Next Article in Journal
Natural Products for Melanoma Therapy: From Traditional Medicine to Modern Drug Discovery
Next Article in Special Issue
The Targeted Metabolomic Signatures of Phytohormones in Leaves of Mulberry (Morus alba L.) Are Crucial for Regrowth and Specifically Modulated by the Differential Stubble Lengths
Previous Article in Journal
‘BRS Vitoria’ Grapes Across Four Production Cycles: Morphological, Mineral, and Phenolic Changes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Characterization of MaSPL8 Reveals Its Different Roles in Biotic and Abiotic Stress Responses in Mulberry

1
Jiangsu Key Laboratory of Sericultural Biology and Biotechnology, School of Biotechnology, Jiangsu University of Science and Technology, Zhenjiang 212100, China
2
Key Laboratory of Silkworm and Mulberry Genetic Improvement, Ministry of Agriculture and Rural Affairs, Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang 212100, China
*
Authors to whom correspondence should be addressed.
Plants 2025, 14(6), 950; https://doi.org/10.3390/plants14060950
Submission received: 20 February 2025 / Revised: 8 March 2025 / Accepted: 11 March 2025 / Published: 18 March 2025

Abstract

The Squamosa promoter-binding protein-like (SPL) family proteins plays pivotal roles in plant development and stress adaptation. In this study, we functionally characterized MaSPL8 in mulberry (Morus alba) and investigated its regulatory roles in biotic and abiotic stress responses. MaSPL8 encodes a 364-amino acid protein with a conserved SBP domain and lacks miR156/157 binding sites. Phylogenetic analysis confirmed its orthology to Arabidopsis AtSPL8, albeit with functional divergence. Downregulation of MaSPL8 via virus-induced gene silencing (VIGS) resulted in more susceptibility to Ciboria shiraiana infection, but significantly enhanced resistance to drought and salt stress, as evidenced by reduced oxidative damage, elevated proline accumulation, and increased antioxidant enzyme activities. Transcriptomic profiling of MaSPL8-silenced plants revealed enrichment of differentially expressed genes (DEGs) in brassinosteroid biosynthesis, jasmonic acid metabolism, and oxidative stress responses, suggesting hormone signaling interplay. Furthermore, bioinformatic predictions identified miR5658 and miR4221 as potential post-transcriptional regulators of MaSPL8. This study highlights MaSPL8 as a negative regulator of abiotic stress tolerance and positive regulator of biotic (C. shiraiana) stress tolerance in mulberry and provides insights into its integration with phytohormone pathways. Our findings underscore the evolutionary plasticity of SPL8 genes and propose MaSPL8 as a target for enhancing mulberry’s resilience in challenging environments.

1. Introduction

Squamosa promoter-binding protein-like (SPL) proteins constitute a diverse plant-specific transcription factor family and are recognized as key regulators of plant growth and development [1]. These proteins are defined by a highly conserved SBP domain, composed of 78 amino acid residues that form two structural motifs: a bipartite nuclear localization signal (NLS) and a zinc finger motif containing two Zn2+-binding sites (Cys-Cys-His-Cys and Cys-Cys-Cys-His) [2,3]. The SBP domain facilitates dual functions: nuclear import via the NLS and sequence-specific DNA binding to the GTAC core motif in target promoters [4,5].
SPL genes are found in all green plants, including green algae, mosses, ferns, gymnosperms, and angiosperms [2,5]. The first two SPL genes, AmSBP1 and AmSBP2, were found in Antirrhinum majus and proved to be involved in the control of early flower development by binding to the promoter of the floral meristem identity gene SQUAMOSA (SQUA) [6]. The SPL gene family has been identified in various plant species including Arabidopsis thaliana (At), Oryza sativa (Os), Zea may (Zm), Citrus Clementina (Cc), Populus trichocarpa (Ptr), and Triticum aestivum (Ta) [2,7,8,9,10,11,12,13]. Phylogenetic analyses classify SPL genes into five to ten clades, reflecting lineage-specific diversification during evolution [2,8,12,14]. Functionally, SPLs are divided into two types based on the presence or absence of miR156/157 binding sites [15]. miR156/157 are core regulators targeting most SPLs including Arabidopsis AtSPL3/4/5/9/10 and rice OsSPL14, controlling phase transition, tillering, root development, and panicle development [15,16,17], while non-canonical regulators such as maize SPLs may interact with miR529/535. Bioinformatic analyses suggest that SPL in maize might have binding sites for miR529 or miR535 [18,19]. miR529 is evolutionarily related to the miR156 family and modulates drought responses in maize [19,20]. Beyond plant development, SPL genes such as peanut (Arachis hypogaea L.) AhSPL5 and wheat TaSPL6 also affected plant resistance to abiotic stresses such as drought and salt stresses [21,22].
SPL8 belongs to the Group III clade based on the classification in Arabidopsis, which is conserved in both monocots and dicots but shows functional divergence [10,23]. Unlike most SPLs, SPL8 lacks miR156/157 binding sites but is potentially regulated by miR529/535 in maize [18]. In A. thaliana, AtSPL8 regulates reproductive development, including megasporogenesis, trichome patterning, and male fertility [15,24,25,26]. Functional parallels and contrasts exist across species. Medicago sativa MsSPL8 regulated phase transition and inflorescence development via SEPALLATA3 (SEP3) and MADS32 activation and MsSPL8 suppression improves biomass yield and stress tolerance [27]. Similarly, Codonopsis pilosula CpSPL8 negatively regulates salt resistance by repressing the CpSOS2 pathway [28]. Notably, SPL8 intersects with phytohormone signaling to balance development and stress adaptation. For example, AtSPL8 synergizes with gibberellin signaling during anther development and interacts with brassinosteroid-associated BIM1 to regulate fertility [26,29]. Intriguingly, altering the expression levels of the SPL8 gene in Medicago truncatula has been shown to influence the gibberellic acid (GA) content within the plant. GA levels were significantly elevated in Mtspl8 mutant plants, whereas they were reduced in the MtSPL8 overexpression plants, suggesting crosstalk between SPL8 and GA signaling [27,30].
Mulberry (Morus spp.) is a plant of great economic and ecological importance, serving as a cornerstone of sericulture. Its fruits are rich in bioactive compounds, making them valuable in the food and pharmaceutical industries [31,32]. Additionally, mulberry plays a vital role in environmental protection and ecological restoration and is commonly used for windbreaks, soil conservation, and heavy metal remediation [33,34]. Understanding its functional genes is crucial for improving stress resistance, optimizing cultivation strategies, and advancing industrial applications. Preliminary genome-wide analyses have identified multiple SPL homologs in Morus notabilis, but functional studies are scarce [35]. Most SPL genes in mulberry remain underexplored. Our previous study identified MaSPL8 as a sclerotiniose-responsive gene (SRG) during C. shiraiana infection [36]. Here, we further demonstrate that MaSPL8 acts as a negative regulator of resistance to biotic (C. shiraiana) and abiotic (drought, salinity) stresses. Additionally, we reveal its potential interplay with brassinosteroid and jasmonic acid signaling. Given mulberry’s ecological resilience, deciphering the roles of SPL8 in this species could unlock strategies for enhancing stress tolerance and biomass production.

2. Results

2.1. Molecular Cloning and Characterization of MaSPL8 in Mulberry

MaSPL8 was cloned from Morus alba and further bioinformatic characterization of MaSPL8 was performed. The coding sequence (CDS) of MaSPL8 spans 1095 bp, encoding a 364-amino acid protein. Phylogenetic analysis demonstrated that MaSPL8 is the ortholog of A. thaliana AtSPL8 (Figure 1A). Conserved motif analysis revealed that MaSPL8 shares identical motif composition and arrangement with SPL8 homologs from other dicots (Figure 1B). Sequence alignment further confirmed the presence of an SBP domain in MaSPL8 and reference SPL8 proteins, with conserved Zn1/Zn2 domains and nuclear localization signals (NLSs) marked (Figure 1C). MaSPL8 lacks miR156/157 regulatory motifs, consistent with the functional divergence from miR156-regulated clades I/II. Bioinformatic prediction identified two novel miRNAs, miR5658 and miR4221, as potential post-transcriptional regulators of MaSPL8 (Table 1).

2.2. MaSPL8 Mediates Responses to Biotic and Abiotic Stresses

Our previous transcriptomic study identified MaSPL8 as a sclerotiniose-responsive gene (SRG) [36]. Upon C. shiraiana infection, MaSPL8 expression was significantly upregulated in diseased fruits (Figure 2A). In contrast, exposure to drought or salt stress markedly suppressed MaSPL8 expression (Figure 2B). It is likely that MaSPL8 plays roles in responses to both biotic and abiotic stresses.

2.3. VIGS-Mediated MaSPL8 Silencing Impairs Growth and Enhances Pathogen Resistance

Virus-induced gene silencing (VIGS) effectively downregulated MaSPL8 expression, with suppression detectable 9 days post-treatment and sustained for over 19 days (Figure 3A). Fourteen mulberry plants with downregulation of MaSPL8 to varying degrees were finally obtained and were used for the following experiments (Figure S1). MaSPL8-silenced lines exhibited pronounced growth retardation compared to empty vector controls (Figure 3B). Notably, silenced plants displayed accelerated cell death upon C. shiraiana challenge, indicating susceptibility to C. shiraiana infection (Figure 3C,D).

2.4. MaSPL8 Silencing Confers Drought and Salt Stress Tolerance

Quantitative real-time PCR (qRT-PCR) confirmed the downregulation of MaSPL8 in VIGS-treated seedlings (Figure S1). The mulberry seedlings were then divided into groups for subsequent treatments, each consisting of three VIGS lines and corresponding controls (CKs). By day 9 of drought stress, control plants showed severe leaf wilting, whereas the silenced lines retained turgid leaves (Figure 4A). Physiological assays revealed that silenced plants accumulated 42% less malondialdehyde (MDA) and 70% less superoxide anion (O2•−), alongside about 1.2-fold higher proline levels and elevated activities of SOD (EC 1.15.1.1), POD (EC 1.11.1.7), and CAT (EC 1.11.1.6) (Figure 4B–G). Similarly, under salt stress, silenced plants showed delayed leaf wilting and analogous improvements in oxidative stress markers were determined (Figure 5). These findings collectively demonstrate that MaSPL8 acts as a negative regulator of abiotic stress tolerance.

2.5. Transcriptomic Analysis Reveals the MaSPL8-Regulated Pathways

Mulberry plants with different MaSPL8 expression levels were obtained using VIGS treatments. Two groups of mulberry plants with relatively high expression level (HEP) and low expression level (LEP) of MaSPL8 were selected for RNA-seq (Figure S1). Correlation analysis of all samples based on RNA-seq data showed that the different groups were well distinguished, and the samples in the same group showed high correlation (Figure 6A). Principal component analysis (PCA) confirmed clear separation between HEP and LEP groups, indicating that differences mainly resulted from the change in MaSPL8 expression levels (Figure 6B). RNA-seq analysis of MaSPL8 HEP and LEP groups revealed 825 differentially expressed genes (DEGs: 412 upregulated, 413 downregulated) (Figure 6C,D). GO enrichment highlighted DEG associations with light signaling, oxidative stress response, floral development, and phytohormone biosynthesis (Figure 6E and Figure S2). It is notable that plant hormone biosynthesis-related processes, including sterol biosynthesis, carotenoid biosynthesis, brassinosteriod biosynthesis, and homeostasis, and the jasmonic acid metabolic process were significantly enriched, implying the important role of MaSPL8 in regulating brassinosteriod or jasmonic acid homeostasis (Figure 6E and Figure S2).

3. Discussion

The functional characterization of MaSPL8 in mulberry reveals its different roles in biotic and abiotic stress responses. Although SPL genes are widely implicated in stress adaptation, their functional dichotomy across stress types remains understudied. In pineapple, SBP family genes were proven to respond to abiotic stresses such as cold, heat, and salt and drought stresses. Nine of thirty SPL genes in poplar have been identified as candidate regulators of resistance to high salt stress [13]. The miRNA156/157-SPL module regulates plant resistance to various stresses in plants [37]. For instance, it was reported that miR156 improved drought resistance of alfalfa by silencing SPL13, indicating that SPL13 played a negative role in abiotic stress responses [38]. Non-miRNA156-targeted SPL8 negatively regulated plant resistance to drought and salt stresses.
Downregulation of SPL8 improved both the biomass yield and the salt/drought tolerance of transgenic alfalfa [27]. CpSPL8 inhibited the SOS pathway and negatively regulated salt tolerance in Codonopsis pilosula [28]. The downregulation of MaSPL8 in this study led to reduced malondialdehyde (MDA) and superoxide anion levels, alongside elevated proline content and antioxidant enzyme activities (SOD, POD, CAT), aligning with the classic hallmarks of enhanced stress tolerance. These physiological changes likely stem from MaSPL8’s transcriptional regulation of genes involved in oxidative stress mitigation and osmotic adjustment. Contrasting its abiotic stress role, MaSPL8 positively regulates biotic stress resistance. Silenced plants exhibited accelerated cell death upon C. shiraiana infection, a phenotype of hyper-sensitive responses (HRs) in pathogen defense. This corresponds with reports in grape where VpSBP5 activates salicylic acid (SA) or jasmonic acid (JA) signaling to the defense of Erysiphenecator [39] and mulberry MnSPL7, which enhances catechin biosynthesis against silkworm herbivory [35].
Transcriptomic profiling revealed that MaSPL8 is intricately involved in the crosstalk between brassinosteroid (BR) and jasmonic acid (JA) signaling pathways. Specifically, differentially expressed genes (DEGs) associated with BR biosynthesis (including sterols and carotenoids) and JA metabolism were significantly enriched. In plants, BRs typically promote growth and enhance stress tolerance [40,41]. This supports the hypothesis that MaSPL8 integrates BR signaling in stress adaptation, a role that parallels the function of AtSPL8 in Arabidopsis, where it regulates BR signaling during anther development [29]. Additionally, SA and JA signaling pathways play critical roles in plant defense. In mulberry fruit infected with C. carunculoide, SA signaling is activated while JA signaling is inhibited, highlighting the complex interplay between these hormones in pathogen defense [42]. This suggests that MaSPL8 might function in conjunction with the JA pathway to enhance resistance to C. shiraiana infection. The precise molecular mechanisms underlying the interplay between MaSPL8 and these hormone pathways require further investigation, including hormone profiling and promoter-binding assays to confirm the regulatory roles of MaSPL8.
Beyond hormone signaling, transcriptomic analysis revealed that MaSPL8 is involved in the regulation of other pathways. For instance, 28 DEGs associated with transmembrane transport were identified, suggesting that MaSPL8 may influence cellular transport processes during stress responses. Transmembrane transporters, such as aquaporins and cation/H+ exchangers, are crucial for maintaining ion homeostasis and osmotic balance under stress conditions [43]. Further exploration of these transporters could provide insights into how MaSPL8 modulates stress tolerance at the cellular level. Moreover, the differential expression of stress-responsive transcription factors, such as members of the WRKY and MYB families, was observed. These transcription factors are known to play pivotal roles in oxidative stress tolerance, further underscoring the multifaceted regulatory network governed by MaSPL8.
The identification of miR5658 and miR4221 as potential regulators of MaSPL8 introduces an additional layer of post-transcriptional complexity to its regulation. miR156/157 are well-known core regulators that target most SPLs and influence various biological processes. Unlike Arabidopsis SPL8, which lacks miRNA156/157 binding sites, mulberry MaSPL8 may be modulated by novel miRNAs, reflecting lineage-specific regulatory adaptations. In fact, besides miR156, miR529 has been reported to cooperate with miR156 to target SPLs such as ZmSPL6, affecting inflorescence development [19]. In addition, miR529 also participates in auxin-mediated phyllody in the witches’ broom disease of jujube and response to drought stress in maize [20,44]. The novel miR5658 and miR4221 were predicted to target MaSPL8 and studies on these two microRNAs are limited. miR4221 was predicted to respond to cold stress in Solanum aculeatissimum [45] and miR5658 participates in the regulation of internode elongation of sugarcane [46]. The functions of miR5658 and miR4221 in mulberry and most other plants are undetermined. The findings in the present study highlight the need to dissect miRNA-SPL networks in non-model plants, where regulatory plasticity drives ecological adaptation.

4. Materials and Methods

4.1. Plant Materials

The materials for this study were sourced from the National Mulberry GeneBank (NMGB) in Zhenjiang (32°11′ N, 119°27′ E), Jiangsu Province, China. Leaves, buds, stems, and roots of one-year-old M. alba-variety Fengchi were collected for molecular cloning and tissue expression profiling. Drought, waterlogging, low-temperature (4 °C), and high-temperature (40 °C) treatments were conducted as described previously [40,41], with leaves collected for expression analysis. High salt treatment followed our established protocol, using 200 mM NaCl irrigation until wilted, dark leaves with yellowing margins appeared. Mulberry leaves were harvested to assess MaSPL expression changes under various stressors. M. alba var. Fengchi seedlings were germinated in moist dishes, transplanted into pots, and grown in a growth chamber at 22 °C with a 16/8 h day/night cycle and 40–60% humidity. Virus-induced gene silencing (VIGS) was performed on four-euphylla-stage seedlings, as previously reported [42]. VIGS-treated seedlings with significant MaSPL8 downregulation compared to controls were exposed to drought or salt stress. Seedlings with varying MaSPL8 expression levels were used for RNA-seq to identify co-expressed genes. All samples were flash-frozen in liquid nitrogen and stored at −80 °C until analysis. Each experiment included at least three biological replicates.

4.2. Cloning and Characterization of MaSPL8 in Morus

Isolation of total RNA and cDNA synthesis were performed according to our previous reports. Primers used for cloning MaSPL8 were designed according to the sequence from M. alba that has been reported in our previous study [40,41]. MaSPL8 was cloned via three-step PCR at a gradient annealing temperature of 52 °C. The PCR products were purified using SanPrep column DNA gel recovery kit (Sangon Biotech, Shanghai, China) and confirmed by Sanger sequencing. The validated sequences were deposited in GenBank with accession number PV138130. The putative MaSPL8 protein sequence was aligned with other SPL homologs from Arabidopsis thaliana and orthologs from different species using the DNAman 8.0 software (Lynnon BioSoft, https://dnaman.software.informer.com/8.0/, accessed on 22 March 2023) with default parameters. SPB domain including Zn1 motif, Zn2 motif, and NLS was identified and marked in the alignment and logo diagram. MEME suit (http://meme-suite.org/tools/meme, accessed on 20 March 2023) was used to scan the conserved motifs of SPL8s and the logo diagram was obtained by visualizing the alignment of SPB domains using Tbtools V 2.150. A neighbor-joining (NJ) phylogenetic tree was constructed using MaSPL8 protein sequence and SPLs from Arabidopsis thaliana, using MEGA11.0 with JTT + G model and bootstrap test with 1000 replicates [38,39]. MicroRNA sequences from M. alba were extracted according to the annotation file. Both the microRNA sequences and MaSPL8 were submitted to psRNATarget (https://www.zhaolab.org/psRNATarget/analysis?function=3, accessed on 22 March 2023) to search the possible MiRNA targeting on MaSPL8.

4.3. Expression Profiles of MaSPL8

MaSPL8 expression levels in various organs and under different stress conditions were analyzed by qRT-PCR using the ABI StepOnePlus™ Real-Time PCR System (ABI Applied Biosystems, Waltham, MA, USA). The reaction mix included 2× ChamQ™ SYBR® qPCR Master Mix (Vazyme, Nanjing, China) and 50× ROX Reference Dye 1. The qRT-PCR protocol involved a two-step cycling program: 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, with Actin as the reference gene. Results were visualized using GraphPad Prism 8.0 and ANOVA was performed with p < 0.05 considered significant. Each experiment included three biological or technical replicates.

4.4. Obtaining Mulberry with DownRegulated MaSPL8 Using VIGS

We used virus-induced gene silencing (VIGS) to generate mulberry trees with varying levels of MaSPL8 downregulation [43]. Recombinant plasmids for VIGS were constructed using Nimble cloning [44] and VIGS was performed as described previously [41,42,43]. Mulberry leaves were infected via pressure injection, with empty vectors pTRV2 and pTRV1 as negative controls. MaSPL8 expression levels were measured by qRT-PCR 9 and 19 days post-injection. Knockdown efficiency was calculated by comparing MaSPL8 expression in VIGS-treated plants to controls.

4.5. Estimation of Plant Resistance to C. shiraiana Infection

Cell death symptoms and C. shiraiana growth were recorded to evaluate transgenic plant resistance to infection, as previously described [41]. C. shiraiana was inoculated 10 days after infiltration in mulberry. Results are based on at least three biological replicates.

4.6. Drought and Salt Stress Treatment and Physiology Indicator Determination

Mulberry plants with confirmed MaSPL8 downregulation via VIGS were subjected to drought or salt stress. For drought stress, plants were placed in a single pot without irrigation, while controls received regular watering. For salt stress, plants were irrigated daily with 200 mM NaCl instead of water. Drought stress lasted seven days and salt stress continued for nine days. Plant growth conditions were photographed to document tolerance to drought or salt stress. Physiological indicators, including MDA and proline contents, O2 levels, and SOD, POD, and CAT activities in leaves, were measured using samples collected on the seventh or ninth day, as described previously [45,46]. Data were analyzed using GraphPad Prism 8.0, with ANOVA and visualization performed at a significance level of p < 0.05. All experiments included three biological replicates.

4.7. RNA-Seq and Comparative RNA-Seq Analysis

The trimmed and filtered reads were aligned to the M. alba genome released by Jiao et al. (2020) [47] using bowtie2 (version-2.3.2) [48]. Samtools was used to operate the bam files. StringTie v2.15 was used to calculate the expression matrix with the genome annotation file (.gff3) [49]. Tbtools V 2.150 was used to identify differentially expressed genes and perform GO enrichment analysis [50]. R version 4.1.2 was used for R-package-based analyses.

5. Conclusions

In summary, this study establishes MaSPL8 as a multifaceted regulator in mulberry, positively influencing resistance to fungal pathogens and negatively influencing drought resistance and salt stress. Its downregulation enhances abiotic stress tolerance by bolstering antioxidant capacity and osmotic regulation, while concurrently intersecting with BR and JA signaling pathways. The species-specific functional divergence of SPL8 homologs highlights the evolutionary plasticity of this transcription factor family. Our work not only expands upon the functional repertoire of SPL8 genes but also provides a genetic target for improving mulberry’s stress resilience—a critical trait for its roles in sericulture and phytoremediation. Future studies should prioritize elucidating the molecular mechanisms underlying MaSPL8 hormone crosstalk and validating the roles of miR5658/miR4221 in its regulation.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants14060950/s1: Figure S1: Expression levels of MaSPL8 in VIGS-treated mulberry. Figure S2: GO enrichment analysis of DEGs. (A) GO enrichment of up-regulated DEGs; (B) GO enrichment of downregulated DEGs.

Author Contributions

M.L. and L.L. guided the work and provided advice. L.Z., W.Z. and L.W. performed the experiments. L.Z. and W.Z. analyzed the data and organized the figures. M.L. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was jointly supported by Crop Germplasm Resources Protection Project of the Ministry of Agriculture and Rural Affairs of the People’s Republic of China (19200382), National Infrastructure for Crop Germplasm Resources (NCGRC-2020-041), and China Agriculture Research System of MOF and MARA (CARS-18).

Data Availability Statement

Data is contained within the article or Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, X.; Zhang, Z.; Liu, D.; Zhang, K.; Li, A.; Mao, L. SQUAMOSA Promoter-Binding Protein-like Transcription Factors: Star Players for Plant Growth and Development. J. Integr. Plant Biol. 2010, 52, 946–951. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Preston, J.C.; Hileman, L.C. Functional Evolution in the Plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) Gene Family. Front. Plant Sci. 2013, 4, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Yamasaki, K.; Kigawa, T.; Inoue, M.; Tateno, M.; Yamasaki, T.; Yabuki, T.; Aoki, M.; Seki, E.; Matsuda, T.; Nunokawa, E.; et al. A Novel Zinc-binding Motif Revealed by Solution Structures of DNA-binding Domains of Arabidopsis SBP-family Transcription Factors. J. Mol. Biol. 2004, 337, 49–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Birkenbihl, R.P.; Jach, G.; Saedler, H.; Huijser, P. Functional Dissection of the Plant-specific SBP-Domain: Overlap of the DNA-binding and Nuclear Localization Domains. J. Mol. Biol. 2005, 352, 585–596. [Google Scholar] [CrossRef] [Scilit]
  5. Riese, M.; Höhmann, S.; Saedler, H.; Münster, T.; Huijser, P. Comparative analysis of the SBP-box gene families in P. patens and seed plants. Gene 2007, 401, 28–37. [Google Scholar] [CrossRef] [Scilit]
  6. Klein, J.; Saddler, H.; Huijser, P. A new family of DNA binding proteins includes putative transcriptional regulators of the Antirrhinum majus floral meristem identity gene SQUAMOSA. Mol. Gen. Genet. 1996, 250, 7–16. [Google Scholar]
  7. Zeng, R.-F.; Zhou, J.-J.; Liu, S.-R.; Gan, Z.-M.; Zhang, J.-Z.; Hu, C.-G. Genome-Wide Identification and Characterization of SQUAMOSA—Promoter-Binding Protein (SBP) Genes Involved in the Flowering Development of Citrus Clementina. Biomolecules 2019, 9, 66. [Google Scholar] [CrossRef] [Scilit]
  8. Zhu, T.; Liu, Y.; Ma, L.; Wang, X.; Zhang, D.; Han, Y.; Ding, Q.; Ma, L. Genome-wide identification, phylogeny and expression analysis of the SPL gene family in wheat. BMC Plant Biol. 2020, 20, 295. [Google Scholar] [CrossRef] [Scilit]
  9. Cardon, G.; Höhmann, S.; Klein, J.; Nettesheim, K.; Saedler, H.; Huijser, P. Molecular characterisation of the Arabidopsis SBP-box genes. Gene 1999, 237, 91–104. [Google Scholar] [CrossRef] [Scilit]
  10. Xie, K.; Wu, C.; Xiong, L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol. 2006, 142, 280–293. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, B.; Geng, S.; Wang, D.; Feng, N.; Zhang, D.; Wu, L.; Hao, C.; Zhang, X.; Li, A.; Mao, L. Characterization of Squamosa Promoter Binding Protein-LIKE genes in wheat. J. Plant Biol. 2015, 58, 220–229. [Google Scholar] [CrossRef] [Scilit]
  12. Mao, H.-D.; Yu, L.-J.; Li, Z.-J.; Yan, Y.; Han, R.; Liu, H.; Ma, M. Genome-wide analysis of the SPL family transcription factors and their responses to abiotic stresses in maize. Plant Gene 2016, 6, 1–12. [Google Scholar] [CrossRef] [Scilit]
  13. Guo, Q.; Li, L.; Zhao, K.; Yao, W.; Cheng, Z.; Zhou, B.; Jiang, T. Genome-Wide Analysis of Poplar SQUAMOSA-Promoter-Binding Protein (SBP) Family under Salt Stress. Forests 2021, 12, 413. [Google Scholar] [CrossRef] [Scilit]
  14. Tripathi, R.K.; Goel, R.; Kumari, S.; Dahuja, A. Genomic organization, phylogenetic comparison, and expression profiles of the SPL family genes and their regulation in soybean. Dev. Genes Evol. 2017, 227, 101–119. [Google Scholar] [CrossRef] [Scilit]
  15. Xing, S.; Salinas, M.; Höhmann, S.; Berndtgen, R.; Huijser, P. miR156-Targeted and Nontargeted SBP-Box Transcription Factors Act in Concert to Secure Male Fertility in Arabidopsis. Plant Cell 2010, 22, 3935–3950. [Google Scholar] [CrossRef] [Scilit]
  16. Jiao, Y.; Wang, Y.; Xue, D.; Wang, J.; Yan, M.; Liu, G.; Dong, G.; Zeng, D.; Lu, Z.; Zhu, X. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 2010, 42, 541–544. [Google Scholar] [CrossRef] [Scilit]
  17. Yu, N.; Niu, Q.W.; Ng, K.H.; Chua, N.H. The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J. 2015, 83, 673–685. [Google Scholar] [CrossRef] [Scilit]
  18. Chuck, G.; Cigan, A.M.; Saeteurn, K.; Hake, S. The heterochronic maize mutant Corngrass1 results from overexpression of a tandem microRNA. Nat. Genet. 2007, 39, 544–549. [Google Scholar] [CrossRef] [Scilit]
  19. Chuck, G.; Whipple, C.; Jackson, D.; Hake, S. The maize SBP-box transcription factor encoded by tasselsheath4 regulates bract development and the establishment of meristem boundaries. Development 2010, 137, 1243–1250. [Google Scholar] [CrossRef] [Scilit]
  20. Zhou, L.; Liu, Y.; Liu, Z.; Kong, D.; Duan, M.; Luo, L. Genome-wide identification and analysis of drought-responsive microRNAs in Oryza sativa. J. Exp. Bot. 2010, 61, 4157–4168. [Google Scholar] [CrossRef] [Scilit]
  21. Zhao, Y.; He, J.; Liu, M.; Miao, J.; Ma, C.; Feng, Y.; Qian, J.; Li, H.; Bi, H.; Liu, W. The SPL transcription factor TaSPL6 negatively regulates drought stress response in wheat. Plant Physiol. Biochem. 2024, 206, 108264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Sun, X.; Zhang, L.; Xu, W.; Zheng, J.; Yan, M.; Zhao, M.; Wang, X.; Yin, Y. A Comprehensive Analysis of the Peanut SQUAMOSA Promoter Binding Protein-like Gene Family and How AhSPL5 Enhances Salt Tolerance in Transgenic Arabidopsis. Plants 2024, 13, 1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Guo, A.-Y.; Zhu, Q.-H.; Gu, X.; Ge, S.; Yang, J.; Luo, J. Genome-wide identification and evolutionary analysis of the plant specific SBP-box transcription factor family. Gene 2008, 418, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Xing, S.; Salinas, M.; Garcia-Molina, A.; Höhmann, S.; Berndtgen, R.; Huijser, P. SPL8 and miR156-targeted SPL genes redundantly regulate Arabidopsis gynoecium differential patterning. Plant J. 2013, 75, 566–577. [Google Scholar] [CrossRef] [Scilit]
  25. Unte, U.S.; Sorensen, A.-M.; Pesaresi, P.; Gandikota, M.; Leister, D.; Saedler, H.; Huijser, P. SPL8, an SBP-Box Gene That Affects Pollen Sac Development in Arabidopsis. Plant Cell 2003, 15, 1009–1019. [Google Scholar] [CrossRef] [Scilit]
  26. Zhang, Y.; Schwarz, S.; Saedler, H.; Huijser, P. SPL8, a local regulator in a subset of gibberellin-mediated developmental processes in Arabidopsis. Plant Mol. Biol. 2006, 63, 429–439. [Google Scholar] [CrossRef] [Scilit]
  27. Gou, J.; Debnath, S.; Sun, L.; Flanagan, A.; Tang, Y.; Jiang, Q.; Wen, J.; Wang, Z.Y. From model to crop: Functional characterization of SPL8 in M. truncatula led to genetic improvement of biomass yield and abiotic stress tolerance in alfalfa. Plant Biotechnol. J. 2017, 16, 951–962. [Google Scholar] [CrossRef] [Scilit]
  28. Li, Q.; Yang, Q.; Dong, S.; Fu, F.; Xin, Y.; Kang, H.; Wu, Y.; Cao, X. Transcription factors CpSPL5 and CpSPL8 negatively regulate salt tolerance in Codonopsis pilosula by inhibiting SOS pathway. Plant J. 2024, 121, e17205. [Google Scholar] [CrossRef] [Scilit]
  29. Xing, S.; Quodt, V.; Chandler, J.; Höhmann, S.; Berndtgen, R.; Huijser, P. SPL8 Acts Together with the Brassinosteroid-Signaling Component BIM1 in Controlling Arabidopsis thaliana Male Fertility. Plants 2013, 2, 416–428. [Google Scholar] [CrossRef] [Scilit]
  30. Abhinandan, K.; Skori, L.; Stanic, M.; Hickerson, N.M.N.; Jamshed, M.; Samuel, M.A. Abiotic Stress Signaling in Wheat–An Inclusive Overview of Hormonal Interactions During Abiotic Stress Responses in Wheat. Front. Plant Sci. 2018, 9, 734. [Google Scholar] [CrossRef] [Scilit]
  31. Chao, N.; Wang, R.F.; Hou, C.; Yu, T.; Miao, K.; Cao, F.Y.; Fang, R.J.; Liu, L. Functional characterization of two chalcone isomerase (CHI) revealing their responsibility for anthocyanins accumulation in mulberry. Plant Physiol. Biochem. 2021, 161, 65–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Xia, Z.; Fan, W.; Liu, D.; Chen, Y.; Lv, J.; Xu, M.; Zhang, M.; Ren, Z.; Chen, X.; Wang, X.; et al. Haplotype-resolved chromosomal-level genome assembly reveals regulatory variations in mulberry fruit anthocyanin content. Hortic. Res. 2024, 11, uhae120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Dai, M.J.; Zhang, L.D.; Li, J.; Zhu, C.Q.; Song, L.Y.; Huang, H.Z.; Xu, C.Q.; Li, Q.H.; Chen, L.; Jiang, C.K.; et al. Calcium regulates the physiological and molecular responses of Morus alba roots to cadmium stress. J. Hazard. Mater. 2024, 480, 136210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Liu, C.; Fan, W.; Zhu, P.; Xia, Z.; Hu, J.; Zhao, A. Mulberry RGS negatively regulates salt stress response and tolerance. Plant Signal. Behav. 2019, 14, 1672512. [Google Scholar] [CrossRef] [Scilit]
  35. Li, H.; Ma, B.; Luo, Y.; Wei, W.; Yuan, J.; Zhai, C.; He, N. The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway. Int. J. Mol. Sci. 2022, 23, 1141. [Google Scholar] [CrossRef] [Scilit]
  36. Liu, L.; Guo, Z.; Kang, X.; Li, S.; Huang, S.; Zheng, L.; Fu, R.; Yidilisi, K.; Chao, N. Comparative Transcriptome Analysis of Different Mulberry Varieties to Reveal Candidate Genes and Small Secreted Peptides Involved in the Sclerotiniose Response. Forests 2024, 15, 1126. [Google Scholar] [CrossRef] [Scilit]
  37. Yuan, J.; Wang, X.; Qu, S.; Shen, T.; Li, M.; Zhu, L. The roles of miR156 in abiotic and biotic stresses in plants. Plant Physiol. Biochem. 2023, 204, 108150. [Google Scholar] [CrossRef] [Scilit]
  38. Ali, H.; Liu, Y.; Azam, S.M.; Rahman, Z.U.; Priyadarshani, S.V.G.N.; Li, W.; Huang, X.; Hu, B.; Xiong, J.; Ali, U.; et al. Genomic Survey, Characterization, and Expression Profile Analysis of the SBP Genes in Pineapple (Ananas comosus L.). Int. J. Genom. 2017, 2017, 1032846. [Google Scholar] [CrossRef] [Scilit]
  39. Unver, T.; Hou, H.; Li, J.; Gao, M.; Singer, S.D.; Wang, H.; Mao, L.; Fei, Z.; Wang, X. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape. PLoS ONE 2013, 8, e59358. [Google Scholar] [CrossRef] [Scilit]
  40. Li, H.; Ye, K.; Shi, Y.; Cheng, J.; Zhang, X.; Yang, S. BZR1 Positively Regulates Freezing Tolerance via CBF-Dependent and CBF-Independent Pathways in Arabidopsis. Mol. Plant 2017, 10, 545–559. [Google Scholar] [CrossRef] [Scilit]
  41. Li, J.; Zhou, H.; Zhang, Y.; Li, Z.; Yang, Y.; Guo, Y. The GSK3-like Kinase BIN2 Is a Molecular Switch between the Salt Stress Response and Growth Recovery in Arabidopsis thaliana. Dev. Cell 2020, 55, 367–380.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Lv, Z.; Hao, L.; Ma, B.; He, Z.; Luo, Y.; Xin, Y.; He, N. Ciboria carunculoides Suppresses Mulberry Immune Responses Through Regulation of Salicylic Acid Signaling. Front. Plant Sci. 2021, 12, 658590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Mishra, G.; Mohapatra, S.K.; Rout, G.R. Plant membrane transporters function under abiotic stresses: A review. Planta 2024, 260, 125. [Google Scholar] [CrossRef] [Scilit]
  44. Ma, F.; Huang, J.; Yang, J.; Zhou, J.; Sun, Q.; Sun, J. Identification, expression and miRNA targeting of auxin response factor genes related to phyllody in the witches’ broom disease of jujube. Gene 2020, 746, 144656. [Google Scholar] [CrossRef] [Scilit]
  45. Yang, X.; Liu, F.; Zhang, Y.; Wang, L.; Cheng, Y.-F. Cold-responsive miRNAs and their target genes in the wild eggplant species Solanum aculeatissimum. BMC Genom. 2017, 18, 1000. [Google Scholar] [CrossRef] [Scilit]
  46. Qiu, L.; Chen, R.; Fan, Y.; Huang, X.; Luo, H.; Xiong, F.; Liu, J.; Zhang, R.; Lei, J.; Zhou, H.; et al. Integrated mRNA and small RNA sequencing reveals microRNA regulatory network associated with internode elongation in sugarcane (Saccharum officinarum L.). BMC Genom. 2019, 20, 817. [Google Scholar] [CrossRef] [Scilit]
  47. Jiao, F.; Luo, R.; Dai, X.; Liu, H.; Yu, G.; Han, S.; Lu, X.; Su, C.; Chen, Q.; Song, Q.; et al. Chromosome-level reference genome and population genomic analysis provide insights into the evolution and improvement of domesticated mulberry (Morus alba). Molecular plant 2020, 13, 1001–1012. [Google Scholar] [CrossRef] [Scilit]
  48. Langdon, B.W. Performance of genetic programming optimised Bowtie2 on genome comparison and analytic testing (GCAT) benchmarks. BioData Min. 2015, 8, 1. [Google Scholar] [CrossRef] [Scilit]
  49. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [Scilit]
  50. Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Characterization of MaSPL8 protein sequence. (A) Phylogenetic analysis of SPLs from Morus alba and other plant species. SPLs from A. thaliana were extracted from the Arabidopsis Information Resource (TAIR). Accession numbers for SPL8 for different plant species are as follows: Brassica rapa BrsSPL8, XP_009119750; Betula platyphylla BplSPL8, AXB72472; Arachis hypogaea AhSPL8, XP_025640943; Gossypium arboreum GaSPL8, XP_017641940; Triticum aestivum TaSPL8, KAF7018911; Oryza sativa OsSPL8, NP_001406835; Morus notabilis MnSPL8, XP_010089258; Salvia miltiorrhiza SmSPL8, AIE89797. (B) Conserved motifs of SPL8 from different plant species. (C) Alignment of SPL8s from different plant species. Zn1 and Zn2 binding motifs are indicated by red boxes and NLS is indicated by a blue box.
Figure 1. Characterization of MaSPL8 protein sequence. (A) Phylogenetic analysis of SPLs from Morus alba and other plant species. SPLs from A. thaliana were extracted from the Arabidopsis Information Resource (TAIR). Accession numbers for SPL8 for different plant species are as follows: Brassica rapa BrsSPL8, XP_009119750; Betula platyphylla BplSPL8, AXB72472; Arachis hypogaea AhSPL8, XP_025640943; Gossypium arboreum GaSPL8, XP_017641940; Triticum aestivum TaSPL8, KAF7018911; Oryza sativa OsSPL8, NP_001406835; Morus notabilis MnSPL8, XP_010089258; Salvia miltiorrhiza SmSPL8, AIE89797. (B) Conserved motifs of SPL8 from different plant species. (C) Alignment of SPL8s from different plant species. Zn1 and Zn2 binding motifs are indicated by red boxes and NLS is indicated by a blue box.
Plants 14 00950 g001
Figure 2. Expression profile of MaSPL8 in response to various stresses in mulberry. (A) Expression levels of MaSPL8 in response to sclerotiniose; (B) expression levels of MaSPL8 in response to different abiotic stresses. Data are presented as means ± SD of at least three biological replicates. The significance was marked using ** (0.001 < p < 0.01), *** (p < 0.001), ns (non-significant).
Figure 2. Expression profile of MaSPL8 in response to various stresses in mulberry. (A) Expression levels of MaSPL8 in response to sclerotiniose; (B) expression levels of MaSPL8 in response to different abiotic stresses. Data are presented as means ± SD of at least three biological replicates. The significance was marked using ** (0.001 < p < 0.01), *** (p < 0.001), ns (non-significant).
Plants 14 00950 g002
Figure 3. Downregulation of MaSPL8 by VIGS impairs growth and enhances pathogen resistance in mulberry. (A) qRT-PCR (quantitative real-time PCR) detection of MaSPL8 expression levels in VIGS-treated mulberry plants 9 days and 19 days post-treatment. (B) Growth conditions of VIGS-treated mulberry and controls 19 days post-treatment. (C) qRT-PCR detection of MaSPL8 expression levels in VIGS-treated mulberry and controls used for C. shiraiana infection. (D) Observation of cell death symptom after C. shiraiana infection. CK: mulberry plants treated with empty vectors were used as controls; MaSPL8-T1 and T2: independent mulberry plants with downregulation of MaSPL8 by VIGS treatment. Data are presented as means ± SD of three biological replicates. The significance was marked using ** (0.001 < p < 0.01), **** (p < 0.0001).
Figure 3. Downregulation of MaSPL8 by VIGS impairs growth and enhances pathogen resistance in mulberry. (A) qRT-PCR (quantitative real-time PCR) detection of MaSPL8 expression levels in VIGS-treated mulberry plants 9 days and 19 days post-treatment. (B) Growth conditions of VIGS-treated mulberry and controls 19 days post-treatment. (C) qRT-PCR detection of MaSPL8 expression levels in VIGS-treated mulberry and controls used for C. shiraiana infection. (D) Observation of cell death symptom after C. shiraiana infection. CK: mulberry plants treated with empty vectors were used as controls; MaSPL8-T1 and T2: independent mulberry plants with downregulation of MaSPL8 by VIGS treatment. Data are presented as means ± SD of three biological replicates. The significance was marked using ** (0.001 < p < 0.01), **** (p < 0.0001).
Plants 14 00950 g003
Figure 4. Downregulation of MaSPL8 by VIGS increases drought tolerance in mulberry. (A) Growth conditions of VIGS-treated mulberry and controls under drought stress; plants were observed and recorded until the nineth day after being exposed to drought stress. (B) MDA contents in VIGS-treated mulberry and controls after being exposed to drought stress. (C) O2•− contents in VIGS-treated mulberry and controls after being exposed to drought stress. (D) Proline contents in VIGS-treated mulberry and controls after being exposed to drought stress. (E) CAT activities in VIGS-treated mulberry and controls after being exposed to drought stress. (F) POD activities in VIGS-treated mulberry and controls after being exposed to drought stress. (G) SOD activities in VIGS-treated mulberry and controls after being exposed to drought stress. Physiological indicators were determined in leaves on the nineth day of stress treatment. CK: mulberry plants treated with empty vectors were used as controls. Three independent mulberry plants with downregulation of MaSPL8 by VIGS treatment were used. Data are presented as means ± SD of three biological replicates. The significance was marked using **** (p < 0.0001).
Figure 4. Downregulation of MaSPL8 by VIGS increases drought tolerance in mulberry. (A) Growth conditions of VIGS-treated mulberry and controls under drought stress; plants were observed and recorded until the nineth day after being exposed to drought stress. (B) MDA contents in VIGS-treated mulberry and controls after being exposed to drought stress. (C) O2•− contents in VIGS-treated mulberry and controls after being exposed to drought stress. (D) Proline contents in VIGS-treated mulberry and controls after being exposed to drought stress. (E) CAT activities in VIGS-treated mulberry and controls after being exposed to drought stress. (F) POD activities in VIGS-treated mulberry and controls after being exposed to drought stress. (G) SOD activities in VIGS-treated mulberry and controls after being exposed to drought stress. Physiological indicators were determined in leaves on the nineth day of stress treatment. CK: mulberry plants treated with empty vectors were used as controls. Three independent mulberry plants with downregulation of MaSPL8 by VIGS treatment were used. Data are presented as means ± SD of three biological replicates. The significance was marked using **** (p < 0.0001).
Plants 14 00950 g004
Figure 5. Downregulation of MaSPL8 by VIGS increases salt tolerance in mulberry. (A) Growth conditions of VIGS-treated mulberry and controls under salt stress; plants were observed and recorded until the seventh day after being exposed to drought stress. (B) MDA content in VIGS-treated mulberry and controls after salt stress exposure. (C) O2 content in VIGS-treated mulberry and controls after salt stress exposure. (D) Proline contents in VIGS-treated mulberry and controls after being exposed to salt stress. (E) CAT activities in VIGS-treated mulberry and controls after being exposed to salt stress. (F) POD activities in VIGS-treated mulberry and controls after being exposed to salt stress. (G) SOD activities in VIGS-treated mulberry and controls after being exposed to salt stress. Physiological indicators were determined in leaves on the seventh day of stress treatment. CK: mulberry plants treated with empty vectors were used as controls. Three independent mulberry plants with downregulation of MaSPL8 by VIGS treatment were used. Data are presented as means ± SD of three biological replicates. The significance was marked using **** (p < 0.0001).
Figure 5. Downregulation of MaSPL8 by VIGS increases salt tolerance in mulberry. (A) Growth conditions of VIGS-treated mulberry and controls under salt stress; plants were observed and recorded until the seventh day after being exposed to drought stress. (B) MDA content in VIGS-treated mulberry and controls after salt stress exposure. (C) O2 content in VIGS-treated mulberry and controls after salt stress exposure. (D) Proline contents in VIGS-treated mulberry and controls after being exposed to salt stress. (E) CAT activities in VIGS-treated mulberry and controls after being exposed to salt stress. (F) POD activities in VIGS-treated mulberry and controls after being exposed to salt stress. (G) SOD activities in VIGS-treated mulberry and controls after being exposed to salt stress. Physiological indicators were determined in leaves on the seventh day of stress treatment. CK: mulberry plants treated with empty vectors were used as controls. Three independent mulberry plants with downregulation of MaSPL8 by VIGS treatment were used. Data are presented as means ± SD of three biological replicates. The significance was marked using **** (p < 0.0001).
Plants 14 00950 g005
Figure 6. Comparative transcriptome analysis of mulberry plants with different MaSPL8 expression levels. (A) Correlation of RNA-seq data from mulberry plants with different MaSPL8 expression levels. HEP: high expression level of MaSPL8; LEP: low expression level of MaSPL8; (B) PCA of different samples; (C) volcano diagram of DEGs; (D) cluster and heatmap of DEGs; (E) GO enrichment of DEGs.
Figure 6. Comparative transcriptome analysis of mulberry plants with different MaSPL8 expression levels. (A) Correlation of RNA-seq data from mulberry plants with different MaSPL8 expression levels. HEP: high expression level of MaSPL8; LEP: low expression level of MaSPL8; (B) PCA of different samples; (C) volcano diagram of DEGs; (D) cluster and heatmap of DEGs; (E) GO enrichment of DEGs.
Plants 14 00950 g006
Table 1. Prediction of upstream miRNA targeting on MaSPL8.
Table 1. Prediction of upstream miRNA targeting on MaSPL8.
miRNATarget GeneExpectAlignmentInhibition
miR5658MaSPL82.5miRNA 21 AAAGUAGUAGUAGUAGUAGUA 1Cleavage
:: :::::::::: :::::
Target 154 ACUCCUCAUCAUCAUAAUCAU 174
miR4221MaSPL85miRNA 22 CGUUCUUAAGUUGUCUCCUUUU 1Cleavage
.::.: ::.:.::::...:
Target 417 CGGAGGAGGCAGCGGAGGGGGA 438
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, L.; Zhang, W.; Wei, L.; Li, M.; Liu, L. Functional Characterization of MaSPL8 Reveals Its Different Roles in Biotic and Abiotic Stress Responses in Mulberry. Plants 2025, 14, 950. https://doi.org/10.3390/plants14060950

AMA Style

Zheng L, Zhang W, Wei L, Li M, Liu L. Functional Characterization of MaSPL8 Reveals Its Different Roles in Biotic and Abiotic Stress Responses in Mulberry. Plants. 2025; 14(6):950. https://doi.org/10.3390/plants14060950

Chicago/Turabian Style

Zheng, Longyan, Wenhao Zhang, Liuqing Wei, Mengqi Li, and Li Liu. 2025. "Functional Characterization of MaSPL8 Reveals Its Different Roles in Biotic and Abiotic Stress Responses in Mulberry" Plants 14, no. 6: 950. https://doi.org/10.3390/plants14060950

APA Style

Zheng, L., Zhang, W., Wei, L., Li, M., & Liu, L. (2025). Functional Characterization of MaSPL8 Reveals Its Different Roles in Biotic and Abiotic Stress Responses in Mulberry. Plants, 14(6), 950. https://doi.org/10.3390/plants14060950

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop