Dynamic Changes of Ascorbic Acid, Phenolics Biosynthesis and Antioxidant Activities in Mung Beans (Vigna radiata) until Maturation
Abstract
1. Introduction
2. Results
2.1. Ascorbic Acid in Mung Beans during Legume Development
2.2. Phenolics in Mung Beans during Legume Development
2.3. Dynamic Changes of Antioxidant Activity in Mung Beans during Legume Development
3. Materials and Methods
3.1. Sample Collection
3.2. Chemical and Reagents
3.3. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR Analysis
3.4. Phenolics Extraction and Determination of Total Phenolic Content (TPC)
3.5. Determination of Phenolics and Ascorbic Acid by High-Performance Liquid Chromatography (HPLC)
3.6. Determination of Antioxidant Activity
3.7. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Genkinger, J.M.; Platz, E.A.; Hoffman, S.C.; Comstock, G.W.; Helzlsouer, K.J. Fruit, vegetable, and antioxidant intake and all-cause, cancer, and cardiovascular disease mortality in a community-dwelling population in Washington County, Maryland. Am. J. Epidemiol. 2004, 160, 1223–1233. [Google Scholar] [CrossRef] [PubMed]
- Freedman, N.D.; Park, Y.; Subar, A.F.; Hollenbeck, A.R.; Leitzmann, M.F.; Schatzkin, A.; Abnet, C.C. Fruit and vegetable intake and head and neck cancer risk in a large United States prospective cohort study. Int. J. Cancer 2008, 122, 2330–2336. [Google Scholar] [CrossRef] [PubMed]
- Dahiya, P.K.; Linnemann, A.R.; Van Boekel, M.A.J.S.; Khetarpaul, N.; Grewal, R.B.; Nout, M.J.R. Mung Bean: Technological and Nutritional Potential. Crit. Rev. Food Sci. Nutr. 2015, 55, 670–688. [Google Scholar] [CrossRef] [PubMed]
- Burton-Freeman, B.M.; Sandhu, A.K.; Edirisinghe, I. Mangos and their bioactive components: Adding variety to the fruit plate for health. Food Funct. 2017, 8, 3010–3032. [Google Scholar] [CrossRef] [PubMed]
- Ganesan, K.; Xu, B. A critical review on phytochemical profile and health promoting effects of mung bean (Vigna radiata). Food Sci. Hum. Wellness 2017, 7, 11–33. [Google Scholar] [CrossRef]
- Padayatty, S.J.; Katz, A.; Wang, Y.; Eck, P.; Kwon, O.; Lee, J.H.; Chen, S.; Corpe, C.; Dutta, A.; Dutta, S.K. Vitamin C as an Antioxidant: Evaluation of Its Role in Disease Prevention. J. Am. Coll. Nutr. 2003, 22, 18–35. [Google Scholar] [CrossRef]
- Lado, J.; Alos, E.; Rodrigo, M.J.; Zacarias, L. Light avoidance reduces ascorbic acid accumulation in the peel of Citrus fruit. Plant Sci. 2015, 231, 138–147. [Google Scholar] [CrossRef]
- Smirnoff, N. Vitamin C: The Metabolism and Functions of Ascorbic Acid in Plants. Adv. Bot. Res. 2011, 59, 107–177. [Google Scholar]
- Amparo Asensi-Fabado, M.; Munne-Bosch, S. Vitamins in plants: Occurrence, biosynthesis and antioxidant function. Trends Plant Sci. 2010, 15, 582–592. [Google Scholar] [CrossRef]
- Hancock, R.D.; Viola, R. Biosynthesis and catabolism of L-ascorbic acid in plants. Crit. Rev. Plant Sci. 2005, 24, 167–188. [Google Scholar] [CrossRef]
- Ishikawa, T.; Dowdle, J.; Smirnoff, N. Progress in manipulating ascorbic acid biosynthesis and accumulation in plants. Physiol. Plant. 2007, 129, 343–355. [Google Scholar] [CrossRef]
- Valpuesta, V.; Botella, M.A. Biosynthesis of L-ascorbic acid in plants: New pathways for an old antioxidant. Trends Plant Sci. 2004, 9, 573–577. [Google Scholar] [CrossRef] [PubMed]
- Tabata, K.; Takaoka, T.; Esaka, M. Gene expression of ascorbic acid-related enzymes in tobacco. Phytochemistry 2002, 61, 631–635. [Google Scholar] [CrossRef]
- Zhang, G.-Y.; Liu, R.-R.; Zhang, C.-Q.; Tang, K.-X.; Sun, M.-F.; Yan, G.-H.; Liu, Q.-Q. Manipulation of the Rice L-Galactose Pathway: Evaluation of the Effects of Transgene Overexpression on Ascorbate Accumulation and Abiotic Stress Tolerance. PLoS ONE 2015, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Yabuta, Y.; Mieda, T.; Rapolu, M.; Nakamura, A.; Motoki, T.; Maruta, T.; Yoshimura, K.; Ishikawa, T.; Shigeoka, S. Light regulation of ascorbate biosynthesis is dependent on the photosynthetic electron transport chain but independent of sugars in Arabidopsis. J. Exp. Bot. 2007, 58, 2661–2671. [Google Scholar] [CrossRef] [PubMed]
- Bulley, S.; Laing, W. The regulation of ascorbate biosynthesis. Curr. Opin. Plant Biol. 2016, 33, 15–22. [Google Scholar] [CrossRef]
- Ghasemzadeh, A.; Ghasemzadeh, N. Flavonoids and phenolic acids: Role and biochemical activity in plants and human. J. Med. Plants Res. 2011, 5, 6697–6703. [Google Scholar] [CrossRef]
- Cheynier, V.; Comte, G.; Davies, K.M.; Lattanzio, V.; Martens, S. Plant phenolics: Recent advances on their biosynthesis, genetics, and ecophysiology. Plant Physiol. Biochem. 2013, 72, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Hoang, V.L.T.; Innes, D.J.; Shaw, P.N.; Monteith, G.R.; Gidley, M.J.; Dietzgen, R.G. Sequence diversity and differential expression of major phenylpropanoid-flavonoid biosynthetic genes among three mango varieties. BMC Genom. 2015, 16, 1–12. [Google Scholar] [CrossRef]
- Jung, W.; Yu, O.; Lau, S.M.C.; O’Keefe, D.P.; Odell, J.; Fader, G.; McGonigle, B. Identification and expression of isoflavone synthase, the key enzyme for biosynthesis of isoflavones in legumes. Nat. Biotechnol. 2000, 18, 208–212. [Google Scholar] [CrossRef] [PubMed]
- Alhagdow, M.; Mounet, F.; Gilbert, L.; Nunes-Nesi, A.; Garcia, V.; Just, D.; Petit, J.; Beauvoit, B.; Fernie, A.R.; Rothan, C.; et al. Silencing of the mitochondrial ascorbate synthesizing enzyme L-galactono-1,4-lactone dehydrogenase affects plant and fruit development in tomato. Plant Physiol. 2007, 145, 1408–1422. [Google Scholar] [CrossRef] [PubMed]
- Paradiso, A.; de Pinto, M.C.; Locato, V.; De Gara, L. Galactone-gamma-lactone-dependent ascorbate biosynthesis alters wheat kernel maturation. Plant Biol. 2012, 14, 652–658. [Google Scholar] [CrossRef]
- Pinto, M.C.; Paradiso, A.; Leonetti, P.; De Gara, L. Hydrogen peroxide, nitric oxide and cytosolic ascorbate peroxidase at the crossroad between defence and cell death. Plant J. 2006, 48, 784–795. [Google Scholar] [CrossRef] [PubMed]
- Oboh, G. Antioxidant properties of some commonly consumed and underutilized tropical legumes. Eur. Food Res. Technol. 2006, 224, 61–65. [Google Scholar] [CrossRef]
- Wang, L.; Wang, H.; Lai, Q.; Li, T.; Fu, X.; Guo, X.; Liu, R.H. The dynamic changes of ascorbic acid, tocopherols and antioxidant activity during germination of soya bean (Glycine max). Int. J. Food Sci. Technol. 2015, 50, 2367–2374. [Google Scholar] [CrossRef]
- Guo, X.; Li, T.; Tang, K.; Liu, R.H. Effect of Germination on Phytochemical Profiles and Antioxidant Activity of Mung Bean Sprouts (Vigna radiata). J. Agric. Food Chem. 2012, 60, 11050–11055. [Google Scholar] [CrossRef] [PubMed]
- Urzica, E.I.; Adler, L.N.; Page, M.D.; Linster, C.L.; Arbing, M.A.; Casero, D.; Pellegrini, M.; Merchant, S.S.; Clarke, S.G. Impact of Oxidative Stress on Ascorbate Biosynthesis in Chlamydomonas via Regulation of the VTC2 Gene Encoding a GDP-L-galactose Phosphorylase. J. Biol. Chem. 2012, 287, 14234–14245. [Google Scholar] [CrossRef] [PubMed]
- Shi, Z.; Yang, Y.; Zhu, Y.; Ren, G. Nutritional composition and antioxidant activity of twenty mung bean cultivars in China. Crop J. 2016, 4, 398–406. [Google Scholar] [CrossRef]
- Randhir, R.; Lin, Y.T.; Shetty, K. Stimulation of phenolics, antioxidant and antimicrobial activities in dark germinated mung bean sprouts in response to peptide and phytochemical elicitors. Process Biochem. 2004, 39, 637–646. [Google Scholar] [CrossRef]
- Butsat, S.; Weerapreeyakul, N.; Siriamornpun, S. Changes in Phenolic Acids and Antioxidant Activity in Thai Rice Husk at Five Growth Stages during Grain Development. J. Agric. Food Chem. 2009, 57, 4566–4571. [Google Scholar] [CrossRef]
- Weidner, S.; Amarowicz, R.; Karamac, M.; Fraczek, E. Changes in endogenous phenolic acids during development of Secale cereale caryopses and after dehydration treatment of unripe rye grains. Plant Physiol. Biochem. 2000, 38, 595–602. [Google Scholar] [CrossRef]
- McKeehen, J.D.; Busch, R.H.; Fulcher, R.G. Evaluation of wheat (Triticum aestivum L.) phenolic acids during grain development and their contribution to Fusarium resistance. J. Agric. Food Chem. 1999, 47, 1476–1482. [Google Scholar] [CrossRef]
- Bustamante-Rangel, M.; Milagros Delgado-Zamarreno, M.; Perez-Martin, L.; Rodriguez-Gonzalo, E.; Dominguez-Alvarez, J. Analysis of Isoflavones in Foods. Compr. Rev. Food Sci. Food Saf. 2018, 17, 391–411. [Google Scholar] [CrossRef]
- Meenu, M.; Kamboj, U.; Sharma, A.; Guha, P.; Mishra, S. Green method for determination of phenolic compounds in mung bean (Vigna radiata L.) based on near-infrared spectroscopy and chemometrics. Int. J. Food Sci. Technol. 2016, 51, 2520–2527. [Google Scholar] [CrossRef]
- Tsao, R. Chemistry and Biochemistry of Dietary Polyphenols. Nutrients 2010, 2, 1231–1246. [Google Scholar] [CrossRef] [PubMed]
- Oufedjikh, H.; Mahrouz, M.; Amiot, M.J.; Lacroix, M. Effect of gamma-irradiation on phenolic compounds and phenylalanine ammonia-lyase activity during storage in relation to peel injury from peel of Citrus clementina Hort. ex. Tanaka. J. Agric. Food Chem. 2000, 48, 559–565. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Zheng, H.; Sheng, K.; Liu, W.; Zheng, L. Effects of postharvest UV-C irradiation on phenolic acids, flavonoids, and key phenylpropanoid pathway genes in tomato fruit. Sci. Hortic. 2018, 241, 107–114. [Google Scholar] [CrossRef]
- Yu, O.; McGonigle, B. Metabolic engineering of isoflavone biosynthesis. In Advances in Agronomy; Sparks, D.L., Ed.; Elsevier Academic Press Inc: San Diego, CA, USA, 2005; Volume 86, pp. 147–190. [Google Scholar]
- Huang, D.J.; Ou, B.X.; Hampsch-Woodill, M.; Flanagan, J.A.; Prior, R.L. High-throughput assay of oxygen radical absorbance capacity (ORAC) using a multichannel liquid handling system coupled with a microplate flourescence reader in 96-well format. J. Agric. Food Chem. 2002, 50, 4437–4444. [Google Scholar] [CrossRef]
- Zia-Ul-Haq, M.; Amarowicz, R.; Ahmad, S.; Qayum, M.; Ercisli, S. Antioxidant Potential of Mungbean Cultivars Commonly Consumed in Pakistan. Oxid. Commun. 2013, 36, 15–25. [Google Scholar]
- Yoo, K.M.; Lee, K.W.; Park, J.B.; Lee, H.J.; Hwang, I.K. Variation in major antioxidants and total antioxidant activity of yuzu (Citrus junos Sieb ex Tanaka) during maturation and between cultivars. J. Agric. Food Chem. 2004, 52, 5907–5913. [Google Scholar] [CrossRef]
- Anwar, F.; Latif, S.; Przybylski, R.; Sultana, B.; Ashraf, M. Chemical composition and antioxidant activity of seeds of different cultivars of mungbean. J. Food Sci. 2007, 72, S503–S510. [Google Scholar] [CrossRef] [PubMed]
- Atala, E.; Vasquez, L.; Speisky, H.; Lissi, E.; Lopez-Alarcon, C. Ascorbic acid contribution to ORAC values in berry extracts: An evaluation by the ORAC-pyrogallol red methodology. Food Chem. 2009, 113, 331–335. [Google Scholar] [CrossRef]
- Guo, R.; Guo, X.; Li, T.; Fu, X.; Liu, R.H. Comparative assessment of phytochemical profiles, antioxidant and antiproliferative activities of Sea buckthorn (Hippophae rhamnoides L.) berries. Food Chem. 2017, 221, 997–1003. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wang, J.; Guo, X.; Brennan, C.S.; Li, T.; Fu, X.; Chen, G.; Liu, R.H. Effect of germination on lignan biosynthesis, and antioxidant and antiproliferative activities in flaxseed (Linum usitatissimum L.). Food Chem. 2016, 205, 170–177. [Google Scholar] [CrossRef]
Composition | 5 DAF | 8 DAF | 11 DAF | 14 DAF | 17 DAF |
---|---|---|---|---|---|
Daidzein | 18.62 ± 0.31 b | 12.12 ± 1.69 c | 7.73 ± 0.36 d | 9.45 ± 0.29 c,d | 25.82 ± 3.47 a |
Glycitin | 187.3 ± 42.1 a | 172.3 ± 17.1 a | 111.9 ± 8.7 b | 76.53 ± 5.21 b | 105.1 ± 9.0 b |
Gallic acid | 139.4 ± 52.0 a | 135.9 ± 46.6 a | 141.0 ± 52.6 a | 219.2 ± 34.4 a | 174.3 ± 89.4 a |
Total phenolics | 362.1 ± 18.9 a | 346.0 ± 5.5 a | 364.5 ± 39.6 a | 312.8 ± 37.8 a,b | 286.6 ± 2.1 b |
Gene Name | GeneBank ID | Prime Direction | Primer Sequence 5′ to 3′ |
---|---|---|---|
VrPAL | AB858431.1 | Forward primer | CAACAACGGTCTGCCTTCAA |
Reward primer | TCTTGGTTGTGTTGCTCAGC | ||
VrC4H | NM_001317148.1 | Forward primer | AGAAGACCCTCTGTTCCAGC |
Reward primer | TAGTGCTCTTCGTGCTTCCA | ||
Vr4CL | XM_014654045.2 | Forward primer | GAGGCCACAGAGAGAACCAT |
Reward primer | CTCCCGCAGCTTCATCTTTC | ||
VrCHS | KP164978.1 | Forward primer | TGTGCTTGTCGTGTGTTCTG |
Reward primer | GCAGTCCAAACGAGCTCAAA | ||
VrCHR | XM_014648050.2 | Forward primer | ATGGCTGCTGTCGAAATTCC |
Reward primer | CAGCAGCAGTGTCAAAGTGT | ||
VrCHI | NM_001317294.1 | Forward primer | GCAGCCATTGAACAGTTTGC |
Reward primer | TCTCCAATACTGCAGCCGAT | ||
VrIFS | AF195807.1 | Forward primer | ATAGCTCAGTGGCCATGGTT |
Reward primer | AAGCTCCTCGGTCAAGTCAA | ||
VrIFR | XM_014664599.2 | Forward primer | TGTTGAATGGCAGCGAAGAG |
Reward primer | GCTCCAGAGGTCTTGAAGGT | ||
VrDFR | XM_014637804.1 | Forward primer | GACAGAGAAGGCAGTGCTTG |
Reward primer | CTGGCCACATCATCCACATG | ||
VrPMM | XM_014642393.2 | Forward primer | CCATTGCATTCTTGTCACGC |
Reward primer | AGGTTTCTGGGCAGCCATTA | ||
VrGMP | XM_014649580.2 | Forward primer | GCAGTTGTGGATTCCGACTC |
Reward primer | CGTTAGTGGCCTCAACCTTG | ||
VrGME | XM_014663397.2 | Forward primer | TACTGGCCCACTGAAAAGCT |
Reward primer | TCCACCCATATCAGCAGCAA | ||
VrVTC2 | XM_014668416.1 | Forward primer | GAAGAACGCATGCAGAGAGG |
Reward primer | CATTGTCGCTAGCCTCCAAC | ||
VrVTC4 | XM_014638972.2 | Forward primer | GTCTTCTCAGCTGGAACCCT |
Reward primer | GCCACCGTCGGAAACTTATC | ||
VrGalDH | XM_014650586.2 | Forward primer | GCTTGTAGGCATGAAGTCCG |
Reward primer | AAGTAAACAGCGGGAGTGGA | ||
VrGLDH | XM_022784598.1 | Forward primer | AGTCCCTTGAGTCCTGCTTC |
Reward primer | AGCCCAGTGTTCAAATGCAG | ||
VrAO | XM_014648870.2 | Forward primer | CCACTGCCATTCTTCGCTAC |
Reward primer | TCCGTATCTCTGTTTGCCGT | ||
VrGalUR | XM_014647041.2 | Forward primer | AGCAGTTGAACTTGGCCTTG |
Reward primer | TCCACACACCCTTCACATCA | ||
VrDHAR | XM_014639262.2 | Forward primer | AAGGCCATTTTCTCGAGGGA |
Reward primer | TGTTCCTCGGCGGTATAGTC | ||
VrMDAR | XM_014654624.2 | Forward primer | CACAATGGCCGCGATATCAA |
Reward primer | TGGTCACAATACAGAGGCGT | ||
VrAPX | XM_014638724.2 | Forward primer | GGCTGCTCAAACTTCCAACA |
Reward primer | CGCCGCAGTAACTACAACTC | ||
VrGulO | XM_014648433.2 | Forward primer | TTTCGCACACCATTCCCAAG |
Reward primer | CCACCAAGCTGAACCCTCTA | ||
VrMIPS | EU239689.2 | Forward primer | CCACTTGTTCCACCCAGTTG |
Reward primer | CCCGGAAAACATTCAAGCCA | ||
VrGR | XM_014658926.2 | Forward primer | ATTGCCTTGGAGTTTGCTGG |
Reward primer | ACCATCAGCTGACTTCGTGA | ||
VrPMI | XM_014642277.2 | Forward primer | GGTTCTTCGCAAATGGGGTT |
Reward primer | CACCCTTGAGCTCCTTGAGA | ||
VrACT | XM_014638363.2 | Forward primer | ACCACAGCTGAGCGAGAAAT |
Reward primer | ATCATGGATGGCTGGAAGAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, Y.; Chang, X.; Guo, X. Dynamic Changes of Ascorbic Acid, Phenolics Biosynthesis and Antioxidant Activities in Mung Beans (Vigna radiata) until Maturation. Plants 2019, 8, 75. https://doi.org/10.3390/plants8030075
Lu Y, Chang X, Guo X. Dynamic Changes of Ascorbic Acid, Phenolics Biosynthesis and Antioxidant Activities in Mung Beans (Vigna radiata) until Maturation. Plants. 2019; 8(3):75. https://doi.org/10.3390/plants8030075
Chicago/Turabian StyleLu, Yanyan, Xiaoxiao Chang, and Xinbo Guo. 2019. "Dynamic Changes of Ascorbic Acid, Phenolics Biosynthesis and Antioxidant Activities in Mung Beans (Vigna radiata) until Maturation" Plants 8, no. 3: 75. https://doi.org/10.3390/plants8030075
APA StyleLu, Y., Chang, X., & Guo, X. (2019). Dynamic Changes of Ascorbic Acid, Phenolics Biosynthesis and Antioxidant Activities in Mung Beans (Vigna radiata) until Maturation. Plants, 8(3), 75. https://doi.org/10.3390/plants8030075