Analysis of the Distribution Pattern and Prophage Types in Candidatus Liberibacter Asiaticus ‘Cuimi’ Kumquat
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Plant DNA Extraction
2.3. Comparison of External Quality Measurements Between Healthy and Infected Fruits
2.4. Observation and Measurement of Sections from Healthy and Infected Fruits
2.5. Detection and Quantification of CLas
2.6. Absolute Quantification of CLas
2.7. Identification of Prophage Types
2.8. Data Processing
3. Results and Analysis
3.1. Symptoms of ‘Cuimi’ Kumquat Infected with CLas
3.2. Differences in Appearance Quality Between Healthy and Infected Fruits
3.3. Comparison of Tissue Morphology Between the Pectin of Healthy and Infected Fruits
3.4. Detection Results of CLas in Branches with Fruits of ‘Cuimi’ Kumquat
3.5. Distribution of CLas in Different Parts of ‘Cuimi’ Kumquat Branches
3.6. Analysis of Prophage Types of CLas in ‘Cuimi’ Kumquat
3.7. Distribution Pattern of CLas and Prophage in the Pith of ‘Cuimi’ Kumquat Fruits
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jagoueix, S.; Bové, J.M.; Garnier, M. The phloem-limit ed bacterium of greening disease of citrus is a member of the alpha subdivision of the Proteobacteria. Int. J. Syst. Bacteriol. 1994, 44, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 2006, 88, 7–37. [Google Scholar]
- Chu, L.P.; Zheng, Z.; Deng, X.L. Quantitative analysis of the distribution of ‘Candidatus Liberibacter asiaticus’ in Shatangju Mandarins. South China Fruits 2016, 45, 42–43. [Google Scholar]
- Guo, H.Y.; Luo, X.L.; Li, T.; Deng, X.L.; Zheng, Z. Distribution pattern of ‘Candidatus Liberibacter asiaticus’ in infected branches and fruit albedo of Gonggan Citrus. Acta Phytopathol. Sin. 2020, 50, 543–548. [Google Scholar]
- Ding, F.; Duan, Y.; Paul, C.; Brlansky, R.H.; Hartung, J.S. Localization and distribution of ‘Candidatus Liberibacter asiaticus’ in citrus and periwinkle by direct tissue blot immuno assay with an Anti-OmpA polyclonal antibody. PLoS ONE 2015, 10, e0123939. [Google Scholar] [CrossRef]
- Tatinen, S.; Sagara, U.S.; Gowda, S.; Robertson, C.J.; Dawson, W.O. In planta distribution of ‘Candidatus Liberibacter asiaticus’ as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology 2008, 98, 592–599. [Google Scholar] [CrossRef]
- Kunta, M.; Graca, J.V.D.; Malik, N. Quantitative distribution of ‘Candidutus Liberibacter asiaticus’ in the aerial parts of the Huanglongbing infected citrus trees in Texas. HortScience 2014, 49, 65–68. [Google Scholar] [CrossRef]
- Li, B.; Levy, L.; Hartung, J.S. Quantitative distribution of ‘Candidatus Liberibacter asiaticus’ in citrus plants with citrus huanglongbing. Phytopathology 2009, 99, 13. [Google Scholar] [CrossRef]
- Gao, X.; Tang, Z.P.; Qin, R.Y.; Wang, Y.C.; Lan, H.G.; Wei, R.J.; Deng, G.Z. Comparative analysis of fruit quality among ‘Cuimi’ Kumquat, ‘Rongan’ Kumquat, and ‘Huapi’ Kumquat. J. South. Agric. 2016, 47, 4. [Google Scholar]
- Wang, C.; Fang, F.; Li, Y.; Zhang, L.; Wu, J.; Li, T.; Zheng, Y.; Xu, Q.; Fan, S.; Chen, J.; et al. Biological features and in planta transcriptomic analyses of a microviridae phage (CLasMV1) in “Candidatus Liberibacter asiaticus”. Int. J. Mol. Sci. 2022, 23, 10024. [Google Scholar] [CrossRef]
- Zhang, S.; Flores-Cruz, Z.; Zhou, L.; Kang, B.H.; Fleites, L.A.; Gooch, M.D.; Wulff, N.A.; Davis, M.J.; Duan, Y.P.; Gabriel, D.W. ‘Candidatus Liberibacter asiaticus’ carries an excision plasmid prophage and a chromosomally integrated prophage that becomes lytic in plant infections. Mol. Plant-Microbe Interact. 2011, 24, 458–468. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Z.; Bao, M.; Wu, F.; Van Horn, C.; Chen, J.; Deng, X. A Type 3 prophage of ‘Candidatus Liberibacter asiaticus’ carrying a restriction-modification system. Phytopathology 2018, 108, 454–461. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, Z.; Bao, M.; Li, T.; Fang, F.; Zheng, Y.; Liu, Y.; Xu, M.; Chen, J.; Deng, X.; et al. A novel microviridae phage (CLasMV1) from ‘Candidatus Liberibacter asiaticus’. Front. Microbiol. 2021, 12, 754245. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Powell, C.A.; Hoffman, M.T.; Li, W.; Fan, G.; Liu, B.; Lin, H.; Duan, Y. Diversity and plasticity of the intracellular plant pathogen and insect symbiont ‘Candidatus Liberibacter asiaticus’ as revealed by hypervariable prophage genes with intragenic tandem repeats. Appl. Environ. Microbiol. 2011, 77, 6663–6673. [Google Scholar] [CrossRef]
- Tan, J.; Wang, X.F.; Su, H.N.; Li, Z.A.; Chang, Y. Genetic Diversity of Two Hypervariable Prophage Genes in the Pathogen of Citrus Huanglongbing in China. Sci. Agric. Sin. 2013, 46, 3784–3792. [Google Scholar]
- Liu, R.; Zhang, P.; Pu, X.; Xing, X.; Chen, J.; Deng, X. Analysis of a prophage gene frequency revealed population variation of ‘Candidatus Liberibacter asiaticus’ from two citrus-growing provinces in China. Plant Dis. 2011, 95, 431–435. [Google Scholar] [CrossRef]
- Li, J.H.; Zheng, Z.; Deng, X.L. Analysis of the genetic structure of citrus Huanglongbing bacterium populations in China based on prophage types. Acta Phytopathol. Sin. 2019, 49, 334–342. [Google Scholar]
- Zheng, Z.; Bao, M.; Wu, F.; Chen, J.; Deng, X. Predominance of single prophage carrying a CRISPR/cas System in ‘Candidatus Liberibacter asiaticus’ strains in southern China. PLoS ONE 2016, 11, e0146422. [Google Scholar] [CrossRef]
- Zheng, Y.; Huang, H.; Huang, Z.; Deng, X.; Zheng, Z.; Xu, M. Prophage region and short tandem repeats of ‘Candidatus Liberibacter asiaticus’ reveal significant population structure in China. Plant Pathol. 2021, 70, 959–969. [Google Scholar] [CrossRef]
- Bao, M.L.; Zheng, Z.; Sun, X.A.; Chen, J.; Deng, X. Enhancing PCR capacity to detect ‘Candidatus Liberibacter asiaticus’ utilizing whole genome sequence information. Plant Dis. 2020, 104, 13. [Google Scholar] [CrossRef]
- Li, T.; Deng, X.L.; Zheng, Z. Distribution of “Candidatus Liberibacter asiaticus” in Huanglongbing-affected Citrus reticulata Blanco cv. Gongkan branches and the fruit pith. Acta Phytopathol. Sin. 2020, 50, 543–548. [Google Scholar]
- Chen, Y.L.; Tang, R.; Liu, Y.; Deng, X.L.; Xu, M.R. Distribution and diversity analysis of Huanglongbing bacterium on citrus branches. Acta Phytopathol. Sin. 2018, 48, 728–737. [Google Scholar]
- Wang, J. Study on the Spatio-Temporal Distribution of Huanglongbing Bacterium on Citrus Branches with Fruits. Master’s Thesis, South China Agricultural University, Guangzhou, China, 2018. [Google Scholar]
- Zhang, P.; Guan, L.; Liu, R.; Pu, X.L.; Deng, X.L. Study on the correlation between red-nosed fruits of sugarcane orange and infection by bacteria of the genus Xanthomonas. Chin. J. Trop. Crop. 2011, 32, 738–742. [Google Scholar]
- Fang, F.; Guo, H.Y.; Zhao, A.M.; Li, T.; Liao, H.; Deng, X.; Xu, M.; Zheng, Z. A significantly high abundance of ‘Candidatus Liberibacter asiaticus’ in citrus fruit pith: In planta transcriptome and anatomical analyses. Front. Microbiol. 2021, 12, 681251. [Google Scholar] [CrossRef]
- Huang, J.Q.; Li, L.; Wu, F.N.; Zheng, Z.; Deng, X.L. Proliferation and pathogenicity of Huanglongbing bacteria carrying different prophages in the citrus. Sci. Agric. Sin. 2022, 55, 719–728. [Google Scholar]
Type | Primer Name | Sequences (5′–3′) | Length (bp) | Genes |
---|---|---|---|---|
CLas | CLas_4G | AGTCGAGCGCGTATGCGAAT | 78 | 16S rRNA [20] |
HLBr | GCGTTATCCCGTAGAAAAAGGTAG | |||
HLBp-Probe | FAM-AGACGGGTGAGTAACGCG-BHQ1 | |||
Type 1 | SC1-045F | CCGTTCGTCTTTTGCCCATA | 87 | SC1_gp045 [19] |
SC1-045R | GCATTCTTCGCATCATCGGA | |||
Type 2 | SC2-035F | AGGTCACAAGGATTTAGCCCA | 86 | SC2_gp040 [19] |
SC2-035R | CTCCTAATCCCGCACCGATA | |||
Type 3 | PJXGC-8F | CGGCGCTGAACTCTTGTATT | 85 | PJXGC_08 [12] |
PJXGC-8R | AAGGGCGTTGTTCTTGTCAC | |||
Type 4 | MV1-1F | ACGACCACATGACCAGACTT | 93 | CLasMV1_ORF3 [21] |
MV1-1R | TGATGCGTATAAGGAGTTGACTG |
Measurement Indicators | ||||
---|---|---|---|---|
Single Fruit Weight (g) | Transverse Diameter (mm) | Longitudinal Diameter (mm) | Fruit Shape Index | |
Healthy Fruit | 39.75 ± 0.31 a | 40.92 ± 0.18 a | 45.95 ± 0.29 a | 1.12 ± 0.01 a |
CLas-infected fruit | 24.24 ± 0.42 b | 28.22 ± 0.11 b | 30.68 ± 0.18 b | 1.08 ± 0.01 b |
Kumquat on Top | Kumquat in the Middle | The Lower Part of Kumquat | |||
---|---|---|---|---|---|
Phloem Thickness Ratio | p-Value | Phloem Thickness Ratio | p-Value | Phloem Thickness Ratio | p-Value |
90.45% | 0.09 | 89.75% | 0.07 | 88.15% | 0.05 |
No. | New Leaves | Upper Phloem of Branches | Fruit Pedicel | Fruit Pith | Fruit Axis | Old Leaves | Lower Phloem of Branches |
---|---|---|---|---|---|---|---|
1 | 33.52 | 22.04 | 18.78 | 17.23 | 18.12 | 33.56 | 23.66 |
2 | 28.73 | 33.21 | 22.05 | 17.21 | 17.72 | 27.19 | 25.56 |
3 | 31.01 | 27.97 | 21.76 | 19.78 | 20.78 | 29.65 | 30.15 |
4 | 28.41 | 29.98 | 23.35 | 20.23 | 22.35 | 28.16 | 29.58 |
5 | 29.12 | 33.56 | 18.93 | 15.73 | 18.92 | 31.44 | 32.54 |
6 | 28.12 | 28.54 | 24.38 | 22.91 | 21.28 | 30.64 | 32.55 |
7 | 28.01 | 29.29 | 16.34 | 14.68 | 18.19 | 27.15 | 28.25 |
No. | New Leaves | Upper Phloem of Branches | Fruit Pedicel | Fruit Pith | Fruit Axis | Old Leaves | Lower Phloem of Branches |
---|---|---|---|---|---|---|---|
1 | 1.03 (T1) | 0.58 (T1) | 1.41 (T1) | 17.68 (T1) | 1.45 (T4) | 1.08 (T1) | 0.88 (T1) |
2 | 2.65 (T1) | 0.44 (T1) | 3.48 (T1) | 1.70 (T1) | 1.41 (T1) | 1.22 (T1) | 0.29 (T1) |
3 | 0.51 (T2) | 0.36 (T2) | 0.94 (T4) | 0.69 (T2) | 0.89 (T2) | 0.73 (T2) | 0.62 (T2) |
0.62 (T4) | 0.83 (T4) | 2.76 (T4) | 0.48 (T4) | 0.25 (T4) | 0.72 (T4) | ||
4 | 0.42 (T2) | 0.55 (T2) | 0.42 (T2) | 0.75 (T2) | 0.43 (T2) | 0.31 (T2) | 0.42 (T2) |
0.80 (T4) | 1.64 (T4) | 0.63 (T4) | 4.85 (T4) | 0.73 (T4) | 0.93 (T4) | 0.55 (T4) | |
5 | 0.77 (T1) | 0.64 (T1) | 0.79 (T1) | 2.60 (T2) | 4.59 (T1) | 1.15 (T1) | 0.85 (T1) |
0.58 (T2) | 1.21 (T4) | ||||||
0.97 (T4) | |||||||
6 | 0.30 (T2) | 0.52 (T1) | 4.0 (T4) | 3.29 (T2) | 0.44 (T2) | 0.40 (T2) | 0.24 (T2) |
0.50 (T2) | 0.41 (T4) | 1.81 (T4) | 0.41 (T4) | 0.65 (T4) | |||
1.61 (T4) | 0.06 (T4) | ||||||
7 | 0.27 (T2) | 1.67 (T2) | 1.80 (T4) | 2.25 (T2) | 0.51 (T2) | 0.38 (T2) | 1.25 (T2) |
0.43 (T4) | 0.89 (T4) | 17.23 (T4) | 0.30 (T4) | 0.36 (T4) | 0.57 (T4) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, W.-T.; Teng, X.-F.; He, L.; Guan, B.; He, C.-L.; Liu, J.-J.; Chen, K.-L.; Zheng, Z.; He, J. Analysis of the Distribution Pattern and Prophage Types in Candidatus Liberibacter Asiaticus ‘Cuimi’ Kumquat. Plants 2025, 14, 94. https://doi.org/10.3390/plants14010094
Li W-T, Teng X-F, He L, Guan B, He C-L, Liu J-J, Chen K-L, Zheng Z, He J. Analysis of the Distribution Pattern and Prophage Types in Candidatus Liberibacter Asiaticus ‘Cuimi’ Kumquat. Plants. 2025; 14(1):94. https://doi.org/10.3390/plants14010094
Chicago/Turabian StyleLi, Wen-Ting, Xiao-Feng Teng, Li He, Bin Guan, Cui-Ling He, Jian-Jun Liu, Ke-Ling Chen, Zheng Zheng, and Jian He. 2025. "Analysis of the Distribution Pattern and Prophage Types in Candidatus Liberibacter Asiaticus ‘Cuimi’ Kumquat" Plants 14, no. 1: 94. https://doi.org/10.3390/plants14010094
APA StyleLi, W.-T., Teng, X.-F., He, L., Guan, B., He, C.-L., Liu, J.-J., Chen, K.-L., Zheng, Z., & He, J. (2025). Analysis of the Distribution Pattern and Prophage Types in Candidatus Liberibacter Asiaticus ‘Cuimi’ Kumquat. Plants, 14(1), 94. https://doi.org/10.3390/plants14010094