Next Article in Journal
Comparative Transcriptome and Metabolome Profiling Revealed Molecular Cascade Events During the Enzymatic Browning of Potato Tubers After Cutting
Previous Article in Journal
The Use of DNA Markers in Rice Breeding for Blast Resistance and Submergence Tolerance as a Weed Control Factor
Previous Article in Special Issue
Genetic Diversity and Population Structure of Wild Ancient Camellia tetracocca in Pu’an, Guizhou, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection

by
Eleftheria Deligiannidou
1,
Anastasia Boutsika
1,
Ioannis Plesias
1,
Aliki Xanthopoulou
1,
Theodoros Moysiadis
1,2,
Ifigeneia Mellidou
1,
Ioannis Manthos
1,
Thomas Sotiropoulos
1 and
Ioannis Ganopoulos
1,*
1
Institute of Plant Breeding and Genetic Resources, ELGO DIMITRA, Thermi-Thermi Road, 570 01 Thermi, Thessaloniki, Greece
2
Department of Computer Science, School of Sciences and Engineering, University of Nicosia, Nicosia 2417, Cyprus
*
Author to whom correspondence should be addressed.
Plants 2025, 14(12), 1816; https://doi.org/10.3390/plants14121816
Submission received: 3 May 2025 / Revised: 9 June 2025 / Accepted: 12 June 2025 / Published: 13 June 2025
(This article belongs to the Special Issue Genetic Diversity and Population Structure of Plants)

Abstract

:
Pear (Pyrus communis L.) is a widely cultivated fruit tree species, valued for its significant economic impact and cultural relevance. The rise in commercial cultivars, characterized by genetic uniformity and high yield, is increasingly displacing traditional landraces. However, traditional varieties are highly adapted to local environmental conditions, having resulted from centuries of selection. In this study, 51 pear (Pyrus communis L.) accessions conserved in the Greek national germplasm collection were genotyped using eight SSR markers recommended by the European Cooperative Programme for Plant Genetic Resources (ECPGR). A total of 44 alleles were detected, including several private alleles, indicative of localized adaptation or potential genetic isolation. Analyses of population structure and genetic diversity, using Principal Coordinate Analysis (PCoA), UPGMA clustering, and Bayesian inference via STRUCTURE, uncovered distinct genetic groupings within the collection. The results revealed moderate genetic variability among the 51 accessions and identified some accessions with significant genetic divergence. These findings underscore the importance of conserving Greek pear germplasm, as it represents an ideal source of desirable traits, such as stress tolerance and fruit quality, which can be utilized in breeding programs.

1. Introduction

The pear (Pyrus communis L.), a member of the Rosaceae family, is a popular fruit known for its delicate taste and pleasant aroma. It is one of the oldest cultivated crops in the world, dating back almost 3000 years. The species is believed to have originated in the hilly regions of southwest China [1,2]. Cultivated species of the genus are primarily diploid and triploid, with a basic chromosome number of x = 17. Pears are highly valued as important temperate fruit trees [3,4,5]. However, human activities, agricultural practices, and urban development threaten wild Pyrus populations [6]. As a result, cultivated local wild varieties are at risk of extinction [7] or are being replaced by modern ones. This phenomenon reduces genetic variability and contributes to genetic erosion [8] as modern, high-yielding commercial varieties increasingly dominate the market [3,9].
Εx situ germplasm collections maintained in Gene Banks can preserve natural genetic materials with valuable characteristics [10,11], on which plant breeding programs heavily rely [12]. The Agricultural Research Service (USDA-ARS) of the US Department of Agriculture maintains the world’s largest pear gene bank in Oregon, with over 2500 distinct clones and seedlings [11,13]. In Greece, the only recognized repository for Pyrus germplasm is the Pomology Unit of the Institute of Plant Breeding & Genetic Resources (ELGO DIMITRA). Its pear collection includes both commercial cultivars and older accessions with valuable agronomic traits, including disease resistance and drought tolerance.
Gene banks are essential for safeguarding the rich diversity of pear varieties. Beyond their historical and cultural significance, older varieties, known as landraces, may harbor unique genetic resources that remain largely unexplored by breeders. These landraces can offer a valuable gene pool and hold the potential to improve future varieties by providing genes related to environmental stresses, longer shelf life, earlier ripening, and unique characteristics such as red-fleshed fruit, even though they might not always display superior commercial traits [14]. Due to the region’s unique environmental conditions and centuries of traditional cultivation, Greek pear germplasm stands out as a distinct genetic pool. Thus, our study emphasizes the uniqueness of Greek germplasm as a genetic resource and highlights the impact of local, environmental, and historical factors on its development. Its distinction from the broader USDA pear collection, along with its genetic characterization, is crucial to preventing genetic erosion and to preserving pear biodiversity at the national level [15,16].
Numerous studies have characterized national germplasm collections of pears in various countries, including Spain [16,17,18], Italy [19], Sweden [20], Germany, and Poland [21]. These studies reveal that the genetic diversity of pears can be effectively estimated using comprehensive Simple Sequence Repeats (SSR) analysis [11,20,22,23,24,25,26,27,28,29,30], as SSR markers are reproducible, multiallelic, codominant, abundant, and provide good genome coverage [31].
In this study, we assessed the genetic diversity of Greek pear cultivars from the Greek National Collection using SSR markers, in accordance with the guidelines of the European Cooperative Program for Plant Genetic Resources (ECPGR). The main objective was to gain insight into the genetic identity of 51 pear accessions from this collection and to apply this knowledge to breeding programs and conservation initiatives.

2. Materials and Methods

2.1. Plant Material and DNA Extraction

A total of 51 accessions of P. communis were analyzed in this study (Table 1). Among them, there were 6 local varieties, 16 breeding lines, and 29 international cultivars. Samples were collected from their historical regions of origin and have been maintained in the Greek National Pear Collection for over 10 years. The collection is located at the Institute of Plant Breeding and Genetic Resources (IPGRB)-Pomology Unit, ELGO DIMITRA, in Naoussa.
Young leaves from each variety were collected, snap-frozen, and stored at −20 °C until DNA extraction. Genomic DNA was extracted using the Higher Purity™ Plant DNA Purification Kit (Canvax Biotech, Valladolid, Spain), following the manufacturer’s instructions.

2.2. Microsatellite Genotyping

A set of 8 microsatellite markers were selected for genotyping. Two multiplex PCR assays were designed, each containing a panel of SSR markers. The fluorophores used for labeling the SSR markers were FAM, ROX, TAMRA, and HEX, which facilitated the simultaneous detection of multiple loci within a single reaction. The details of the SSR markers [20,32,33,34,35,36], including their names, dye labels, amplicon size ranges (min-max), and sequences of forward (F) and reverse (R) primers, are listed in Table 2 for Multiplex 1 and Multiplex 2. Multiplex Set 1 includes the primers EMPc117 (Tm: 61.8 °C, Dye: FAM, Allelic Range: 85–135 bp), CH01d08 (Dye: FAM, Allelic Range: 277–301 bp), EMPc1 (Dye: TAMRA, Allelic Range: 135–155 bp), CH01f07a (Dye: TAMRA, Allelic Range: 175–211 bp), and CH05c06 (Dye: ROX, Allelic Range: 83–111 bp). Multiplex Set 2 includes CH04e03 (Dye: FAM, Allelic Range: 179–221 bp), CH03g07 (Tm: 60.8 °C, Dye: HEX, Allelic Range: 195–265 bp), and GD147 (Dye: HEX, Allelic Range: 121–147 bp). These combinations were selected based on compatibility in melting temperatures, non-overlapping allelic size ranges, and distinct fluorescent dye labeling to ensure accurate and efficient fragment analysis.
Ninety-eight PCR reactions were performed in total. Each reaction had a total volume of 10 μL, consisting of 5 μL of KAPA2G Fast Multiplex PCR Mix (2×), 1 μL of template DNA (100 ng/μL), 0.2 μL of each forward (10 mM), and 0.2 μL of each reverse primer (10 mM) mix. Finally, nuclease-free water was added to reach the final volume of 10 μL. The thermal cycling conditions for PCR amplification were optimized for each multiplex and are summarized below. For Multiplex 1: Initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 61.8 °C for 30 s, and extension at 72 °C for 30 s, repeated for 35 cycles, with a final extension at 72 °C for 10 min. For Multiplex 2: Initial denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 60.8 °C for 45 s, and extension at 72 °C for 1 min, repeated for 30 cycles, with a final extension at 72 °C for 7 min.
The PCR products were separated and detected using capillary electrophoresis. Fragment analysis was conducted in an ABI 3730xl (Applied Biosystems, Foster City, CA, USA) with GeneScan 500 LIZ size standard, and results were recorded with GeneMapper v4. Cultivar reference samples were genotyped twice to avoid sample mix-up (two independent DNA extractions and PCR amplifications). PCR amplifications were repeated for a random sample of 5 individuals (~10% of the whole dataset). The data were used to calculate the error rate (~2%): (i) per reaction and (ii) per allele [37].
To test whether the eight microsatellite loci were informative enough to distinguish the pear accessions, statistical re-sampling showed that these microsatellite loci were sufficient to ensure identification. According to the discriminating power value for each locus, we tested combinations starting with the most discriminating and adding one locus at each step. The optimal combination (CH03g07 + CH04e03 + GD147 + CH01d08 + CH01f07a + CH05c06 + EMPc11 + EMPc117) successfully discriminated all analyzed accessions analyzed. Using this locus combination, we observed a low probability of identity (PI = 3.9 × 10−5; Table 2). Also, for the Pyrus genus, as few as six microsatellite markers can be sufficient to facilitate cross-comparisons between collections in order to detect duplicates and synonyms with minimal chance of misidentifying a genotype with a randomly selected one from a larger sample [38].

2.3. Data Analysis

Genetic diversity estimates, including number of alleles (Na), private alleles (Np), Shannon’s index (I), and expected heterozygosity (He), were calculated using GenAlEx 6.51b2 software [39]. Polymorphic Information Content (PIC) values for each microsatellite marker were calculated using PowerMarker v3.25 software [40] to assess the discriminatory power of different SSR primers. The probability of identity (PI) measures the probability that two randomly drawn diploid genotypes will be identical, assuming the observed allele frequencies and random assortment [41]. The total probability of identity, defined as the probability of two cultivars sharing the same genetic profile by chance, was also calculated from the individual PI values. PI was calculated by IDENTITY 1.0 (Centre for Applied Genetics, University of Agricultural Sciences, Vienna, Austria). The allelic data generated by fragment analysis were examined with GenAlEx [39], STRUCTURE program [42], and RStudio version 4.3.1 [43] to assess genetic diversity, population structure, and other significant characteristics. The R packages used for the genetic analysis were ape [44], phangorn [45], readr [46], ggplot2 [47], ggrepel [48], cluster [49], factoextra [50], and NbClust [51]. A Principal Coordinate Analysis (PCoA) was conducted to evaluate genetic relationships among the 51 pear accessions, which included both local and commercial cultivars, using both GenAlEx and R for complementary visualizations. Specifically, it was conducted on the SSR genotypic matrix, formatted specifically for compatibility with GenAlEx (Genetic Analysis in Excel) software [39] to determine the proportion of variation explained by each primary coordinate, thus allowing the multivariate statistical analysis of many variables [7,52]. Furthermore, a pairwise Euclidean distance matrix was calculated from the scaled genotype matrix, utilizing the classical multidimensional scaling function cmdscale() from the base R stats package [43]. Eigenvalues were obtained to determine the proportion of variance attributed to each principal coordinate axis. The PCoA scatterplot was generated utilizing ggplot2 [47], with sample points distinguished by population grouping and selectively annotated through the ggrepel package [48]. A scree plot was created to illustrate the variance accounted for by the initial 13 axes. All analyses were conducted utilizing R version 4.x.
Hierarchical clustering was conducted using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) to investigate the genetic structure of a single pear population. The analysis utilized a Euclidean distance matrix obtained from standardized SSR marker data. The preprocessing steps involved averaging the values of duplicated markers, substituting missing values (coded as -9) with the mean of the respective marker column, and eliminating loci exhibiting no variation. The dataset underwent standardization through z-score transformation to normalize markers and ensure uniform weighting. A Euclidean distance matrix was generated from the scaled data utilizing the dist() function in R. UPGMA clustering was performed utilizing the hclust() function, with the method specified as “average,” aligning with UPGMA, as described by Sneath and Sokal [53]. The hierarchical clustering result was transformed into a phylogenetic tree object utilizing the as.phylo() function from the ape package [54], facilitating enhanced formatting and visualization of the dendrogram.
All samples originated from a single population and were represented using a consistent color scheme for tip labels. The dendrogram was exported in high resolution via the png() graphics device, with enhanced font sizes and spacing to ensure clarity in label presentation. This method facilitated the identification of genetic subgroups and outlier genotypes within the examined population.
The ‘admixture’ and ‘independent allele frequencies’ models were used to run STRUCTURE 2.3.4 [42]. A burn-in of 200,000 iterations and 500,000 MCMC repetitions for each run were executed, with 20 replicates from K = 1 up to K = 8. The CLUMPAK main pipeline [55] was used to merge replicate runs, and the optimal K value was inferred using Evanno’s method [56], which was run in the pophelper 2.3.0 R package [57]. The software Structure threader [58] was used to parallelize computations. The terms “populations” and “subpopulations” used throughout the manuscript refer exclusively to the genetic clusters inferred from STRUCTURE analysis. No a priori grouping was applied; the structure was inferred de novo based on multilocus genotype data using the admixture model.

3. Results

The total number of distinct alleles (Na), alleles with a frequency ≥ 5% (Na Freq. ≥ 5%), effective number of alleles (Ne), Shannon’s Information Index (I), expected heterozygosity (He), and its unbiased version (uHe) were among the key parameters used to evaluate the genetic variation in P. communis genotypes across various loci (Table 3). Private alleles and the presence of locally common alleles (No. LComm Alleles) were also assessed to provide insights into genetic diversity and population structure (Table 4).
The entire collection of IPGRB accessions was used, and across all loci, a total of 44 distinct alleles (Na) were detected, with 21 of these having a frequency of ≥5%. The effective number of alleles (Ne), a measure of allelic diversity, was also 44, reflecting a moderate level of genetic diversity within the collection. Nevertheless, neither 25% nor 50% of the population showed evidence of regionally common alleles, suggesting limited gene flow or exchange between subpopulations and indicating potential genetic isolation within specific regions. Averaged across all loci, each genetic locus exhibited approximately 5.5 distinct alleles (Na), with 2.6 alleles occurring at frequencies ≥ 5% and a range of 2 (locus CH03g07) to 13 (locus EMPc117). Although the total number of alleles detected was 44, the effective number of alleles (Ne) averaged 2.34, suggesting that, despite the presence of a variety of alleles, only a smaller subset contributes effectively to the genetic variation within the collection, meaning that some alleles were rare and contributed little to diversity.
Shannon’s Information Index (I) averaged 0.953 across loci, indicating a moderate degree of genetic diversity, as a higher value would imply greater genetic variety. On average, the expected heterozygosity (He), which estimates the probability that two randomly selected alleles are different, was 0.505, while the unbiased expected heterozygosity (uHe) had a similar value of 0.510. These heterozygosity values suggest a moderate level of genetic variability within the collection. The total value of the probability of identity was a total of 3.9 × 10−5.
Notably, no regionally common alleles were detected at any significant frequency, further supporting the notion that the collection is genetically diverse but exhibits limited allele sharing among its subgroups. This is also reflected in the presence of several private alleles associated with specific accessions that clustered separately and belonged to certain subpopulations, indicating that some genotypes possess distinctive allelic combinations not widely distributed across the collection.
Principal Coordinate Analysis (PCoA), utilizing pairwise genetic distances among 51 pear accessions, revealed a distinct genetic structure. A total of 40.2% of the genetic variance was explained by the first two PCoA axes, with PCoA1 contributing 23.3% and PCoA2 contributing 16.9% (Figure 1). The clustering of the majority of individuals in the center of the PCoA plot indicates minimal genetic differentiation among the accessions. However, three genotypes, ‘Highland’, ‘Kontoula_Patron’, and ‘Kastorias’, located outside the central cluster, suggest increased genetic divergence. ‘Highland’ showed significant separation along the PCoA1 axis, whereas ‘Kontoula_Patron’ demonstrated a clear distinction along PCoA2. ‘Kastorias’ was positioned on the far left of the plot, deviating from both axes. This distinction highlights their potential singularity within the broader collection. This conclusion was supported by the scree plot, which indicates that the initial PCoA axes accounted for the majority of genetic variation, with eigenvalues declining significantly after the third axis. The most significant contributors to the first principal coordinate axis (PCoA1) among the examined SSR loci were found to be CH05c06 and EMPc117, whereas those to the second axis (PCoA2) were found to be CH01d08 and CH03g07. These loci exhibited the strongest associations with the spatial distribution of accessions in the PCoA plot, as derived from the coordinate loadings calculated in GenAlEx. The high influence of CH05c06 and EMPc117 aligns with their high allelic richness and variability, further supporting their discriminating power in revealing population structure.
The UPGMA dendrogram (Figure 2) demonstrated moderate genetic diversity among the accessions, even though they originated from a single population. Several genotypes, including ‘Kontoula Patron’, ‘Highland’, and ‘45047’, exhibited distinct and elongated branches, indicating greater genetic divergence from the remaining group. Furthermore, many accessions were grouped into closely related subgroups, suggesting a higher degree of genetic similarity. Despite the uniform color of all samples, the branching pattern revealed internal genetic differentiation. The tree structure provided valuable insights into the relationships among genotypes and can support future conservation and varietal selection efforts within this collection.
Analysis of population structure utilizing the Bayesian clustering method in STRUCTURE revealed that the optimal number of genetic clusters is K = 2 and identified two subpopulations, corroborated by the highest ΔK value (Figure 3). At this level, individuals were distinctly categorized into two primary groups. The initial group (Cluster 1, shown in blue) includes accessions such as Kontoula_Patron, Kastorias, and Highland, which were clearly classified with high membership coefficients. Cluster 2, represented in red, comprises the majority of the remaining samples, indicating a more genetically homogeneous group. Several accessions, including Aromata Bistrite, Le Clerk, and Spina Carpi, showed a notable presence in Cluster 1, despite previously being grouped with other accessions based on their geographic origin or cultivar classification. This pattern suggests potential admixture or a distinct genetic lineage, a phenomenon also reported in similar studies [11,23]. Subsequent STRUCTURE analyses at K = 3, 4, and 5 revealed further sub-structuring while maintaining consistency with the primary division observed at K = 2. Rather than indicating entirely new groupings, the higher K values revealed more diffuse patterns of differentiation, likely reflecting minor genetic variation resulting from cultivar development or local selection pressures.
The structure-based groupings received robust support from both Principal Coordinate Analysis (PCoA) and the UPGMA dendrogram, indicating the existence of two primary genetic groups within the dataset, with some individuals positioned at intermediate or divergent points. The PCoA plot (Figure 1) showed that Kontoula_Patron and Highland are distinct outliers along the PCoA1 axis, highlighting their genetic uniqueness. In line with the STRUCTURE results, the UPGMA dendrogram (Figure 2) distinctly clustered ‘Kontoula_Patron’, ‘Kastorias’, and ‘Highland’ apart from the main group, confirming their genetic divergence. Most genotypes from Cluster 2 belong to a robust clade, consistent with their shared ancestry.

4. Discussion

We characterized 51 pear accessions of the Greek Gene Bank collection using a set of eight SSR markers, which are broadly recommended by ECPGR and are suitable for the study of pear genetic resources [59]. The primary goal of this research was to gain insight into the genetic identity of the Greek collection of pears and utilize this information for breeding programs and conservation initiatives. The characterization of pear germplasm with SSR markers has already taken place for multiple pear collections worldwide (Table 5). In conservation genetic studies, where a large number of samples are studied, the use of SSR markers represents a suitable choice, as it is also the most economically beneficial option [60].
We have identified 44 distinct alleles across loci with an average of 5.5 alleles per locus. Regarding the number of alleles, by using a similar set of markers, other researchers came to different conclusions. Specifically, Queiroz et al. [23] characterized 54 Portuguese pear accessions with six SSR markers and detected 68 alleles with 11.3 alleles per locus; Sehic et al. [20] analyzed a European pear collection of 94 samples with 10 SSR markers and reported 104 alleles with 10.4 alleles per locus. Furthermore, Gasi et al. [22] studied 64 European pear accessions from Bosnia and Herzegovina using 13 microsatellite markers and found 159 alleles and 14.5 alleles per locus, while Kocsisné et al. [11] identified 216 alleles with 27 alleles per locus after the analysis of 88 cultivars from the Hungarian pear gene bank with eight SSR markers.
The effective number of alleles (Ne), with a value of 44, being equal to the total number of distinct alleles (Na) suggests that all detected alleles contribute to genetic diversity. However, with a mean of 2.43, it became clear that only a small portion of the total alleles contributed successfully to the genetic variation within the collection [61], which is similar to findings where the effective number of alleles was lower than the total number detected [18]. The mean of 5.5 distinct alleles per locus, ranging from 2 to 13, reflects the variability in genetic diversity across different loci, which is crucial for understanding the genetic structure and potential for breeding programs [11,26].
Considering the private alleles, the highest value (13) was found for the EMPc117 locus, while the lowest (2) was detected for the CH03g07 locus. Private alleles that are specific to a single wild pear collection can be used to estimate migration rates and quantify the genetic distinctiveness of the marker for the collections that are under investigation [62]. The presence of private alleles associated with specific accessions demonstrates that certain genotypes possess unique allelic combinations [27]. Furthermore, the average expected heterozygosity (He) was 0.505, which was relatively low compared to the mean values reported by Queiroz et al. [23,24] and Kocsisné et al. [11].
For specific loci, the effective number of alleles (Ne) and Shannon’s Information Index (I) varied from 1.104 and 0.229 (locus CH01d08) to 3.480 and 1.609 (locus CH05c06), respectively. In general, the CH01d08 locus displayed the lowest values among the loci examined and the CH05c06 locus suggested a high degree of genetic variety. This agrees with Queiroz et al. [23,24], who found similar values for this specific locus for the total (Na = 11.3, Na = 11) and effective (Ne = 3.3, Ne = 3.034) alleles, respectively. On the contrary, Kocsisné et al. [11] had nearly double these values for the CH05c06 locus. Generally, to improve the molecular identification of pear cultivars, it is necessary to have common guidelines among studies, because differing methodologies make it difficult to compare the results and create common databases [3]. Finally, there is also a need to include reference samples [11].
The PCoA effectively demonstrated a distinct genetic structure. The distinct positioning of the genotypes ‘Highland’, ‘Kontoula_Patron’, and ‘Kastorias’ outside the central cluster highlights their genetic divergence, further supporting the identification of separate evolutionary processes among different pear species, indicating that certain cultivars may have unique genetic backgrounds [30].
By performing the UPGMA phylogenetic analysis, we found moderate genetic diversity among the genotypes, which shows that genetic diversity can be significant even within a single population and suggests that environmental and geographic factors contribute to genetic differentiation [30]. Our pear germplasm showed a moderate level of genetic diversity overall, enough variation to support breeding and conservation efforts, while also containing some significantly divergent accessions, ‘Kontoula Patron’, ‘Highland’, and ‘45047’, that might be prioritized as reservoirs of unique alleles. This large genetic distance could also be due to hybridization with other Pyrus species, as reported by Bergonzoni et al. [14] for the cultivars ‘Cocomerina Selvatica La Casa’ (CS) and ‘Incrocio S. Alessio’ (IA). The determination of the genetic identity of these local cultivars is highly important for their conservation, as they adapt to distinct climatic conditions [8]. Understanding genetic relationships is crucial for maintaining diversity and selecting appropriate cultivars for breeding programs [30].
STRUCTURE analysis identified the optimal number of genetic clusters as K = 2, and this finding aligns with other studies, where similar Bayesian clustering methods revealed distinct genetic groupings within pear germplasm collections, supporting the utility of Bayesian methods in understanding population structure [63]. The clear categorization of accessions into two primary clusters reflects the genetic uniqueness of cultivars such as Kontoula_Patron and Highland, which may represent distinct genetic lineages [30]. The presence of significant admixture, where accessions such as Aromata Bistrite and Le Clerk were historically grouped with others based on geographic origin, suggests complex genetic relationships.
The results of the present study assessed the structure of the Greek pear germplasm collection and revealed valuable genetic diversity. The genetic-based clustering of the Greek pear germplasm collection uncovered high variability in pear cultivation in Greece, as well as the existence of plant material exchange between different regions. The presence of genetic variation is of utmost importance for a deeper understanding of the origin and evolution of traditional cultivars. Specifically, accessions carrying private alleles or showing unique genetic profiles may contain traits of agronomic importance, such as adaptation to local climatic conditions or resistance to biotic and abiotic stress factors, and the presence of private or rare alleles can be exploited in breeding programs. In addition, the use of microsatellite markers enhances the analysis of the genetic structure of the Greek pear germplasm collection. This acquisition of genetic data can contribute to the identification of duplicate entries, the verification of accession identity, and the development of a representative core collection. Given the impending climate change, which necessitates the utilization of biodiversity, all the above applications are of paramount importance for the conservation of Greek pear genetic resources. The present study serves as a springboard for the detailed phenotypic characterization and the implementation of traditional pear varieties in sustainable breeding programs.
Table 5. Data from other publications regarding the pear accessions and species, number of accessions, number of SSR markers, total number of alleles, Na (Mean number of alleles), Ne (Effective number of alleles), and He (Expected heterozygosity).
Table 5. Data from other publications regarding the pear accessions and species, number of accessions, number of SSR markers, total number of alleles, Na (Mean number of alleles), Ne (Effective number of alleles), and He (Expected heterozygosity).
PublicationPear AccessionsPear SpeciesNumber of AccessionsNumber of SSR MarkersTotal Number of AllelesNaNe He
[11]Portuguese pear landracesP. communis88821627-0.88
[18]Local Pear Cultivars (Aragon, Northeastern
Spain)
P. communis, P. spinosa108916218.118.450.83
[20]Pear cultivars in Central EuropeP. communis94108410.5-0.78
[22]European pear (Bosnia and Herzegovina)P. communis641315914.5--
[23]Chinese National Pear Germplasm Repository
(Wuhan)
P. communis5466811.35.80.806
[24]Pear collectionsP. communis1301112911.75.80.79
[25]Sardinian pearsP. spp.1921---0.3
[26]“Zangli” pear landraces (Tibet)P. spp.67282027.214.070.72
[27]Pear germplasm collection (Tunisia)P. pyrifolia, P. pashia478171217.126.360.78
[28]Chinese National Germplasm Repository of Pear
(Xingcheng, China)
P. spp.1311737722.177.770.86
[29]Pear cultivars (Minas Gerais State, Brazil)P. spp.6112959.53.30.62
[30]Collection of European pear cultivarsP. communis2521425117.936.830.82
[63]Portuguese pear germplasmP. spp.3851346905.45-0.74

5. Conclusions

Taken together, this study utilized eight SSR markers to identify an overall moderate genetic differentiation between the 51 P. communis accessions maintained in the national collection. Among the accessions, there were some significantly divergent ones, ‘Kontoula Patron’, ‘Highland’, and ‘45047’, which can be used as a source for unique alleles. The importance of this study for future breeding and conservation strategies is highlighted by the observed variations in expected heterozygosity and the presence of private alleles, which were detected in genetically distinct genotypes (e.g., ‘Highland’, ‘Kontoula Patron’) and whose presence, albeit in a conserved collection, likely reflects their origin from historically isolated environments. To gain more insight regarding genetic diversity and the possibilities for breeding enhancement, additional markers and a broader range of pear accessions should be selected and utilized for future research.

Author Contributions

E.D. was in charge of preparing the manuscript and carrying out the molecular analysis. I.P. assisted with molecular analysis. A.B. helped gather and analyze the data. A.X. and I.M. (Ifigene Mellidou) supervised the manuscript, providing critical feedback. T.M. helped with software and Data curation. T.S. and I.M. (Ioannis Manthos) was in charge of sample collection, while I.G. was the corresponding author and directed the study’s overall coordination. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

For the preparation and the availability of the research material, the authors are grateful to the Greek National Pear Collection, located at the Institute of Plant Breeding and Genetic Resources (IPGRB)-Pomology Institute, ELGO DIMITRA, Naoussa.

Conflicts of Interest

The authors declared that there is no conflict of interest.

References

  1. Simmonds, N.W. Origin and Geography of Cultivated Plants, by N. I. Vavilov. Xxxi + 498 pp. Cambridge: Cambridge University Press (1993). J. Agric. Sci. 1993, 120, 419–420. [Google Scholar] [CrossRef]
  2. Hancock, J.F.; Lobos, G.A. Pears. In Temperate Fruit Crop Breeding; Hancock, J.F., Ed.; Springer: Berlin/Heidelberg, Germany, 2008; pp. 299–336. [Google Scholar] [CrossRef]
  3. Draga, S.; Palumbo, F.; Barbagiovanni, I.M.; Pati, F.; Barcaccia, G. Management of Genetic Erosion: The (Successful) Case Study of the Pear (Pyrus communis L.) Germplasm of the Lazio Region (Italy). Front. Plant Sci. 2023, 13, 1099420. [Google Scholar] [CrossRef]
  4. Pérez-Sánchez, R.; Morales-Corts, M.R. Agromorphological and Chemical Characterization of Pear Cultivars Grown in Central–West Iberian Peninsula. Agronomy 2023, 13, 2993. [Google Scholar] [CrossRef]
  5. Pang, X.; Jia, M.; Zhang, Y.; Chen, M.; Miao, P.; Cheng, W.; Zhou, Z.; Zhang, Q.; Ye, J.; Li, J.; et al. Dynamic Interplay between Soil Microbial Communities, Enzyme Activities, and Pear Quality across Planting Years. Front. Microbiomes 2024, 3, 1381270. [Google Scholar] [CrossRef]
  6. Waite, J.M.; Gottschalk, C.; Reinhold, L.A.; Bassil, N.V.; Volk, G.M.; Postman, J.D.; Elkins, R.B.; Bell, R.L. Vulnerability of Pear (Pyrus) Genetic Resources in the U.S. Genet. Resour. Crop Evol. 2024, 72, 815–843. [Google Scholar] [CrossRef]
  7. Ganopoulos, I.V.; Kazantzis, K.; Chatzicharisis, I.; Karayiannis, I.; Tsaftaris, A.S. Genetic Diversity, Structure and Fruit Trait Associations in Greek Sweet Cherry Cultivars Using Microsatellite Based (SSR/ISSR) and Morpho-Physiological Markers. Euphytica 2011, 181, 237–251. [Google Scholar] [CrossRef]
  8. Velázquez-Barrera, M.E.; Ramos-Cabrer, A.M.; Pereira-Lorenzo, S.; Ríos-Mesa, D.J. Genetic Pool of the Cultivated Pear Tree (Pyrus spp.) in the Canary Islands (Spain), Studied Using SSR Molecular Markers. Agronomy 2022, 12, 1711. [Google Scholar] [CrossRef]
  9. Ferradini, N.; Lancioni, H.; Torricelli, R.; Russi, L.; Dalla Ragione, I.; Cardinali, I.; Marconi, G.; Gramaccia, M.; Concezzi, L.; Achilli, A.; et al. Characterization and Phylogenetic Analysis of Ancient Italian Landraces of Pear. Front. Plant Sci. 2017, 8, 751. [Google Scholar] [CrossRef]
  10. Labuschagne, I.; Musacchi, S.; Nyéki, J.; Szabó, Z.; Szabó, T. The Hungarian Pear Germplasm (Pyrus communis) as Source of Genetic Variability for Breeding Programs. Acta Hortic. 2011, 909, 89–95. [Google Scholar] [CrossRef]
  11. Kocsisné, G.M.; Bolla, D.; Ulrike; Forneck, A.; Taller, J.; Kocsis, L. Genetic Diversity and Similarity of Pear (Pyrus communis L.) Cultivars in Central Europe Revealed by SSR Markers. Genet. Resour. Crop Evol. 2020, 67, 1755–1763. [Google Scholar] [CrossRef]
  12. Erfani, J.; Ebadi, A.; Abdollahi, H.; Fatahi, R. Genetic Diversity of Some Pear Cultivars and Genotypes Using Simple Sequence Repeat (SSR) Markers. Plant Mol. Biol. Report. 2012, 30, 1065–1072. [Google Scholar] [CrossRef]
  13. Montanari, S.; Postman, J.; Bassil, N.V.; Neale, D.B. Reconstruction of the Largest Pedigree Network for Pear Cultivars and Evaluation of the Genetic Diversity of the USDA-ARS National Pyrus Collection. G3 Genes Genomes Genet. 2020, 10, 3285–3297. [Google Scholar] [CrossRef]
  14. Bergonzoni, L.; Alessandri, S.; Domenichini, C.; Dondini, L.; Caracciolo, G.; Pietrella, M.; Baruzzi, G.; Tartarini, S. Characterization of Red-Fleshed Pear Accessions from Emilia-Romagna Region. Sci. Hortic. 2023, 312, 111857. [Google Scholar] [CrossRef]
  15. Ganopoulos, I.; Tourvas, N.; Xanthopoulou, A.; Aravanopoulos, F.A.; Avramidou, E.; Zambounis, A.; Tsaftaris, A.; Madesis, P.; Sotiropoulos, T.; Koutinas, N. Phenotypic and Molecular Characterization of Apple (Malus × Domestica Borkh) Genetic Resources in Greece. Sci. Agric. 2018, 75, 509–518. [Google Scholar] [CrossRef]
  16. Irisarri, P.; Urrestarazu, J.; Ramos-Cabrer, A.; Pereira-Lorenzo, S.; Velázquez-Barrera, M.E.; Díaz-Hernández, M.B.; Dapena, E.; Urbina, V.; Dalmases, J.; Ríos-Mesa, D.; et al. Unlocking Spanish Pear Genetic Diversity: Strategies for Construction of a National Core Collection. Sci. Rep. 2024, 14, 26555. [Google Scholar] [CrossRef]
  17. Ferreira dos Santos, A.R.; Ramos-Cabrer, A.M.; Díaz-Hernández, M.B.; Pereira-Lorenzo, S. Genetic variability and diversification process in local pear cultivars from northwestern Spain using microsatellites. Tree Genet. Genomes 2011, 7, 1041–1056. [Google Scholar] [CrossRef]
  18. Sau, S.; Pastore, C.; D’hallewin, G.; Dondini, Λ.; Bacchetta, G. Characterisation of Microsatellite Loci in Sardinian Pears (Pyrus communis L. and P. spinosa Forssk.). Sci. Hortic. 2020, 270, 109443. [Google Scholar] [CrossRef]
  19. Baccichet, I.; Foria, S.; Messina, R.; Peccol, E.; Losa, A.; Fabro, M.; Gori, G.; Zandigiacomo, P.; Cipriani, G.; Testolin, R. Genetic and Ploidy Diversity of Pear (Pyrus spp.) Germplasm of Friuli Venezia Giulia, Italy. Genet. Resour. Crop Evol. 2020, 67, 83–96. [Google Scholar] [CrossRef]
  20. Sehic, J.; Garkava-Gustavsson, L.; Fernández-Fernández, F.; Nybom, H. Genetic Diversity in a Collection of European Pear (Pyrus communis) Cultivars Determined with SSR Markers Chosen by ECPGR. Sci. Hortic. 2012, 145, 39–45. [Google Scholar] [CrossRef]
  21. Puskás, M.; Höfer, M.; Sestraş, R.E.; Peil, A.; Sestraş, A.F.; Hanke, M.-V.; Flachowsky, H. Molecular and Flow Cytometric Evaluation of Pear (Pyrus L.) Genetic Resources of the German and Romanian National Fruit Collections. Genet. Resour. Crop Evol. 2015, 63, 1023–1033. [Google Scholar] [CrossRef]
  22. Gasi, F.; Kurtovic, M.; Kalamujic, B.; Pojskic, N.; Grahic, J.; Kaiser, C.; Meland, M. Assessment of European Pear (Pyrus communis L.) Genetic Resources in Bosnia and Herzegovina Using Microsatellite Markers. Sci. Hortic. 2013, 157, 74–83. [Google Scholar] [CrossRef]
  23. Queiroz, A.; Assunção, A.; Ramadas, I.; Viegas, W.; Veloso, M.M. Molecular Characterization of Portuguese Pear Landraces (Pyrus communis L.) Using SSR Markers. Sci. Hortic. 2015, 183, 72–76. [Google Scholar] [CrossRef]
  24. Queiroz, Á.; Guimarães, J.B.; Sánchez, C.; Simões, F.; Maia de Sousa, R.; Viegas, W.; Veloso, M.M. Genetic Diversity and Structure of the Portuguese Pear (Pyrus communis L.) Germplasm. Sustainability 2019, 11, 5340. [Google Scholar] [CrossRef]
  25. Stracieri, J.; Helida, M.M.; Luciane, V.R.; Luis, C.C.C. Simple sequence repeat (SSR) markers are effective for Identifying Pear Cultivars and Selections. Afr. J. Biotechnol. 2015, 14, 68-57. [Google Scholar] [CrossRef]
  26. Xue, L.; Liu, Q.; Qin, M.; Zhang, M.; Wu, X.; Wu, J. Genetic Variation and Population Structure of “Zangli” Pear Landraces in Tibet Revealed by SSR Markers. Tree Genet. Genomes 2017, 13, 26. [Google Scholar] [CrossRef]
  27. Xue, L.; Liu, Q.; Hu, H.; Song, Y.; Fan, J.; Bai, B.; Zhang, M.; Wang, R.; Qin, M.; Li, X.; et al. The Southwestern Origin and Eastward Dispersal of Pear (Pyrus pyrifolia) in East Asia Revealed by Comprehensive Genetic Structure Analysis with SSR Markers. Tree Genet. Genomes 2018, 14, 48. [Google Scholar] [CrossRef]
  28. Wahocho, S.A.; Cao, Y.-F.; Xu, J.-Y.; Qi, D.; Wahocho, N.A.; Gul, H.; Dong, X.-G.; Tian, L.; Huo, H.; Liu, C.; et al. Origin and Dissemination Route of Pear Accessions from Western China to Abroad Based on Combined Analysis of SSR and CpDNA Markers. Genet. Resour. Crop Evol. 2019, 67, 107–128. [Google Scholar] [CrossRef]
  29. Ouni, R.; Zborowska, A.; Sehic, J.; Choulak, S.; Hormaza, J.I.; Garkava-Gustavsson, L.; Mars, M. Genetic Diversity and Structure of Tunisian Local Pear Germplasm as Revealed by SSR Markers. Hortic. Plant J. 2020, 6, 61–70. [Google Scholar] [CrossRef]
  30. Bielsa, F.J.; Irisarri, P.; Errea, P.; Pina, A. Genetic Diversity and Structure of Local Pear Cultivars from Mountainous Areas from Aragon (Northeastern Spain). Agronomy 2021, 11, 1778. [Google Scholar] [CrossRef]
  31. Madesis, P.; Ganopoulos, I.; Tsaftaris, A. Microsatellites: Evolution and Contribution. Methods Mol. Biol. 2013, 1006, 1–13. [Google Scholar] [CrossRef]
  32. Gianfranceschi, L.; Seglias, N.; Tarchini, R.; Komjanc, M.; Gessler, C. Simple Sequence Repeats for the Genetic Analysis of Apple. Theor. Appl. Genet. 1998, 96, 1069–1076. [Google Scholar] [CrossRef]
  33. Hokanson, S.C.; Szewc-McFadden, A.K.; Lamboy, W.F.; McFerson, J.R. Microsatellite (SSR) Markers Reveal Genetic Identities, Genetic Diversity and Relationships in a Malus × Domestica Borkh. Core Subset Collection. Theor. Appl. Genet. 1998, 97, 671–683. [Google Scholar] [CrossRef]
  34. Liebhard, R.; Gianfranceschi, L.; Koller, B.; Ryder, C.D.; Tarchini, R.; Van De Weg, E.; Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus × domestica Borkh.). Mol. Breed. 2002, 10, 217–241. [Google Scholar] [CrossRef]
  35. Yamamoto, T.; Kimura, T.; Shoda, M.; Imai, T.; Saito, T.; Sawamura, Y.; Kotobuki, K.; Hayashi, T.; Matsuta, N. Genetic linkage maps constructed by using SSR markers in apple and pear. Theor. Appl. Genet. 2002, 105, 104–111. [Google Scholar]
  36. Fernández-Fernández, F.; Harvey, N.G.; James, C.M. Isolation and Characterization of Polymorphic Microsatellite Markers from European Pear (Pyrus communis L.). Mol. Ecol. Notes 2006, 6, 1039–1041. [Google Scholar] [CrossRef]
  37. Hoffman, J.I.; Amos, W. Microsatellite Genotyping Errors: Detection Approaches, Common Sources and Consequences for Paternal Exclusion. Mol. Ecol. 2004, 14, 599–612. [Google Scholar] [CrossRef]
  38. Urrestarazu, J.; Royo, J.B.; Santesteban, L.G.; Miranda, C. Evaluating the Influence of the Microsatellite Marker Set on the Genetic Structure Inferred in Pyrus communis L. PLoS ONE 2015, 10, e0138417. PLoS ONE 2015, 10, e0138417. [Google Scholar] [CrossRef]
  39. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research—An Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  40. Liu, K.; Muse, S.V. PowerMarker: An Integrated Analysis Environment for Genetic Marker Analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef]
  41. Paetkau, D.; Calvert, W.; Stirling, I.; Strobeck, C. Microsatellite Analysis of Population Structure in Canadian Polar Bears. Mol. Ecol. 1995, 4, 347–354. [Google Scholar] [CrossRef]
  42. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  43. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Available online: https://www.R-project.org (accessed on 20 April 2025).
  44. Paradis, E.; Schliep, K. Ape 5.0: An Environment for Modern Phylogenetics and Evolutionary Analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef] [PubMed]
  45. Schliep, K.P. Phangorn: Phylogenetic Analysis in R. Bioinformatics 2011, 27, 592–593. [Google Scholar] [CrossRef]
  46. Wickham, H.; Hester, J.; Bryan, J. Readr: Read Rectangular Text Data. R Package Version 1.3.1. Available online: https://CRAN.R-project.org/package=readr (accessed on 20 April 2025).
  47. Wickham, H. ggplot2; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
  48. Slowikowski, K. Ggrepel: Automatically Position Non-Overlapping Text Labels with ‘Ggplot2’. R Package Version 0.9.1. Available online: https://CRAN.R-project.org/package=ggrepel (accessed on 20 April 2025).
  49. Maechler, M.; Rousseeuw, P.; Struyf, A.; Hubert, M.; Hornik, K. Cluster: Cluster Analysis Basics and Extensions. R Package Version 2.1.4. Available online: https://CRAN.R-project.org/package=cluster (accessed on 20 April 2025).
  50. Kassambara, A.; Mundt, F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R Package Version 1.0.7. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 20 April 2025).
  51. Charrad, M.; Ghazzali, N.; Boiteau, V.; Niknafs, A. NbClust: An R Package for Determining the Relevant Number of Clusters in a Data Set. J. Stat. Softw. 2014, 61, 1–36. [Google Scholar] [CrossRef]
  52. Ganopoulos, I.; Moysiadis, T.; Xanthopoulou, A.; Ganopoulou, M.; Avramidou, E.; Aravanopoulos, F.A.; Tani, E.; Madesis, P.; Tsaftaris, A.; Kazantzis, K. Diversity of Morpho-Physiological Traits in Worldwide Sweet Cherry Cultivars of GeneBank Collection Using Multivariate Analysis. Sci. Hortic. 2015, 197, 381–391. [Google Scholar] [CrossRef]
  53. Sneath, P.H.A.; Sokal, R.R. Numerical Taxonomy: The Principles and Practice of Numerical Classification; Freeman: San Francisco, CA, USA, 1973. [Google Scholar]
  54. Paradis, E.; Claude, J.; Strimmer, K. APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 2004, 20, 289–290. [Google Scholar] [CrossRef]
  55. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A Program for Identifying Clustering Modes and Packaging Population Structure Inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  56. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the Number of Clusters of Individuals Using the Software Structure: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  57. Francis, R.M. pophelper: An R package and web app to analyse and visualize population structure. Mol. Ecol. Resour. 2017, 17, 27–32. [Google Scholar] [CrossRef]
  58. Pina-Martins, F.; Silva, D.N.; Fino, J.; Paulo, O.S. Structure_threader: An improved method for automation and parallelization of programs structure, fastStructure and MavericK on multicore CPU systems. Mol. Ecol. Resour. 2017, 17, e268–e274. [Google Scholar] [CrossRef]
  59. Evans, K.M.; Fernández-Fernández, F.; Govan, C. Harmonising Fingerprinting Protocols to Allow Comparisons between Germplasm Collections—Pyrus. Acta Hortic. 2009, 814, 103–106. [Google Scholar] [CrossRef]
  60. Jennings, T.N.; Knaus, B.J.; Mullins, T.D.; Haig, S.M.; Cronn, R.C. Multiplexed Microsatellite Recovery Using Massively Parallel Sequencing. Mol. Ecol. Resour. 2011, 11, 1060–1067. [Google Scholar] [CrossRef] [PubMed]
  61. Mergeay, J. Population Size in Evolutionary Biology Is More than the Effective Size. Evol. Appl. 2024, 17, e70029. [Google Scholar] [CrossRef] [PubMed]
  62. Wolko, Ł.; Bocianowski, J.; Antkowiak, W.; Słomski, R. Genetic Diversity and Population Structure of Wild Pear (Pyrus pyraster (L.) Burgsd.) in Poland. Cent. Eur. J. Biol. 2014, 10, 19–29. [Google Scholar] [CrossRef]
  63. Liu, Q.; Song, Y.; Liu, L.; Zhang, M.; Sun, J.; Zhang, S.; Wu, J. Genetic Diversity and Population Structure of Pear (Pyrus spp.) Collections Revealed by a Set of Core Genome-Wide SSR Markers. Tree Genet. Genomes 2015, 11, 128. [Google Scholar] [CrossRef]
Figure 1. PCoA analysis. Principal Coordinate Analysis (PCoA) based on SSR marker data from 51 pear (Pyrus communis L.) accessions. The plot displays the first two coordinate axes, PCoA 1 and PCoA 2, which together explain 40.2% of the total genetic variation (23.3% and 16.9%, respectively). The corresponding scree plot illustrates the variance explained by each axis.
Figure 1. PCoA analysis. Principal Coordinate Analysis (PCoA) based on SSR marker data from 51 pear (Pyrus communis L.) accessions. The plot displays the first two coordinate axes, PCoA 1 and PCoA 2, which together explain 40.2% of the total genetic variation (23.3% and 16.9%, respectively). The corresponding scree plot illustrates the variance explained by each axis.
Plants 14 01816 g001
Figure 2. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) dendrogram illustrating the genetic relationships among 51 pear (Pyrus communis L.) accessions based on SSR marker data. The branches with red color represent the Greek local landraces. The dendrogram was constructed using Euclidean genetic distances derived from standardized multilocus genotypic data. Bootstrap values and a scale bar are also shown.
Figure 2. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) dendrogram illustrating the genetic relationships among 51 pear (Pyrus communis L.) accessions based on SSR marker data. The branches with red color represent the Greek local landraces. The dendrogram was constructed using Euclidean genetic distances derived from standardized multilocus genotypic data. Bootstrap values and a scale bar are also shown.
Plants 14 01816 g002
Figure 3. This figure presents the (A) STRUCTURE bar plot for K = 2, 3, 4, 5, revealing that the optimal number of genetic clusters is K = 2; (B) optimal cluster determination by the Evanno method. The ΔK method detected the highest rate of change at K = 2, and LnP(K) suggested increasing fit with higher K. The Evanno method corrected for overfitting and pointed to K = 2 as the most meaningful.
Figure 3. This figure presents the (A) STRUCTURE bar plot for K = 2, 3, 4, 5, revealing that the optimal number of genetic clusters is K = 2; (B) optimal cluster determination by the Evanno method. The ΔK method detected the highest rate of change at K = 2, and LnP(K) suggested increasing fit with higher K. The Evanno method corrected for overfitting and pointed to K = 2 as the most meaningful.
Plants 14 01816 g003
Table 1. Pear accessions of Gene bank collection used in this study.
Table 1. Pear accessions of Gene bank collection used in this study.
NoAccession NameOriginGroupNoAccession NameOriginGroup
1Duchesse d’AnguleneFranceCultivar27BartletEnglandCultivar
2Pierre CornellFranceCultivar28MonglowMarylandCultivar
3HighlandEnglandCultivar29Gentile BiancaFranceCultivar
444960GreeceBreeding line30Aromata BistritaRomaniaCultivar
545078GreeceBreeding line31HW614SerbiaCultivar
645170GreeceBreeding line32Passa CrassanaFranceCultivar
7Kontoula PereasGreeceLandrace3345017GreeceBreeding line
844929GreeceBreeding line3445143GreeceBreeding line
9SerpouFranceLandrace3544986GreeceBreeding line
1045139GreeceBreeding line3645146GreeceBreeding line
11Beurré d’HardenpontFranceCultivar3744933GreeceBreeding line
12BasdouvanikoGreeceLandrace38CosciaItalyCultivar
1345020GreeceBreeding line39Decana d’ InvernoBelgiumCultivar
14AvgoustiatikiGreeceLandrace40Decana del ComicioFranceCultivar
15Harvest QueenCanadaCultivar41Santa MariaItalyCultivar
1645176GreeceBreeding line42Karamanets PcillaresBulgaryCultivar
17BlanquillaSpainCultivar4345052GreeceBreeding line
1845047GreeceBreeding line44ConferenceEnglandCultivar
19Packham’s TriumphEnglandCultivar4545085GreeceBreeding line
20ColetteUSACultivar46HW607SerbiaCultivar
21HW 611SerbiaCultivar4745084GreeceBreeding line
22SumandinkaSerbiaCultivar48Abate FetelFranceCultivar
23Kontoula PatronGreeceLandrace49Grand ChampionUSACultivar
24Kontoula LechaiouGreeceLandrace50Le ClerkFranceCultivar
25Favorita di clapsUSACultivar51KastoriasGreeceLandrace
26Spina CarpiItalyCultivar
Table 2. Multiplex (M1 and M2) PCR assay primer characteristics. Linkage groups (LG) are reported according to the GDR database (https://www.rosaceae.org/) (Accessed on 1 March 2024).
Table 2. Multiplex (M1 and M2) PCR assay primer characteristics. Linkage groups (LG) are reported according to the GDR database (https://www.rosaceae.org/) (Accessed on 1 March 2024).
PrimerDyeRepeat MotifLGMinMaxForwardReverseTmBibliography
Multiplex 1EMPc117FAM(CT)17785135GTTCTATCTACCAAGCCACGCTCGTTTGTGTGTTTTACGTGTTG61.8[20,36]
CH01d08FAM(GA)n3/15277301CTCCGCCGCTATAACACTTCTACTCTGGAGGGTATGTCAAAG[32,34]
EMPc11TAMRA(AC)1311135155GCGATTAAAGATCAATAAACCCATAAAGCAGCTGGTTGGTGAAAT[20,36]
CH01f07aTAMRACT10175211CCCTACACAGTTTCTCAACCCCGTTTTTGGAGCGTAGGAAC[34]
CH05c06ROXGA16 111ATTGGAACTCTCCGTATTGTGCATCAACAGTAGTGGTAGCCGGT[34]
Multiplex 2CH04e03FAM(GA)n5179221TTGAAGATGTTTGGCTGTGCTGCATGTCTGTCTCCTCCAT60.8[34]
CH03g07HEXGA3195265AATAAGCATTCAAAGCAATCCGTTTTTCCAAATCGAGTTTCGTT[34]
GD147HEXAG13121147TCCCGCCATTTCTCTGCAAACCGCTGCTGCTGAAC[33,35]
Table 3. Number of alleles per SSR locus across 51 pear accessions.
Table 3. Number of alleles per SSR locus across 51 pear accessions.
LocusNaAllele Fragment Size (bp)
CH03g072206, 209
CH04e034172, 204, 213, 216
GD1473159, 162, 167
CH01d083270, 281, 303
CH01f07a3169, 181, 191
CH05c061070, 71, 80, 87, 91, 92, 95, 100, 108, 118
EMPc116128, 129, 138, 142, 149, 150
EMPc1171384, 85, 86, 103, 111, 113, 115, 129, 130, 131, 133, 136, 143
Na: Mean number of alleles observed per locus. Allele fragment size (bp): base pair length of each amplified allele.
Table 4. Allelic patterns and diversity statistics per locus across the Greek pear collection.
Table 4. Allelic patterns and diversity statistics per locus across the Greek pear collection.
Mean ValuesStandard Error (SE) Values
Na5.500Na1.402
Na Freq. ≥ 5%2.625Na Freq. ≥ 5%0.460
Ne2.343Ne0.326
I0.953I0.178
No. Private Alleles5.500No. Private Alleles1.402
No. LComm Alleles (≤25%)0No. LComm Alleles (≤25%)0
No. LComm Alleles (≤50%)0No. LComm Alleles (≤50%)0
He0.505He0.075
uHe0.510uHe0.076
Na: Mean number of alleles observed per locus. Na Freq. ≥ 5%: Mean number of alleles with a frequency of at least 5%. Ne: Effective number of alleles, representing genetic diversity adjusted for allele frequencies. I: Shannon’s Information Index, indicating genetic diversity. No. Private Alleles: Mean number of alleles unique to a population. No. LComm Alleles (≤25%): Mean number of alleles with a frequency less than or equal to 25%. No. LComm Alleles (≤50%): Mean number of alleles with a frequency less than or equal to 50%. He: Expected heterozygosity, representing genetic variability. uHe: Unbiased expected heterozygosity, accounting for small sample sizes.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Deligiannidou, E.; Boutsika, A.; Plesias, I.; Xanthopoulou, A.; Moysiadis, T.; Mellidou, I.; Manthos, I.; Sotiropoulos, T.; Ganopoulos, I. Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants 2025, 14, 1816. https://doi.org/10.3390/plants14121816

AMA Style

Deligiannidou E, Boutsika A, Plesias I, Xanthopoulou A, Moysiadis T, Mellidou I, Manthos I, Sotiropoulos T, Ganopoulos I. Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants. 2025; 14(12):1816. https://doi.org/10.3390/plants14121816

Chicago/Turabian Style

Deligiannidou, Eleftheria, Anastasia Boutsika, Ioannis Plesias, Aliki Xanthopoulou, Theodoros Moysiadis, Ifigeneia Mellidou, Ioannis Manthos, Thomas Sotiropoulos, and Ioannis Ganopoulos. 2025. "Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection" Plants 14, no. 12: 1816. https://doi.org/10.3390/plants14121816

APA Style

Deligiannidou, E., Boutsika, A., Plesias, I., Xanthopoulou, A., Moysiadis, T., Mellidou, I., Manthos, I., Sotiropoulos, T., & Ganopoulos, I. (2025). Microsatellite Genotyping and Genetic Diversity of a Greek Pear (Pyrus communis L.) Germplasm Collection. Plants, 14(12), 1816. https://doi.org/10.3390/plants14121816

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop