2009, 19, 79–91. [Google Scholar] [CrossRef]
- Liu, J.; Osbourn, A.; Ma, P. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. Mol. Plant. 2015, 8, 689–708. [Google Scholar] [CrossRef]
- Bubna, G.A.; Lima, R.B.; Zanardo, D.Y.L.; Dos Santos, W.D.; Ferrarese, M.D.L.L.; Ferrarese-Filho, O. Exogenous caffeic acid inhibits the growth and enhances the lignification of the roots of soybean (Glycine max). J. Plant Physiol. 2011, 168, 1627–1633. [Google Scholar] [CrossRef]
- Lim, H.W.; Park, S.S.; Lim, C.J. Purification and properties of phenylalanine ammonia-lyase from leaf mustard. Mol. Cells 1997, 7, 715–720. [Google Scholar]
- Yin, R.; Messner, B.; Faus-Kessler, T.; Hoffmann, T.; Schwab, W.; Hajirezaei, M.R.; Schäffner, A.R. Feedback inhibition of the general phenylpropanoid and flavonol biosynthetic pathways upon a compromised flavonol-3-O-glycosylation. J. Exp. Bot. 2012, 63, 2465–2478. [Google Scholar] [CrossRef]
- Barros, J.; Dixon, R.A. Plant Phenylalanine/Tyrosine Ammonia-lyases. Trends Plant Sci. 2019, 25, 66–79. [Google Scholar] [CrossRef]
- Watts, K.T.; Mijts, B.N.; Lee, P.C.; Manning, A.J.; Schmidt-Dannert, C. Discovery of a substrate selectivity switch in tyrosine ammonia-lyase, a member of the aromatic amino acid lyase family. Chem. Biol. 2006, 13, 1317–1326. [Google Scholar] [CrossRef] [PubMed]
- Goldson-Barnaby, A.; Scaman, C.H. Purification and characterization of phenylalanine ammonia lyase from Trichosporon cutaneum. Enzym. Res. 2013. [Google Scholar] [CrossRef] [PubMed]
- Jun, S.Y.; Sattler, S.A.; Cortez, G.S.; Vermerris, W.; Sattler, S.E.; Kang, C. Biochemical and structural analysis of substrate specificity of a phenylalanine ammonia-lyase. Plant Physiol. 2018, 176, 1452–1468. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, L.S.; Ma, G.J.; Yang, C.C.; Lee, P.D. Cloning, expression, site-directed mutagenesis and immunolocalization of phenylalanine ammonia-lyase in Bambusa oldhamii. Phytochemistry 2010, 71, 1999–2009. [Google Scholar] [CrossRef]
- Faraji, M.; Fonseca, L.L.; Escamilla-Treviño, L.; Barros-Rios, J.; Engle, N.; Yang, Z.K.; Voit, E.O. Mathematical models of lignin biosynthesis. Biotechnol. Biofuels 2018, 11, 34. [Google Scholar] [CrossRef]
- Nguyen, T.N.; Son, S.; Jordan, M.C.; Levin, D.B.; Ayele, B.T. Lignin biosynthesis in wheat (Triticum aestivum L.): Its response to waterlogging and association with hormonal levels. BMC Plant Biol. 2016, 16, 28. [Google Scholar] [CrossRef]
- Vargas-Tah, A.; Gosset, G. Production of cinnamic and p-hydroxycinnamic acids in engineered microbes. Front. Bioeng. Biotech. 2015, 3, 116. [Google Scholar] [CrossRef]
- Barros, J.; Escamilla-Trevino, L.; Song, L.; Rao, X.; Serrani-Yarce, J.C.; Palacios, M.D.; Mittler, R. 4-Coumarate 3-hydroxylase in the lignin biosynthesis pathway is a cytosolic ascorbate peroxidase. Nat. Commun. 2019, 10, 1994. [Google Scholar] [CrossRef]
- Kärkönen, A.; Koutaniemi, S. Lignin biosynthesis studies in plant tissue cultures. J. Integr. Plant Biol. 2010, 52, 176–185. [Google Scholar] [CrossRef]
- Gondor, O.K.; Janda, T.; Soós, V.; Pál, M.; Majláth, I.; Adak, M.K.; Szalai, G. Salicylic acid induction of flavonoid biosynthesis pathways in wheat varies by treatment. Front. Plant Sci. 2016, 7, 1447. [Google Scholar] [CrossRef]
- Khlestkina, E.K.; Shoeva, O.Y.; Gordeeva, E.I. Flavonoid biosynthesis genes in wheat. Russ. J. Genet. Appl. Res. 2015, 5, 268–278. [Google Scholar] [CrossRef]
- Teixeira, W.F.; Fagan, E.B.; Soares, L.H.; Umburanas, R.C.; Reichardt, K.; Neto, D.D. Foliar and seed application of amino acids affects the antioxidant metabolism of the soybean crop. Front Plant Sci. 2017, 8, 327. [Google Scholar] [CrossRef]
- Miller, T.D. Growth stages of wheat. Better crops with plant food. PPI 1992, 76, 12. [Google Scholar]
- Wang, L.; Xu, R.; Hu, B.; Li, W.; Sun, Y.; Tu, Y.; Zeng, X. Analysis of free amino acids in Chinese teas and flower of tea plant by high performance liquid chromatography combined with solid-phase extraction. Food Chem. 2010, 123, 1259–1266. [Google Scholar] [CrossRef]
- Ma, X.; Zhao, D.; Li, X.; Meng, L. Chromatographic method for determination of the free amino acid content of chamomile flowers. Pharmacogn. Mag. 2015, 11, 176. [Google Scholar] [CrossRef] [PubMed]
- Feduraev, P.; Chupakhina, G.; Maslennikov, P.; Tacenko, N.; Skrypnik, L. Variation in Phenolic Compounds Content and Antioxidant Activity of Different Plant Organs from Rumex crispus L. and Rumex obtusifolius L. at Different Growth Stages. Antioxidants 2019, 8, 237. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Yao, K.; Jia, D.; Fan, H.; Liao, X.; Shi, B. Determination of total catechins in tea extracts by HPLC and spectrophotometry. Nat. Prod. Res. 2009, 23, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Maksimović, Z.; Malenčić, Đ.; Kovačević, N. Polyphenol contents and antioxidant activity of Maydis stigma extracts. Bioresour. Technol. 2005, 96, 873–877. [Google Scholar] [CrossRef]
- Padhi, E.M.; Liu, R.; Hernandez, M.; Tsao, R.; Ramdath, D.D. Total polyphenol content, carotenoid, tocopherol and fatty acid composition of commonly consumed Canadian pulses and their contribution to antioxidant activity. J. Funct. Foods 2017, 38, 602–611. [Google Scholar] [CrossRef]
- Cheng, G.W.; Breen, P.J. Activity of phenylalanine ammonia-lyase (PAL) and concentrations of anthocyanins and phenolics in developing strawberry fruit. J. Am. Soc. Hortic. Sci. 1991, 116, 865–869. [Google Scholar] [CrossRef]
- Rösler, J.; Krekel, F.; Amrhein, N.; Schmid, J. Maize phenylalanine ammonia-lyase has tyrosine ammonia-lyase activity. Plant Physiol. 1997, 113, 175–179. [Google Scholar] [CrossRef] [PubMed]
- Malik, C.P.; Singh, M.B. Plant Enzymology and Histoenzymology: A Text Manual; Kalyani Publications: New Delhi, India, 1980; p. 50. [Google Scholar]
- Bradford, M.M. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Ermilova, E.V.; Zalutskaya, Z.M.; Nikitin, M.M.; Lapina, T.V.; Fernández, E. Regulation by light of ammonium transport systems in Chlamydomonas reinhardtii. Plant Cell Environ. 2010, 33, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
- National Center for Biotechnology Information. Available online: http://www.ncbi.nlm.nih.gov (accessed on 5 April 2020).
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hong, M.J.; Yoon, Y.H.; Kim, D.S.; Kim, S.H.; Kang, S.Y.; Kim, D.Y.; Kim, J.B. Phenotypic and molecular responses of wheat (Triticum aestivum L.) to chronic gamma irradiation. J. Agric. Sci. Technol. 2018, 20, 167–178. [Google Scholar] [CrossRef]
Lignin-Related Genes | ||
Primer | Sequence (5′-3′) | |
PAL6 | PAL6-F | CTCAAGCTCATGTCCTCCACA |
PAL6-R | TCAGCACCTTCTTCGACACC | |
C3H1 | C3H1-F | GGCTGTGTCCACTTAATG |
C3H1-R | TGTCATCACTAAGGTCATAC | |
C4H1 | C4H1-F | CAGCCTCCACATCCTCAAG |
C4H1-R | CTTAGGACGAGCGAACAATC | |
4CL1 | 4CL1-F | CACTCAGCCAGCCAGCAG |
4CL1-R | ACATTACACAAGCAGGAAGAACC | |
Phenolic Compound-Related Genes | ||
CHS | CHS-F | CTCATGATGTATCAGCAGG |
CHS-R | ACATCCTTGAGGTGGAA | |
CHI | CHI-F | GCAGTACTCGGACAAGGTGA |
CHI-R | GTTCGTTCACACCGAAACC | |
F3H | F3H-F | CCTACTTCTCGTACCCGGTG |
F3H-R | GAACGTCGCGATCGACAG | |
DFR | DFR-F | TGCTGGAGCTTCCCGGAGC |
DFR-R | CGTGGGGATGATGCTGATGA | |
Reference Genes | ||
Actin | ACT-F | GCCACACTGTTCCAATCTATGA |
ACT-R | TGATGGAATTGTATGTCGCTTC | |
ARF | ARF-F | CTGACGCCGAGGATATCCA |
ARF-R | GCCTTGACCATACCAGTTCCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feduraev, P.; Skrypnik, L.; Riabova, A.; Pungin, A.; Tokupova, E.; Maslennikov, P.; Chupakhina, G. Phenylalanine and Tyrosine as Exogenous Precursors of Wheat (Triticum aestivum L.) Secondary Metabolism through PAL-Associated Pathways. Plants 2020, 9, 476. https://doi.org/10.3390/plants9040476
Feduraev P, Skrypnik L, Riabova A, Pungin A, Tokupova E, Maslennikov P, Chupakhina G. Phenylalanine and Tyrosine as Exogenous Precursors of Wheat (Triticum aestivum L.) Secondary Metabolism through PAL-Associated Pathways. Plants. 2020; 9(4):476. https://doi.org/10.3390/plants9040476
Chicago/Turabian StyleFeduraev, Pavel, Liubov Skrypnik, Anastasiia Riabova, Artem Pungin, Elina Tokupova, Pavel Maslennikov, and Galina Chupakhina. 2020. "Phenylalanine and Tyrosine as Exogenous Precursors of Wheat (Triticum aestivum L.) Secondary Metabolism through PAL-Associated Pathways" Plants 9, no. 4: 476. https://doi.org/10.3390/plants9040476
APA StyleFeduraev, P., Skrypnik, L., Riabova, A., Pungin, A., Tokupova, E., Maslennikov, P., & Chupakhina, G. (2020). Phenylalanine and Tyrosine as Exogenous Precursors of Wheat (Triticum aestivum L.) Secondary Metabolism through PAL-Associated Pathways. Plants, 9(4), 476. https://doi.org/10.3390/plants9040476