GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness
Abstract
1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Plant Materials, Plant Growth and Growth Conditions
3.2. Seed Imbibition Phenotyping
3.3. DNA Isolation, PCR, Sequencing and Alignments
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mohamed, Y.Y.; Barringer, S.A.; Splittstoesser, W.E. The role of seed coats in seed viability. Bot. Rev. 1994, 60, 426–439. [Google Scholar] [CrossRef]
- Potts, H.C.; Duangpatra, J.; Hairston, W.G. Some influences of hard seededness on soybean seed quality. Crop Sci. 1978, 18, 221–224. [Google Scholar] [CrossRef]
- Heatherly, L.G.; Kenty, M.M.; Kilen, T.C. Effects of storage environment and duration on impermeable seed coat in soybean. Field Crops Res. 1995, 40, 57–62. [Google Scholar] [CrossRef]
- Sedivy, E.J.; Wu, F.; Hanzawa, Y. Soybean domestication: The origin, genetic architecture and molecular bases. New Phytol. 2017, 214, 539–553. [Google Scholar] [CrossRef] [PubMed]
- Abbo, S.; Shtienberg, D.; Lichtenzveig, J.; Lev-Yadun, S.; Gopher, A. The chickpea, summer cropping, and a new model for pulse domestication in the ancient near east. Q. Rev. Biol. 2003, 78, 435–448. [Google Scholar] [CrossRef] [PubMed]
- Weeden, N.F. Genetic changes accompanying the domestication of Pisum sativum: Is there a common genetic basis to the ‘domestication syndrome’ for legumes? Ann. Bot. 2007, 100, 1017–1025. [Google Scholar] [CrossRef] [PubMed]
- Andargie, M.; Pasquet, R.S.; Gowda, B.S.; Muluvi, G.M.; Timko, M.P. Molecular mapping of QTLs for domestication-related traits in cowpea (V. unguiculata (L.) Walp.). Euphytica 2014, 200, 401–412. [Google Scholar] [CrossRef]
- Mullin, W.J.; Xu, W. Study of soybean seed coat components and their relationship to water absorption. J. Agric. Food Chem. 2001, 49, 5331–5335. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Miao, Z.; Cai, C.; Zhang, D.; Zhao, M.; Wu, Y.; Zhang, X.; Swarm, S.A.; Zhou, L.; Zhang, Z.J.; et al. GmHs1-1, encoding a calcineurin-like protein, controls hard-seededness in soybean. Nat. Genet. 2015, 47, 939–943. [Google Scholar] [CrossRef]
- Jang, S.J.; Sato, M.; Sato, K.; Jitsuyama, Y.; Fujino, K.; Mori, H.; Takahashi, R.; Benitez, E.R.; Liu, B.; Yamada, T.; et al. A Single-Nucleotide Polymorphism in an endo-1,4-beta-glucanase gene controls seed coat permeability in soybean. PLoS ONE 2015, 10, e0128527. [Google Scholar] [CrossRef]
- Liu, B.; Fujita, T.; Yan, Z.H.; Sakamoto, S.; Xu, D.; Abe, J. QTL mapping of domestication-related traits in soybean (Glycine max). Ann. Bot. 2007, 100, 1027–1038. [Google Scholar] [CrossRef] [PubMed]
- Wen, Z.; Lu, X.; Wen, J.; Wang, Z.; Chai, M. Physical seed dormancy in legumes: Molecular advances and perspectives. Plants 2024, 13, 1473. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Guan, R.; Liu, Z.; Ma, Y.; Wang, L.; Li, L.; Lin, F.; Luan, W.; Chen, P.; Yan, Z.; et al. Genetic structure and diversity of cultivated soybean (Glycine max (L.) Merr.) landraces in China. Theor. Appl. Genet. 2008, 117, 857–871. [Google Scholar] [CrossRef] [PubMed]
- Boerma, H.R.; Specht, J.E. Soybeans: Improvement, Production and Uses; American Society of Agronomy: Madison, WI, USA, 2004. [Google Scholar]
- Keim, P.; Diers, B.W.; Shoemaker, R.C. Genetic analysis of soybean hard seededness with molecular markers. Theor. Appl. Genet. 1990, 79, 465–469. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, S.; Tajuddin, T.; Yamanaka, N.; Hayashi, M.; Harada, K. Analysis of QTLs for reproductive development and seed quality traits in soybean using recombinant inbred lines. Breed. Sci. 2004, 54, 399–407. [Google Scholar] [CrossRef]
- Kebede, H.; Smith, J.R.; Ray, J.D. Identification of a single gene for seed coat impermeability in soybean PI 594619. Theor. Appl. Genet. 2014, 127, 1991–2003. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, Y.; Kaga, A.; Tomooka, N.; Yano, H.; Takada, Y.; Kato, S.; Vaughan, D. QTL affecting fitness of hybrids between wild and cultivated soybeans in experimental fields. Ecol. Evol. 2013, 3, 2150–2168. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Wang, Y.; Song, C.; Zhou, J.; Qiu, L.; Huang, H.; Wang, Y. A single origin and moderate bottleneck during domestication of soybean (Glycine max): Implications from microsatellites and nucleotide sequences. Ann. Bot. 2010, 106, 505–514. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.; Zhao, X.; Liu, D.; Li, Y.; Lightfoot, D.A.; Yang, Z.; Zhao, L.; Zhou, G.; Wang, Z.; Huang, L.; et al. Domestication footprints anchor genomic regions of agronomic importance in soybeans. New Phytol. 2016, 209, 871–884. [Google Scholar] [CrossRef]
- Zhou, Z.; Jiang, Y.; Wang, Z.; Gou, Z.; Lyu, J.; Li, W.; Yu, Y.; Shu, L.; Zhao, Y.; Ma, Y.; et al. Resequencing 302 wild and cultivated accessions identifies genes related to domestication and improvement in soybean. Nat. Biotechnol. 2015, 33, 408–414. [Google Scholar] [CrossRef]
- Sun, Y.; Gong, Y. Research advances on the hard seededness trait of soybean and the underlying regulatory mechanisms. Front. Plant Sci. 2024, 15, 1419962. [Google Scholar] [CrossRef] [PubMed]
- Wang, J. Study on preservation of soybean germplasm using soybean hard seed. Soybean Sci. 1999, 18, 351–354. [Google Scholar]

| No. | Accession | Allele | Phenotype | Category | Province/State | Country |
|---|---|---|---|---|---|---|
| 1 | PI 483464A | GmHs1-1 GmqHS1 | Hard | Glycine soja | Ningxia | China |
| 2 | PI 407301 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Jiangsu | China |
| 3 | PI 407140 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Kumamoto | Japan |
| 4 | PI 326582A | GmHs1-1 GmqHS1 | Hard | Glycine soja | Primorye | Russia |
| 5 | PI 483465 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Shaanxi | China |
| 6 | PI 464935 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Jiangsu | China |
| 7 | PI 468400A | GmHs1-1 GmqHS1 | Hard | Glycine soja | Ningxia | China |
| 8 | PI 468916 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Liaoning | China |
| 9 | PI 339871A | GmHs1-1 GmqHS1 | Hard | Glycine soja | Cheju | Korea |
| 10 | PI 458538 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Heilongjiang | China |
| 11 | PI 597459D | GmHs1-1 GmqHS1 | Hard | Glycine soja | Shandong | China |
| 12 | PI 393551 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Taiwan | China |
| 13 | PI 597461A | GmHs1-1 GmqHS1 | Hard | Glycine soja | Shandong | China |
| 14 | PI 407131 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Kumamoto | Japan |
| 15 | PI 447004 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Jilin | China |
| 16 | PI 562559 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Cholla Puk | S. Korea |
| 17 | PI 366120 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Akita | Japan |
| 18 | PI 407170 | GmHs1-1 GmqHS1 | Hard | Glycine soja | Kyonggi | S. Korea |
| 19 | PI 536637 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | South Carolina | USA |
| 20 | PI 548985 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | South Carolina | USA |
| 21 | PI 518664 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Virginia | USA |
| 22 | PI 548604 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Missouri | USA |
| 23 | PI 548520 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Iowa | USA |
| 24 | PI 522236 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Georgia | USA |
| 25 | PI 533655 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Illinois | USA |
| 26 | PI 508266 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | North Carolina | USA |
| 27 | PI 515961 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Kentucky | USA |
| 28 | PI 533602 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Arkansas | USA |
| 29 | PI 548638 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ontario (Guelph) | Canada |
| 30 | PI 553047 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Georgia | USA |
| 31 | PI 513382 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Minnesota | USA |
| 32 | PI 548644 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ontario (Guelph) | Canada |
| 33 | PI 536635 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ohio | USA |
| 34 | PI 548643 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ontario (Ottawa) | Canada |
| 35 | PI 508083 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Minnesota | USA |
| 36 | PI 525453 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Iowa | USA |
| 37 | PI 548634 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ohio | USA |
| 38 | PI 542403 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Minnesota | USA |
| 39 | PI 540552 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Ohio | USA |
| 40 | PI 556511 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Michigan | USA |
| 41 | PI 548512 | Gmhs1-1 Gmqhs1 | Permeable | Glycine max | Indiana | USA |
| Source of Gene Sequence | Primer Name | Primer Sequence | Application |
|---|---|---|---|
| Glyma.02G269400 | GmqHS1 F | GCTACTATGCGTCGGTGAGT | For cloning of the SOYBEAN GmqHS1 and SNP sequencing |
| Glyma.02G269400 | GmqHS1 R | GAGACCATGAGTTGAAGGCCA | For cloning of the SOYBEAN GmqHS1 and SNP sequencing |
| Glyma.02G269500 | GmHs1-1 F1 | TGGGCTTTCATTAGGTCAGACAAAC | For cloning of the SOYBEAN GmHs1-1 and SNP sequencing |
| Glyma.02G269500 | GmHs1-1 R1 | TCGAAGGAGTGACATCCAAGGTAA | For cloning of the SOYBEAN GmHs1-1 and SNP sequencing |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, H.; Tian, D.; Zhang, Q.; Wen, J.; Wang, Z.-Y.; Chai, M. GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness. Plants 2024, 13, 2061. https://doi.org/10.3390/plants13152061
Yan H, Tian D, Zhang Q, Wen J, Wang Z-Y, Chai M. GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness. Plants. 2024; 13(15):2061. https://doi.org/10.3390/plants13152061
Chicago/Turabian StyleYan, Huifang, Daicai Tian, Qian Zhang, Jiangqi Wen, Zeng-Yu Wang, and Maofeng Chai. 2024. "GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness" Plants 13, no. 15: 2061. https://doi.org/10.3390/plants13152061
APA StyleYan, H., Tian, D., Zhang, Q., Wen, J., Wang, Z.-Y., & Chai, M. (2024). GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness. Plants, 13(15), 2061. https://doi.org/10.3390/plants13152061

