Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and DNA Extraction
2.2. Microsatellite Genotyping
2.3. Data Analysis
3. Results
4. Discussion
| Publication | Pear Accessions | Pear Species | Number of Accessions | Number of SSR Markers | Total Number of Alleles | Na | Ne | He |
|---|---|---|---|---|---|---|---|---|
| [11] | Portuguese pear landraces | P. communis | 88 | 8 | 216 | 27 | - | 0.88 |
| [18] | Local Pear Cultivars (Aragon, Northeastern Spain) | P. communis, P. spinosa | 108 | 9 | 162 | 18.11 | 8.45 | 0.83 |
| [20] | Pear cultivars in Central Europe | P. communis | 94 | 10 | 84 | 10.5 | - | 0.78 |
| [22] | European pear (Bosnia and Herzegovina) | P. communis | 64 | 13 | 159 | 14.5 | - | - |
| [23] | Chinese National Pear Germplasm Repository (Wuhan) | P. communis | 54 | 6 | 68 | 11.3 | 5.8 | 0.806 |
| [24] | Pear collections | P. communis | 130 | 11 | 129 | 11.7 | 5.8 | 0.79 |
| [25] | Sardinian pears | P. spp. | 19 | 21 | - | - | - | 0.3 |
| [26] | “Zangli” pear landraces (Tibet) | P. spp. | 67 | 28 | 202 | 7.21 | 4.07 | 0.72 |
| [27] | Pear germplasm collection (Tunisia) | P. pyrifolia, P. pashia | 478 | 17 | 121 | 7.12 | 6.36 | 0.78 |
| [28] | Chinese National Germplasm Repository of Pear (Xingcheng, China) | P. spp. | 131 | 17 | 377 | 22.17 | 7.77 | 0.86 |
| [29] | Pear cultivars (Minas Gerais State, Brazil) | P. spp. | 61 | 12 | 95 | 9.5 | 3.3 | 0.62 |
| [30] | Collection of European pear cultivars | P. communis | 252 | 14 | 251 | 17.93 | 6.83 | 0.82 |
| [63] | Portuguese pear germplasm | P. spp. | 385 | 134 | 690 | 5.45 | - | 0.74 |
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Simmonds, N.W. Origin and Geography of Cultivated Plants, by N. I. Vavilov. Xxxi + 498 pp. Cambridge: Cambridge University Press (1993). J. Agric. Sci. 1993, 120, 419–420. [Google Scholar] [CrossRef] [Scilit]
- Hancock, J.F.; Lobos, G.A. Pears. In Temperate Fruit Crop Breeding; Hancock, J.F., Ed.; Springer: Berlin/Heidelberg, Germany, 2008; pp. 299–336. [Google Scholar] [CrossRef] [Scilit]
- Draga, S.; Palumbo, F.; Barbagiovanni, I.M.; Pati, F.; Barcaccia, G. Management of Genetic Erosion: The (Successful) Case Study of the Pear (Pyrus communis L.) Germplasm of the Lazio Region (Italy). Front. Plant Sci. 2023, 13, 1099420. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Sánchez, R.; Morales-Corts, M.R. Agromorphological and Chemical Characterization of Pear Cultivars Grown in Central–West Iberian Peninsula. Agronomy 2023, 13, 2993. [Google Scholar] [CrossRef] [Scilit]
- Pang, X.; Jia, M.; Zhang, Y.; Chen, M.; Miao, P.; Cheng, W.; Zhou, Z.; Zhang, Q.; Ye, J.; Li, J.; et al. Dynamic Interplay between Soil Microbial Communities, Enzyme Activities, and Pear Quality across Planting Years. Front. Microbiomes 2024, 3, 1381270. [Google Scholar] [CrossRef] [Scilit]
- Waite, J.M.; Gottschalk, C.; Reinhold, L.A.; Bassil, N.V.; Volk, G.M.; Postman, J.D.; Elkins, R.B.; Bell, R.L. Vulnerability of Pear (Pyrus) Genetic Resources in the U.S. Genet. Resour. Crop Evol. 2024, 72, 815–843. [Google Scholar] [CrossRef] [Scilit]
- Ganopoulos, I.V.; Kazantzis, K.; Chatzicharisis, I.; Karayiannis, I.; Tsaftaris, A.S. Genetic Diversity, Structure and Fruit Trait Associations in Greek Sweet Cherry Cultivars Using Microsatellite Based (SSR/ISSR) and Morpho-Physiological Markers. Euphytica 2011, 181, 237–251. [Google Scholar] [CrossRef] [Scilit]
- Velázquez-Barrera, M.E.; Ramos-Cabrer, A.M.; Pereira-Lorenzo, S.; Ríos-Mesa, D.J. Genetic Pool of the Cultivated Pear Tree (Pyrus spp.) in the Canary Islands (Spain), Studied Using SSR Molecular Markers. Agronomy 2022, 12, 1711. [Google Scholar] [CrossRef] [Scilit]
- Ferradini, N.; Lancioni, H.; Torricelli, R.; Russi, L.; Dalla Ragione, I.; Cardinali, I.; Marconi, G.; Gramaccia, M.; Concezzi, L.; Achilli, A.; et al. Characterization and Phylogenetic Analysis of Ancient Italian Landraces of Pear. Front. Plant Sci. 2017, 8, 751. [Google Scholar] [CrossRef] [Scilit]
- Labuschagne, I.; Musacchi, S.; Nyéki, J.; Szabó, Z.; Szabó, T. The Hungarian Pear Germplasm (Pyrus communis) as Source of Genetic Variability for Breeding Programs. Acta Hortic. 2011, 909, 89–95. [Google Scholar] [CrossRef] [Scilit]
- Kocsisné, G.M.; Bolla, D.; Ulrike; Forneck, A.; Taller, J.; Kocsis, L. Genetic Diversity and Similarity of Pear (Pyrus communis L.) Cultivars in Central Europe Revealed by SSR Markers. Genet. Resour. Crop Evol. 2020, 67, 1755–1763. [Google Scholar] [CrossRef] [Scilit]
- Erfani, J.; Ebadi, A.; Abdollahi, H.; Fatahi, R. Genetic Diversity of Some Pear Cultivars and Genotypes Using Simple Sequence Repeat (SSR) Markers. Plant Mol. Biol. Report. 2012, 30, 1065–1072. [Google Scholar] [CrossRef] [Scilit]
- Montanari, S.; Postman, J.; Bassil, N.V.; Neale, D.B. Reconstruction of the Largest Pedigree Network for Pear Cultivars and Evaluation of the Genetic Diversity of the USDA-ARS National Pyrus Collection. G3 Genes Genomes Genet. 2020, 10, 3285–3297. [Google Scholar] [CrossRef] [Scilit]
- Bergonzoni, L.; Alessandri, S.; Domenichini, C.; Dondini, L.; Caracciolo, G.; Pietrella, M.; Baruzzi, G.; Tartarini, S. Characterization of Red-Fleshed Pear Accessions from Emilia-Romagna Region. Sci. Hortic. 2023, 312, 111857. [Google Scholar] [CrossRef] [Scilit]
- Ganopoulos, I.; Tourvas, N.; Xanthopoulou, A.; Aravanopoulos, F.A.; Avramidou, E.; Zambounis, A.; Tsaftaris, A.; Madesis, P.; Sotiropoulos, T.; Koutinas, N. Phenotypic and Molecular Characterization of Apple (Malus × Domestica Borkh) Genetic Resources in Greece. Sci. Agric. 2018, 75, 509–518. [Google Scholar] [CrossRef] [Scilit]
- Irisarri, P.; Urrestarazu, J.; Ramos-Cabrer, A.; Pereira-Lorenzo, S.; Velázquez-Barrera, M.E.; Díaz-Hernández, M.B.; Dapena, E.; Urbina, V.; Dalmases, J.; Ríos-Mesa, D.; et al. Unlocking Spanish Pear Genetic Diversity: Strategies for Construction of a National Core Collection. Sci. Rep. 2024, 14, 26555. [Google Scholar] [CrossRef] [Scilit]
- Ferreira dos Santos, A.R.; Ramos-Cabrer, A.M.; Díaz-Hernández, M.B.; Pereira-Lorenzo, S. Genetic variability and diversification process in local pear cultivars from northwestern Spain using microsatellites. Tree Genet. Genomes 2011, 7, 1041–1056. [Google Scholar] [CrossRef] [Scilit]
- Sau, S.; Pastore, C.; D’hallewin, G.; Dondini, Λ.; Bacchetta, G. Characterisation of Microsatellite Loci in Sardinian Pears (Pyrus communis L. and P. spinosa Forssk.). Sci. Hortic. 2020, 270, 109443. [Google Scholar] [CrossRef] [Scilit]
- Baccichet, I.; Foria, S.; Messina, R.; Peccol, E.; Losa, A.; Fabro, M.; Gori, G.; Zandigiacomo, P.; Cipriani, G.; Testolin, R. Genetic and Ploidy Diversity of Pear (Pyrus spp.) Germplasm of Friuli Venezia Giulia, Italy. Genet. Resour. Crop Evol. 2020, 67, 83–96. [Google Scholar] [CrossRef] [Scilit]
- Sehic, J.; Garkava-Gustavsson, L.; Fernández-Fernández, F.; Nybom, H. Genetic Diversity in a Collection of European Pear (Pyrus communis) Cultivars Determined with SSR Markers Chosen by ECPGR. Sci. Hortic. 2012, 145, 39–45. [Google Scholar] [CrossRef] [Scilit]
- Puskás, M.; Höfer, M.; Sestraş, R.E.; Peil, A.; Sestraş, A.F.; Hanke, M.-V.; Flachowsky, H. Molecular and Flow Cytometric Evaluation of Pear (Pyrus L.) Genetic Resources of the German and Romanian National Fruit Collections. Genet. Resour. Crop Evol. 2015, 63, 1023–1033. [Google Scholar] [CrossRef] [Scilit]
- Gasi, F.; Kurtovic, M.; Kalamujic, B.; Pojskic, N.; Grahic, J.; Kaiser, C.; Meland, M. Assessment of European Pear (Pyrus communis L.) Genetic Resources in Bosnia and Herzegovina Using Microsatellite Markers. Sci. Hortic. 2013, 157, 74–83. [Google Scholar] [CrossRef] [Scilit]
- Queiroz, A.; Assunção, A.; Ramadas, I.; Viegas, W.; Veloso, M.M. Molecular Characterization of Portuguese Pear Landraces (Pyrus communis L.) Using SSR Markers. Sci. Hortic. 2015, 183, 72–76. [Google Scholar] [CrossRef] [Scilit]
- Queiroz, Á.; Guimarães, J.B.; Sánchez, C.; Simões, F.; Maia de Sousa, R.; Viegas, W.; Veloso, M.M. Genetic Diversity and Structure of the Portuguese Pear (Pyrus communis L.) Germplasm. Sustainability 2019, 11, 5340. [Google Scholar] [CrossRef] [Scilit]
- Stracieri, J.; Helida, M.M.; Luciane, V.R.; Luis, C.C.C. Simple sequence repeat (SSR) markers are effective for Identifying Pear Cultivars and Selections. Afr. J. Biotechnol. 2015, 14, 68-57. [Google Scholar] [CrossRef] [Scilit]
- Xue, L.; Liu, Q.; Qin, M.; Zhang, M.; Wu, X.; Wu, J. Genetic Variation and Population Structure of “Zangli” Pear Landraces in Tibet Revealed by SSR Markers. Tree Genet. Genomes 2017, 13, 26. [Google Scholar] [CrossRef] [Scilit]
- Xue, L.; Liu, Q.; Hu, H.; Song, Y.; Fan, J.; Bai, B.; Zhang, M.; Wang, R.; Qin, M.; Li, X.; et al. The Southwestern Origin and Eastward Dispersal of Pear (Pyrus pyrifolia) in East Asia Revealed by Comprehensive Genetic Structure Analysis with SSR Markers. Tree Genet. Genomes 2018, 14, 48. [Google Scholar] [CrossRef] [Scilit]
- Wahocho, S.A.; Cao, Y.-F.; Xu, J.-Y.; Qi, D.; Wahocho, N.A.; Gul, H.; Dong, X.-G.; Tian, L.; Huo, H.; Liu, C.; et al. Origin and Dissemination Route of Pear Accessions from Western China to Abroad Based on Combined Analysis of SSR and CpDNA Markers. Genet. Resour. Crop Evol. 2019, 67, 107–128. [Google Scholar] [CrossRef] [Scilit]
- Ouni, R.; Zborowska, A.; Sehic, J.; Choulak, S.; Hormaza, J.I.; Garkava-Gustavsson, L.; Mars, M. Genetic Diversity and Structure of Tunisian Local Pear Germplasm as Revealed by SSR Markers. Hortic. Plant J. 2020, 6, 61–70. [Google Scholar] [CrossRef] [Scilit]
- Bielsa, F.J.; Irisarri, P.; Errea, P.; Pina, A. Genetic Diversity and Structure of Local Pear Cultivars from Mountainous Areas from Aragon (Northeastern Spain). Agronomy 2021, 11, 1778. [Google Scholar] [CrossRef] [Scilit]
- Madesis, P.; Ganopoulos, I.; Tsaftaris, A. Microsatellites: Evolution and Contribution. Methods Mol. Biol. 2013, 1006, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Gianfranceschi, L.; Seglias, N.; Tarchini, R.; Komjanc, M.; Gessler, C. Simple Sequence Repeats for the Genetic Analysis of Apple. Theor. Appl. Genet. 1998, 96, 1069–1076. [Google Scholar] [CrossRef] [Scilit]
- Hokanson, S.C.; Szewc-McFadden, A.K.; Lamboy, W.F.; McFerson, J.R. Microsatellite (SSR) Markers Reveal Genetic Identities, Genetic Diversity and Relationships in a Malus × Domestica Borkh. Core Subset Collection. Theor. Appl. Genet. 1998, 97, 671–683. [Google Scholar] [CrossRef] [Scilit]
- Liebhard, R.; Gianfranceschi, L.; Koller, B.; Ryder, C.D.; Tarchini, R.; Van De Weg, E.; Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus × domestica Borkh.). Mol. Breed. 2002, 10, 217–241. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, T.; Kimura, T.; Shoda, M.; Imai, T.; Saito, T.; Sawamura, Y.; Kotobuki, K.; Hayashi, T.; Matsuta, N. Genetic linkage maps constructed by using SSR markers in apple and pear. Theor. Appl. Genet. 2002, 105, 104–111. [Google Scholar]
- Fernández-Fernández, F.; Harvey, N.G.; James, C.M. Isolation and Characterization of Polymorphic Microsatellite Markers from European Pear (Pyrus communis L.). Mol. Ecol. Notes 2006, 6, 1039–1041. [Google Scholar] [CrossRef] [Scilit]
- Hoffman, J.I.; Amos, W. Microsatellite Genotyping Errors: Detection Approaches, Common Sources and Consequences for Paternal Exclusion. Mol. Ecol. 2004, 14, 599–612. [Google Scholar] [CrossRef] [Scilit]
- Urrestarazu, J.; Royo, J.B.; Santesteban, L.G.; Miranda, C. Evaluating the Influence of the Microsatellite Marker Set on the Genetic Structure Inferred in Pyrus communis L. PLoS ONE 2015, 10, e0138417. PLoS ONE 2015, 10, e0138417. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research—An Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
- Liu, K.; Muse, S.V. PowerMarker: An Integrated Analysis Environment for Genetic Marker Analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [Scilit]
- Paetkau, D.; Calvert, W.; Stirling, I.; Strobeck, C. Microsatellite Analysis of Population Structure in Canadian Polar Bears. Mol. Ecol. 1995, 4, 347–354. [Google Scholar] [CrossRef] [Scilit]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Available online: https://www.R-project.org (accessed on 20 April 2025).
- Paradis, E.; Schliep, K. Ape 5.0: An Environment for Modern Phylogenetics and Evolutionary Analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schliep, K.P. Phangorn: Phylogenetic Analysis in R. Bioinformatics 2011, 27, 592–593. [Google Scholar] [CrossRef] [Scilit]
- Wickham, H.; Hester, J.; Bryan, J. Readr: Read Rectangular Text Data. R Package Version 1.3.1. Available online: https://CRAN.R-project.org/package=readr (accessed on 20 April 2025).
- Wickham, H. ggplot2; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
- Slowikowski, K. Ggrepel: Automatically Position Non-Overlapping Text Labels with ‘Ggplot2’. R Package Version 0.9.1. Available online: https://CRAN.R-project.org/package=ggrepel (accessed on 20 April 2025).
- Maechler, M.; Rousseeuw, P.; Struyf, A.; Hubert, M.; Hornik, K. Cluster: Cluster Analysis Basics and Extensions. R Package Version 2.1.4. Available online: https://CRAN.R-project.org/package=cluster (accessed on 20 April 2025).
- Kassambara, A.; Mundt, F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R Package Version 1.0.7. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 20 April 2025).
- Charrad, M.; Ghazzali, N.; Boiteau, V.; Niknafs, A. NbClust: An R Package for Determining the Relevant Number of Clusters in a Data Set. J. Stat. Softw. 2014, 61, 1–36. [Google Scholar] [CrossRef] [Scilit]
- Ganopoulos, I.; Moysiadis, T.; Xanthopoulou, A.; Ganopoulou, M.; Avramidou, E.; Aravanopoulos, F.A.; Tani, E.; Madesis, P.; Tsaftaris, A.; Kazantzis, K. Diversity of Morpho-Physiological Traits in Worldwide Sweet Cherry Cultivars of GeneBank Collection Using Multivariate Analysis. Sci. Hortic. 2015, 197, 381–391. [Google Scholar] [CrossRef] [Scilit]
- Sneath, P.H.A.; Sokal, R.R. Numerical Taxonomy: The Principles and Practice of Numerical Classification; Freeman: San Francisco, CA, USA, 1973. [Google Scholar]
- Paradis, E.; Claude, J.; Strimmer, K. APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 2004, 20, 289–290. [Google Scholar] [CrossRef] [Scilit]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A Program for Identifying Clustering Modes and Packaging Population Structure Inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Scilit]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the Number of Clusters of Individuals Using the Software Structure: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francis, R.M. pophelper: An R package and web app to analyse and visualize population structure. Mol. Ecol. Resour. 2017, 17, 27–32. [Google Scholar] [CrossRef] [Scilit]
- Pina-Martins, F.; Silva, D.N.; Fino, J.; Paulo, O.S. Structure_threader: An improved method for automation and parallelization of programs structure, fastStructure and MavericK on multicore CPU systems. Mol. Ecol. Resour. 2017, 17, e268–e274. [Google Scholar] [CrossRef] [Scilit]
- Evans, K.M.; Fernández-Fernández, F.; Govan, C. Harmonising Fingerprinting Protocols to Allow Comparisons between Germplasm Collections—Pyrus. Acta Hortic. 2009, 814, 103–106. [Google Scholar] [CrossRef] [Scilit]
- Jennings, T.N.; Knaus, B.J.; Mullins, T.D.; Haig, S.M.; Cronn, R.C. Multiplexed Microsatellite Recovery Using Massively Parallel Sequencing. Mol. Ecol. Resour. 2011, 11, 1060–1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mergeay, J. Population Size in Evolutionary Biology Is More than the Effective Size. Evol. Appl. 2024, 17, e70029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolko, Ł.; Bocianowski, J.; Antkowiak, W.; Słomski, R. Genetic Diversity and Population Structure of Wild Pear (Pyrus pyraster (L.) Burgsd.) in Poland. Cent. Eur. J. Biol. 2014, 10, 19–29. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Song, Y.; Liu, L.; Zhang, M.; Sun, J.; Zhang, S.; Wu, J. Genetic Diversity and Population Structure of Pear (Pyrus spp.) Collections Revealed by a Set of Core Genome-Wide SSR Markers. Tree Genet. Genomes 2015, 11, 128. [Google Scholar] [CrossRef] [Scilit]



| No | Accession Name | Origin | Group | No | Accession Name | Origin | Group |
|---|---|---|---|---|---|---|---|
| 1 | Duchesse d’Angulene | France | Cultivar | 27 | Bartlet | England | Cultivar |
| 2 | Pierre Cornell | France | Cultivar | 28 | Monglow | Maryland | Cultivar |
| 3 | Highland | England | Cultivar | 29 | Gentile Bianca | France | Cultivar |
| 4 | 44960 | Greece | Breeding line | 30 | Aromata Bistrita | Romania | Cultivar |
| 5 | 45078 | Greece | Breeding line | 31 | HW614 | Serbia | Cultivar |
| 6 | 45170 | Greece | Breeding line | 32 | Passa Crassana | France | Cultivar |
| 7 | Kontoula Pereas | Greece | Landrace | 33 | 45017 | Greece | Breeding line |
| 8 | 44929 | Greece | Breeding line | 34 | 45143 | Greece | Breeding line |
| 9 | Serpou | France | Landrace | 35 | 44986 | Greece | Breeding line |
| 10 | 45139 | Greece | Breeding line | 36 | 45146 | Greece | Breeding line |
| 11 | Beurré d’Hardenpont | France | Cultivar | 37 | 44933 | Greece | Breeding line |
| 12 | Basdouvaniko | Greece | Landrace | 38 | Coscia | Italy | Cultivar |
| 13 | 45020 | Greece | Breeding line | 39 | Decana d’ Inverno | Belgium | Cultivar |
| 14 | Avgoustiatiki | Greece | Landrace | 40 | Decana del Comicio | France | Cultivar |
| 15 | Harvest Queen | Canada | Cultivar | 41 | Santa Maria | Italy | Cultivar |
| 16 | 45176 | Greece | Breeding line | 42 | Karamanets Pcillares | Bulgary | Cultivar |
| 17 | Blanquilla | Spain | Cultivar | 43 | 45052 | Greece | Breeding line |
| 18 | 45047 | Greece | Breeding line | 44 | Conference | England | Cultivar |
| 19 | Packham’s Triumph | England | Cultivar | 45 | 45085 | Greece | Breeding line |
| 20 | Colette | USA | Cultivar | 46 | HW607 | Serbia | Cultivar |
| 21 | HW 611 | Serbia | Cultivar | 47 | 45084 | Greece | Breeding line |
| 22 | Sumandinka | Serbia | Cultivar | 48 | Abate Fetel | France | Cultivar |
| 23 | Kontoula Patron | Greece | Landrace | 49 | Grand Champion | USA | Cultivar |
| 24 | Kontoula Lechaiou | Greece | Landrace | 50 | Le Clerk | France | Cultivar |
| 25 | Favorita di claps | USA | Cultivar | 51 | Kastorias | Greece | Landrace |
| 26 | Spina Carpi | Italy | Cultivar |
| Primer | Dye | Repeat Motif | LG | Min | Max | Forward | Reverse | Tm | Bibliography | |
|---|---|---|---|---|---|---|---|---|---|---|
| Multiplex 1 | EMPc117 | FAM | (CT)17 | 7 | 85 | 135 | GTTCTATCTACCAAGCCACGCT | CGTTTGTGTGTTTTACGTGTTG | 61.8 | [20,36] |
| CH01d08 | FAM | (GA)n | 3/15 | 277 | 301 | CTCCGCCGCTATAACACTTC | TACTCTGGAGGGTATGTCAAAG | [32,34] | ||
| EMPc11 | TAMRA | (AC)13 | 11 | 135 | 155 | GCGATTAAAGATCAATAAACCCATA | AAGCAGCTGGTTGGTGAAAT | [20,36] | ||
| CH01f07a | TAMRA | CT | 10 | 175 | 211 | CCCTACACAGTTTCTCAACCC | CGTTTTTGGAGCGTAGGAAC | [34] | ||
| CH05c06 | ROX | GA | 16 | 111 | ATTGGAACTCTCCGTATTGTGC | ATCAACAGTAGTGGTAGCCGGT | [34] | |||
| Multiplex 2 | CH04e03 | FAM | (GA)n | 5 | 179 | 221 | TTGAAGATGTTTGGCTGTGC | TGCATGTCTGTCTCCTCCAT | 60.8 | [34] |
| CH03g07 | HEX | GA | 3 | 195 | 265 | AATAAGCATTCAAAGCAATCCG | TTTTTCCAAATCGAGTTTCGTT | [34] | ||
| GD147 | HEX | AG | 13 | 121 | 147 | TCCCGCCATTTCTCTGC | AAACCGCTGCTGCTGAAC | [33,35] |
| Locus | Na | Allele Fragment Size (bp) |
|---|---|---|
| CH03g07 | 2 | 206, 209 |
| CH04e03 | 4 | 172, 204, 213, 216 |
| GD147 | 3 | 159, 162, 167 |
| CH01d08 | 3 | 270, 281, 303 |
| CH01f07a | 3 | 169, 181, 191 |
| CH05c06 | 10 | 70, 71, 80, 87, 91, 92, 95, 100, 108, 118 |
| EMPc11 | 6 | 128, 129, 138, 142, 149, 150 |
| EMPc117 | 13 | 84, 85, 86, 103, 111, 113, 115, 129, 130, 131, 133, 136, 143 |
| Mean Values | Standard Error (SE) Values | ||
|---|---|---|---|
| Na | 5.500 | Na | 1.402 |
| Na Freq. ≥ 5% | 2.625 | Na Freq. ≥ 5% | 0.460 |
| Ne | 2.343 | Ne | 0.326 |
| I | 0.953 | I | 0.178 |
| No. Private Alleles | 5.500 | No. Private Alleles | 1.402 |
| No. LComm Alleles (≤25%) | 0 | No. LComm Alleles (≤25%) | 0 |
| No. LComm Alleles (≤50%) | 0 | No. LComm Alleles (≤50%) | 0 |
| He | 0.505 | He | 0.075 |
| uHe | 0.510 | uHe | 0.076 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deligiannidou, E.; Boutsika, A.; Plesias, I.; Xanthopoulou, A.; Moysiadis, T.; Mellidou, I.; Manthos, I.; Sotiropoulos, T.; Ganopoulos, I. Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants 2025, 14, 1816. https://doi.org/10.3390/plants14121816
Deligiannidou E, Boutsika A, Plesias I, Xanthopoulou A, Moysiadis T, Mellidou I, Manthos I, Sotiropoulos T, Ganopoulos I. Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants. 2025; 14(12):1816. https://doi.org/10.3390/plants14121816
Chicago/Turabian StyleDeligiannidou, Eleftheria, Anastasia Boutsika, Ioannis Plesias, Aliki Xanthopoulou, Theodoros Moysiadis, Ifigeneia Mellidou, Ioannis Manthos, Thomas Sotiropoulos, and Ioannis Ganopoulos. 2025. "Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection" Plants 14, no. 12: 1816. https://doi.org/10.3390/plants14121816
APA StyleDeligiannidou, E., Boutsika, A., Plesias, I., Xanthopoulou, A., Moysiadis, T., Mellidou, I., Manthos, I., Sotiropoulos, T., & Ganopoulos, I. (2025). Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants, 14(12), 1816. https://doi.org/10.3390/plants14121816

