Exogenous 2,4-Epibrassinolide Alleviates Alkaline Stress in Cucumber by Modulating Photosynthetic Performance
Abstract
1. Introduction
2. Results
2.1. Effects of EBR on the Growth of Cucumber Under NaHCO3 Stress
2.2. Effects of EBR on Reactive Oxygen Species Accumulation and Antioxidant Gene Expression in Cucumber Leaves Under NaHCO3 Stress
2.3. Effects of EBR on Photosynthetic Parameters and Chlorophyll Synthesis in Cucumber Leaves Under NaHCO3 Stress
2.4. Effects of EBR on the Chlorophyll Fluorescence Characteristics of Cucumber Leaves Under NaHCO3 Stress
2.5. Effects of EBR on the Expression of Photosynthesis-Related Genes in Cucumber Leaves Under NaHCO3 Stress
3. Discussion
4. Materials and Methods
4.1. Experimental Materials and Design
4.2. Plant Biomass Measurement
4.3. Photosynthetic Parameters Measurement
4.4. Chlorophyll Content Determination
4.5. Chlorophyll Fluorescence Parameter Measurement
4.6. Determination of the Content of Chlorophyll Precursor Substances
4.7. Chlorase and Porphobilinogen Deaminase Activity
4.8. O2.− and H2O2 Staining
4.9. Fluorescence Quantification and Gene Expression Analysis Based on qRT-PCR
4.10. Data Processing
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Calzadilla, P.; Carvalho, F.; Gomez, R.; Neto, M.L.; Signorelli, S. Assessing photosynthesis in plant systems: A cornerstone to aid in the selection of resistant and productive crops. Environ. Exp. Bot. 2022, 201, 104950. [Google Scholar] [CrossRef]
- Zhu, X.-G.; Long, S.P.; Ort, D.R. Improving photosynthetic efficiency for greater yield. Annu. Rev. Plant Biol. 2010, 61, 235–261. [Google Scholar] [CrossRef] [PubMed]
- Muhammad, I.; Shalmani, A.; Ali, M.; Yang, Q.-H.; Ahmad, H.; Li, F.B. Mechanisms regulating the dynamics of photosynthesis under abiotic stresses. Front. Plant Sci. 2021, 11, 615942. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Kumar, V.; Shahzad, B.; Ramakrishnan, M.; Singh Sidhu, G.P.; Bali, A.S.; Handa, N.; Kapoor, D.; Yadav, P.; Khanna, K. Photosynthetic response of plants under different abiotic stresses: A review. J. Plant Growth Regul. 2020, 39, 509–531. [Google Scholar] [CrossRef]
- Yan, K.; Mei, H.; Dong, X.; Zhou, S.; Cui, J.; Sun, Y. Dissecting photosynthetic electron transport and photosystems performance in Jerusalem artichoke (Helianthus tuberosus L.) under salt stress. Front. Plant Sci. 2022, 13, 905100. [Google Scholar] [CrossRef]
- Lotfi, R.; Ghassemi-Golezani, K.; Pessarakli, M. Salicylic acid regulates photosynthetic electron transfer and stomatal conductance of mung bean (Vigna radiata L.) under salinity stress. Biocatal. Agric. Biotechnol. 2020, 26, 101635. [Google Scholar] [CrossRef]
- Wang, G.; Zeng, F.; Song, P.; Sun, B.; Wang, Q.; Wang, J. Effects of reduced chlorophyll content on photosystem functions and photosynthetic electron transport rate in rice leaves. J. Plant Physiol. 2022, 272, 153669. [Google Scholar] [CrossRef]
- Hnilickova, H.; Kraus, K.; Vachova, P.; Hnilicka, F. Salinity stress affects photosynthesis, malondialdehyde formation, and proline content in Portulaca oleracea L. Plants 2021, 10, 845. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Shabala, S. Plant Stress Physiology; CABI: Wallingford, UK, 2017. [Google Scholar] [CrossRef]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcus sp. Plant Physiol. 2000, 123, 1047–1056. [Google Scholar] [CrossRef]
- Bose, J.; Rodrigo-Moreno, A.; Shabala, S. ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot. 2014, 65, 1241–1257. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.-H.; Niu, Y.-J.; Zhai, H.; Han, N.; Du, Y.-P. Effects of alkaline stress on organic acid metabolism in roots of grape hybrid rootstocks. Sci. Hortic. 2018, 227, 255–260. [Google Scholar] [CrossRef]
- Flexas, J.; Bota, J.; Loreto, F.; Cornic, G.; Sharkey, T. Diffusive and metabolic limitations to photosynthesis under drought and salinity in C3 plants. Plant Biol. 2004, 6, 269–279. [Google Scholar] [CrossRef] [PubMed]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef]
- Abdel Latef, A.A.; Tran, L.-S.P. Impacts of priming with silicon on the growth and tolerance of maize plants to alkaline stress. Front. Plant Sci. 2016, 7, 243. [Google Scholar] [CrossRef]
- Gong, B.; Li, X.; Bloszies, S.; Wen, D.; Sun, S.; Wei, M.; Li, Y.; Yang, F.; Shi, Q.; Wang, X. Sodic alkaline stress mitigation by interaction of nitric oxide and polyamines involves antioxidants and physiological strategies in Solanum lycopersicum. Free Radic. Biol. Med. 2014, 71, 36–48. [Google Scholar] [CrossRef]
- Guo, R.; Zhou, J.; Hao, W.; Gong, D.; Zhong, X.; Gu, F.; Liu, Q.; Xia, X.; Tian, J.; Li, H. Germination, growth, photosynthesis and ionic balance in Setaria viridis seedlings subjected to saline and alkaline stress. Can. J. Plant Sci. 2011, 91, 1077–1088. [Google Scholar] [CrossRef]
- Sharma, A.; Kumar, V.; Kanwar, M.; Thukral, A.; Bhardwaj, R. Ameliorating imidacloprid induced oxidative stress by 24-epibrassinolide in Brassica juncea L. Russ. J. Plant Physiol. 2017, 64, 509–517. [Google Scholar] [CrossRef]
- Shahzad, B.; Tanveer, M.; Che, Z.; Rehman, A.; Cheema, S.A.; Sharma, A.; Song, H.; ur Rehman, S.; Zhaorong, D. Role of 24-epibrassinolide (EBL) in mediating heavy metal and pesticide induced oxidative stress in plants: A review. Ecotoxicol. Environ. Saf. 2018, 147, 935–944. [Google Scholar] [CrossRef]
- Holá, D. Brassinosteroids and photosynthesis. In Brassinosteroids: A Class of Plant Hormone; Springer: Berlin, Germany, 2011; pp. 143–192. [Google Scholar] [CrossRef]
- Fariduddin, Q.; Yusuf, M.; Ahmad, I.; Ahmad, A. Brassinosteroids and their role in response of plants to abiotic stresses. Biol. Plant. 2014, 58, 9–17. [Google Scholar] [CrossRef]
- Li, S.; Zheng, H.; Lin, L.; Wang, F.; Sui, N. Roles of brassinosteroids in plant growth and abiotic stress response. Plant Growth Regul. 2021, 93, 29–38. [Google Scholar] [CrossRef]
- Sadura, I.; Janeczko, A. Physiological and molecular mechanisms of brassinosteroid-induced tolerance to high and low temperature in plants. Biol. Plant. 2018, 62, 601–616. [Google Scholar] [CrossRef]
- Wu, C.-y.; Trieu, A.; Radhakrishnan, P.; Kwok, S.F.; Harris, S.; Zhang, K.; Wang, J.; Wan, J.; Zhai, H.; Takatsuto, S. Brassinosteroids regulate grain filling in rice. Plant Cell. 2008, 20, 2130–2145. [Google Scholar] [CrossRef] [PubMed]
- Vardhini, B.V.; Anjum, N.A. Brassinosteroids make plant life easier under abiotic stresses mainly by modulating major components of antioxidant defense system. Front. Environ. Sci. 2015, 2, 67. [Google Scholar] [CrossRef]
- Cui, J.X.; Zhou, Y.H.; Ding, J.G.; Xia, X.J.; Shi, K.; Chen, S.C.; Asami, T.; Chen, Z.; Yu, J.Q. Role of nitric oxide in hydrogen peroxide-dependent induction of abiotic stress tolerance by brassinosteroids in cucumber. Plant Cell Environ. 2011, 34, 347–358. [Google Scholar] [CrossRef]
- Xia, X.J.; Wang, Y.J.; Zhou, Y.H.; Tao, Y.; Mao, W.-H.; Shi, K.; Asami, T.; Chen, Z.; Yu, J.-Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef]
- Nie, W.F.; Wang, M.M.; Xia, X.J.; Zhou, Y.H.; Shi, K.; Chen, Z.; Yu, J.Q. Silencing of tomato RBOH1 and MPK2 abolishes brassinosteroid-induced H2O2 generation and stress tolerance. Plant Cell Environ. 2013, 36, 789–803. [Google Scholar] [CrossRef]
- Sun, Z.; Zou, Y.; Xie, C.; Han, L.; Zheng, X.; Tian, Y.; Ma, C.; Liu, X.; Wang, C. Brassinolide improves the tolerance of Malus hupehensis to alkaline stress. Front. Plant Sci. 2022, 13, 1032646. [Google Scholar] [CrossRef]
- Ma, Q.; Wu, E.; Wang, H.; Yuan, Y.; Feng, Y.; Liu, J.; Zhao, L.; Feng, B. Exogenous 24-epibrassinolide boosts plant growth under alkaline stress from physiological and transcriptomic perspectives: The case of broomcorn millet (Panicum miliaceum L.). Ecotoxicol. Environ. Saf. 2022, 248, 114298. [Google Scholar] [CrossRef]
- Fang, S.; Hou, X.; Liang, X. Response mechanisms of plants under saline-alkali stress. Front. Plant Sci. 2021, 12, 667458. [Google Scholar] [CrossRef]
- Nie, W.; Gong, B.; Geng, B.; Wen, D.; Qiao, P.; Guo, H.; Shi, Q. The effects of exogenous 2,4-epibrassinolide on the germination of cucumber seeds under NaHCO3 stress. Plants 2024, 13, 394. [Google Scholar] [CrossRef] [PubMed]
- Rattan, A.; Kapoor, D.; Kapoor, N.; Bhardwaj, R.; Sharma, A. Involvement of brassinosteroids in plant response to salt stress. In Brassinosteroids in Plant Developmental Biology and Stress Tolerance; Academic Press: New York, NY, USA, 2022; pp. 237–253. [Google Scholar] [CrossRef]
- Soliman, M.; Elkelish, A.; Souad, T.; Alhaithloul, H.; Farooq, M. Brassinosteroid seed priming with nitrogen supplementation improves salt tolerance in soybean. Physiol. Mol. Biol. Plants 2020, 26, 501–511. [Google Scholar] [CrossRef] [PubMed]
- Ondrasek, G.; Rathod, S.; Manohara, K.K.; Gireesh, C.; Anantha, M.S.; Sakhare, A.S.; Parmar, B.; Yadav, B.K.; Bandumula, N.; Raihan, F.; et al. Salt stress in plants and mitigation approaches. Plants 2022, 11, 717. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.L.; Song, L.Y.; Wu, X.; Ma, D.N.; Song, S.W.; Wang, X.X.; Zheng, H.L. Brassinosteroid enhances salt tolerance via S-nitrosoglutathione reductase and nitric oxide signaling pathway in mangrove Kandelia obovata. Plant Cell Environ. 2024, 47, 511–526. [Google Scholar] [CrossRef]
- Chen, C.; Cheng, D.; Li, L.; Sun, X.; He, S.; Li, M.; Chen, J. Physiological characteristics and transcriptome analysis of exogenous brassinosteroid-treated kiwifruit. Int. J. Mol. Sci. 2023, 24, 17252. [Google Scholar] [CrossRef]
- El-Azm, A.; Elhady, A. Brassinosteroids or proline can alleviate yield inhibition under salt stress via modulating physio-biochemical activities and antioxidant systems in snap bean. J. Hortic. Sci. Biotechnol. 2023, 98, 526–539. [Google Scholar] [CrossRef]
- Yu, B.; Wang, L.; Guan, Q.; Xue, X.; Gao, W.; Nie, P. Exogenous 24-epibrassinolide promoted growth and nitrogen absorption and assimilation efficiency of apple seedlings under salt stress. Front. Plant Sci. 2023, 14, 1178085. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, X.-L.; Zhang, R.-X.; Yuan, H.-Y.; Wang, M.-M.; Yang, H.-Y.; Ma, H.-Y.; Liu, D.; Jiang, C.-J.; Liang, Z.-W. Root damage under alkaline stress is associated with reactive oxygen species accumulation in rice (Oryza sativa L.). Front. Plant Sci. 2017, 8, 1580. [Google Scholar] [CrossRef]
- Yang, C.; Jianaer, A.; Li, C.; Shi, D.; Wang, D. Comparison of the effects of salt-stress and alkali-stress on photosynthesis and energy storage of an alkali-resistant halophyte Chloris virgata. Photosynthetica 2008, 46, 273–278. [Google Scholar] [CrossRef]
- Nie, W.; Gong, B.; Chen, Y.; Wang, J.; Wei, M.; Shi, Q. Photosynthetic capacity, ion homeostasis and reactive oxygen metabolism were involved in exogenous salicylic acid increasing cucumber seedlings tolerance to alkaline stress. Sci. Hortic. 2018, 235, 413–423. [Google Scholar] [CrossRef]
- Taïbi, K.; Taïbi, F.; Abderrahim, L.A.; Ennajah, A.; Belkhodja, M.; Mulet, J.M. Effect of salt stress on growth, chlorophyll content, lipid peroxidation and antioxidant defence systems in Phaseolus vulgaris L. S. Afr. J. Bot. 2016, 105, 306–312. [Google Scholar] [CrossRef]
- Hodgins, R.R.; Van Huystee, R.B. Rapid simultaneous estimation of protoporphyrin and Mg-porphyrins in higher plants. J. Plant Physiol. 1986, 125, 311–323. [Google Scholar] [CrossRef]
- Jacob-Wilk, D.; Holland, D.; Goldschmidt, E.E.; Riov, J.; Eyal, Y. Chlorophyll breakdown by chlorophyllase: Isolation and functional expression of the Chlase1 gene from ethylene-treated Citrus fruit and its regulation during development. Plant J. 1999, 20, 653–661. [Google Scholar] [CrossRef]
- Hu, L.; Xiang, L.; Li, S.; Zou, Z.; Hu, X.H. Beneficial role of spermidine in chlorophyll metabolism and D1 protein content in tomato seedlings under salinity–alkalinity stress. Physiol. Plant. 2016, 156, 468–477. [Google Scholar] [CrossRef]
- Ping, W.S.; Rong, G.S.; Hui, H.X.; Jing, L.; Sheng, J.Y. Effects of NaCl stress on the content of photosynthetic pigments in the leaves of cucumber (Cucumis sativus L.) seedlings. J. Jiangxi Agric. Univ. 2006. [Google Scholar] [CrossRef]
- Liu, N.; Gong, B.; Jin, Z.; Wang, X.; Wei, M.; Yang, F.; Li, Y.; Shi, Q. Sodic alkaline stress mitigation by exogenous melatonin in tomato needs nitric oxide as a downstream signal. J. Plant Physiol. 2015, 186, 68–77. [Google Scholar] [CrossRef]
- Qin, J.; Dong, W.; He, K.; Chen, J.; Yu, Y.; Wang, Z. Effects of salt stress on growth and photosynthetic physiological features of Hippophae rhamnoides seedlings. Ecol. Environ. Sci. 2009, 18, 1031–1036. [Google Scholar]
- Lu, C.; Li, L.; Liu, X.; Chen, M.; Wan, S.; Li, G. Salt Stress Inhibits Photosynthesis and Destroys Chloroplast Structure by Downregulating Chloroplast Development–Related Genes in Robinia pseudoacacia Seedlings. Plants 2023, 12, 1283. [Google Scholar] [CrossRef]
- Shoolingin-Jordan, P.M. Porphobilinogen deaminase and uroporphyrinogen III synthase: Structure, molecular biology, and mechanism. J. Bioenerg. Biomembr. 1995, 27, 181–195. [Google Scholar] [CrossRef]
- Fang, Z.; Bouwkamp, J.C.; Solomos, T. Chlorophyllase activities and chlorophyll degradation during leaf senescence in non-yellowing mutant and wild type of Phaseolus vulgaris L. J. Exp. Bot. 1998, 49, 503–510. [Google Scholar] [CrossRef]
- Yuan, R.; Shu, S.; Guo, S.; Sun, J.; Wu, J. The positive roles of exogenous putrescine on chlorophyll metabolism and xanthophyll cycle in salt-stressed cucumber seedlings. Photosynthetica 2018, 56, 557–566. [Google Scholar] [CrossRef]
- Zhu, Y.-f.; Wu, Y.-x.; Hu, Y.; Jia, X.; Zhao, T.; Cheng, L.; Wang, Y. Tolerance of two apple rootstocks to short-term salt stress: Focus on chlorophyll degradation, photosynthesis, hormone and leaf ultrastructures. Acta Physiol. Plant. 2019, 41, 1–14. [Google Scholar] [CrossRef]
- Matile, P.; Schellenberg, M. The cleavage of phaeophorbide a is located in the envelope of barley gerontoplasts. Plant Physiol. Biochem. 1996, 34, 55–59. [Google Scholar] [CrossRef]
- Yamane, K.; Rahman, S.; Kawasaki, M.; Taniguchi, M.; Miyake, H. Pretreatment with Antioxidants Decreases the Effects of Salt Stress on Chloroplast Ultrastructure in Rice Leaf Segments (Oryza sativa L.). Plant Prod. Sci. 2004, 7, 292–300. [Google Scholar] [CrossRef]
- Balasubramaniam, T.; Shen, G.; Esmaeili, N.; Zhang, H. Plants’ Response Mechanisms to Salinity Stress. Plants 2023, 12, 2253. [Google Scholar] [CrossRef]
- Gong, B.; Miao, L.; Kong, W.; Bai, J.-G.; Wang, X.; Wei, M.; Shi, Q. Nitric oxide, as a downstream signal, plays a vital role in auxin induced cucumber tolerance to sodic alkaline stress. Plant Physiol. Biochem. 2014, 83, 258–266. [Google Scholar] [CrossRef]
- Jaspers, P.; Kangasjärvi, J. Reactive oxygen species in abiotic stress signaling. Physiol. Plant. 2010, 138, 405–413. [Google Scholar] [CrossRef]
- Siddiqui, H.; Hayat, S.; Bajguz, A. Regulation of photosynthesis by brassinosteroids in plants. Acta Physiol. Plant. 2018, 40, 1–15. [Google Scholar] [CrossRef]
- Raines, C.A. The Calvin cycle revisited. Photosynth. Res. 2003, 75, 1–10. [Google Scholar] [CrossRef]
- Li, X.J.; Guo, X.; Zhou, Y.H.; Shi, K.; Zhou, J.; Yu, J.Q. Overexpression of a brassinosteroid biosynthetic gene dwarf enhances photosynthetic capacity through activation of Calvin cycle enzymes in tomato. BMC Plant Biol. 2016, 16, 33. [Google Scholar] [CrossRef]
- Jiang, Y.-P.; Cheng, F.; Zhou, Y.-H.; Xia, X.-J.; Mao, W.-H.; Shi, K.; Chen, Z.-X.; Yu, J.-Q. Hydrogen peroxide functions as a secondary messenger for brassinosteroids-induced CO2 assimilation and carbohydrate metabolism in Cucumis sativus. J. Zhejiang Univ. Sci. B 2012, 13, 811–823. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Bie, Z.; Huang, Y.; Zhen, A.; Niu, M.; Lei, B. Rootstocks improve cucumber photosynthesis through nitrogen metabolism regulation under salt stress. Acta Physiol. Plant. 2013, 35, 2259–2267. [Google Scholar] [CrossRef]
- El Sayed, A.; El-Hamahmy, M.; Rafudeen, M.; Ebrahim, M. Exogenous spermidine enhances expression of Calvin cycle genes and photosynthetic efficiency in sweet sorghum seedlings under salt stress. Biol. Plant. 2019, 63, 511–518. [Google Scholar] [CrossRef]
- Yang, Y.; Yu, L.; Wang, L.; Guo, S. Bottle gourd rootstock-grafting promotes photosynthesis by regulating the stomata and non-stomata performances in leaves of watermelon seedlings under NaCl stress. J. Plant Physiol. 2015, 186, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.; Gao, X.; Li, B.; Wang, W.; Bai, L. Low red to far-red light ratio promotes salt tolerance by improving leaf photosynthetic capacity in cucumber. Front. Plant Sci. 2023, 13, 1053780. [Google Scholar] [CrossRef]
- Kim, T.-W.; Michniewicz, M.; Bergmann, D.C.; Wang, Z.-Y. Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of a MAPK pathway. Nature 2012, 482, 419–422. [Google Scholar] [CrossRef]
- Gudesblat, G.E.; Schneider-Pizoń, J.; Betti, C.; Mayerhofer, J.; Vanhoutte, I.; Van Dongen, W.; Boeren, S.; Zhiponova, M.; De Vries, S.; Jonak, C. SPEECHLESS integrates brassinosteroid and stomata signalling pathways. Nat. Cell Biol. 2012, 14, 548–554. [Google Scholar] [CrossRef]
- Li, X.; Zhang, L.; Ahammed, G.J.; Li, Z.-X.; Wei, J.-P.; Shen, C.; Yan, P.; Zhang, L.-P.; Han, W.-Y. Nitric oxide mediates brassinosteroid-induced flavonoid biosynthesis in Camellia sinensis L. J. Plant Physiol. 2017, 214, 145–151. [Google Scholar] [CrossRef]
- You, J.; Chan, Z. ROS regulation during abiotic stress responses in crop plants. Front. Plant Sci. 2015, 6, 1091. [Google Scholar] [CrossRef]
- Soares, C.; de Sousa, A.; Pinto, A.; Azenha, M.; Teixeira, J.; Azevedo, R.A.; Fidalgo, F. Effect of 24-epibrassinolide on ROS content, antioxidant system, lipid peroxidation and Ni uptake in Solanum nigrum L. under Ni stress. Environ. Exp. Bot. 2016, 122, 115–125. [Google Scholar] [CrossRef]
- Gill, M.B.; Cai, K.; Zhang, G.; Zeng, F. Brassinolide alleviates the drought-induced adverse effects in barley by modulation of enzymatic antioxidants and ultrastructure. Plant Growth Regul. 2017, 82, 447–455. [Google Scholar] [CrossRef]
- Wu, W.; Zhang, Q.; Ervin, E.H.; Yang, Z.; Zhang, X. Physiological mechanism of enhancing salt stress tolerance of perennial ryegrass by 24-epibrassinolide. Front. Plant Sci. 2017, 8, 1017. [Google Scholar] [CrossRef] [PubMed]
- Morton, M. Biochemical Spectroscopy. 1975. Available online: https://core.ac.uk/download/pdf/82256489.pdf (accessed on 3 October 2024).
- Bogorad, L. Porphyrin synthesis. Methods Enzymol. 1962, 5, 885–895. [Google Scholar] [CrossRef]
- Holden, M. The breakdown of chlorophyll by chlorophyllase. Biochem. J. 1961, 78, 359–364. [Google Scholar] [CrossRef]
- Zhou, H.; Guo, S.; An, Y.; Shan, X.; Wang, Y.; Shu, S.; Sun, J. Exogenous spermidine delays chlorophyll metabolism in cucumber leaves (Cucumis sativus L.) under high temperature stress. Acta Physiol. Plant. 2016, 38, 224. [Google Scholar] [CrossRef]
- Rimington, C. Spectral-absorption coefficients of some porphyrins in the Soret-band region. Biochem. J. 1960, 75, 620–623. [Google Scholar] [CrossRef]
- Frydman, R.B.; Frydman, B. Disappearance of porphobilinogen deaminase activity in leaves before the onset of senescence. Plant Physiol. 1979, 63, 1154–1157. [Google Scholar] [CrossRef]









| Treatment | Plant Height (cm) | Shoot Fresh Weight (g·Plant−1) | Root Fresh Weight (g·Plant−1) | Total Fresh Weight (g·Plant−1) |
|---|---|---|---|---|
| CK | 50.21 ± 0.73 a | 32.74 ± 2.56 b | 13.34 ± 1.03 a | 46.08 ± 2.81 a |
| EBR | 51.40 ± 0.67 a | 34.26 ± 2.92 a | 13.61 ± 1.80 a | 47.87 ± 4.71 a |
| S | 25.27 ± 4.12 c | 11.67 ± 1.99 d | 3.78 ± 0.43 c | 15.45 ± 2.26 c |
| S + EBR | 39.65 ± 4.68 b | 15.51 ± 1.93 c | 6.03 ± 0.40 b | 21.54 ± 2.32 b |
| Gene Name | Primer Sequences |
|---|---|
| actin | F: ATGGCCGATGCCGAGGATATR R: TAGGAGCATCATCACCAGCAAAAC |
| CsCu-ZnSOD | F: CTCCATTTTCAATCTCTCATTATCC R: ATAGAAGTGATTGTGCGGCCATAG |
| CsFe-SOD | F: TACACTGAACCTGAGTTCAACAAC R: ACGTTCTCTGAGAAACCAAACAGA |
| CsAPX | F: CTGCTACTGTTTTTGGAACCGCCG R: GCGGAGGAGAGGAAACGAGTAGTT |
| CsMDHAR | F: ACAGCCTTCTTCTGTTGCCTTCAG R: CTCTATTGTCGTTGGCGAAATCCG |
| CsDHAR | F: ATGTCGGGCTCCAGAATCCAACCA |
| R: AAAGCGAGGAATTGGAAGGAAGGT | |
| CsGR | F: GTCCGATAGTGCTGGAGGTGTTGG |
| R: CCATCCAAAGCCATGACTCTCTTC | |
| CspsbA | F: GTATTCCAGGCTGAGCACAACATC |
| R: TACCTAAAGCGGTGGACCAGATAC | |
| CspsbB | F: GGTATTTGGAGTTACGAAGGTGTG |
| R: CCCAACCCTGAGAGAAATAAATGA | |
| CspsaA | F: GATTTCTCATAGTTGGTGCTGCTG |
| R: TACAAACCAAAACTGTGAAAGCCT | |
| CspsaB | F: ATTTGGACATCTTGTTTGGGCTAC |
| R: TGATGTAGAGGCAATCAAGAAAGC | |
| CsrbcL | F: TACTGATATCTTGGCAGCATTCCG |
| R: AAGATTCAGCAGCTACAGCGGC | |
| CsrbcS | F: ATGGCTTCATCCATTCTCTCATCC |
| R: CCAGTGAATGGTGCTACCATGCTA | |
| CsRca | F: GAATATGGCAACATGCTCGTCATG |
| R: TCCAAGAGCAGCTTCGTTCAGAT | |
| CsTPI | F: CTCTCTTTCACAACGTCCACTCACA |
| R: ACCAACGAAGAACTTGCCGGAG | |
| CsFBPase | F: AATCTCTCGTTCTCTCTCTCGCCTC |
| R: CGCTATGCCTTCTATTTCCACGG | |
| CsSBPase | F: CAGTGTCCTCCTCATACTTGGGTTG |
| R: CTGGGAAGAAAGATTGGGGAGAAA | |
| CsRupe | F: TCCCAAGTCAGTGGGTTTATCGGAG |
| R: AACCTTCTCCTCGAAACGGTAAGAG | |
| CsPRK | F: ATCCACACCCTCATTCATTTCTCC |
| R: GCAGTTGAGGGAGTGAAGAAGAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nie, W.; He, Q.; Ma, J.; Guo, H.; Shi, Q. Exogenous 2,4-Epibrassinolide Alleviates Alkaline Stress in Cucumber by Modulating Photosynthetic Performance. Plants 2025, 14, 54. https://doi.org/10.3390/plants14010054
Nie W, He Q, Ma J, Guo H, Shi Q. Exogenous 2,4-Epibrassinolide Alleviates Alkaline Stress in Cucumber by Modulating Photosynthetic Performance. Plants. 2025; 14(1):54. https://doi.org/10.3390/plants14010054
Chicago/Turabian StyleNie, Wenjing, Qinghai He, Jinzhao Ma, Hongen Guo, and Qinghua Shi. 2025. "Exogenous 2,4-Epibrassinolide Alleviates Alkaline Stress in Cucumber by Modulating Photosynthetic Performance" Plants 14, no. 1: 54. https://doi.org/10.3390/plants14010054
APA StyleNie, W., He, Q., Ma, J., Guo, H., & Shi, Q. (2025). Exogenous 2,4-Epibrassinolide Alleviates Alkaline Stress in Cucumber by Modulating Photosynthetic Performance. Plants, 14(1), 54. https://doi.org/10.3390/plants14010054

