Genetic Analysis and Construction of a Fingerprint for Licensed Triadica sebifera Cultivars Using SSR Markers
Abstract
1. Introduction
2. Results
2.1. Genetic Diversity
2.2. Genetic Differentiation
2.3. Unique Alleles
2.4. Fingerprinting of Cultivars
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. DNA Extraction
4.3. Genotyping with SSR Markers
4.4. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhou, P.Y.; Zhou, Q.; Dong, F.P.; Shen, X.; Li, Y.G. Study on the genetic variation of Triadica sebifera (Linnaeus) small populations based on SSR markers. Forests 2022, 13, 1330. [Google Scholar] [CrossRef] [Scilit]
- Gao, R.X.; Su, Z.S.; Yin, Y.B.; Sun, L.N.; Li, S.Y. Germplasm, chemical constituents, biological activities, utilization, and control of Chinese tallow (Triadica sebifera (L.) Small). Biol. Invasions 2016, 18, 809–829. [Google Scholar] [CrossRef] [Scilit]
- Dolma, S.K.; Singh, P.P.; Reddy, S.G.E. Insecticidal and enzyme inhibition activities of leaf/bark extracts, fractions, seed oil and isolated compounds from Triadica sebifera (L.) Small against Aphis craccivora Koch. Molecules 2022, 27, 1967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mia, R.; Islam, M.M.; Ahmed, T.; Waqar, M.A.; Khanam, N.J.; Sultana, S.; Bhuiyan, M.S.K.; Uddin, M.N. Natural dye extracted from Triadica sebifera in aqueous medium for sustainable dyeing and functionalizing of viscose fabric. Clean. Eng. Technol. 2022, 8, 100471. [Google Scholar] [CrossRef] [Scilit]
- Fu, R.; Zhang, Y.; Guo, Y.; Chen, F. Chemical composition, antioxidant and antimicrobial activity of Chinese tallow tree leaves. Ind. Crops Prod. 2015, 76, 374–376. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.B.; Dong, X.Y.; Liang, Z.H.; Dou, Q.Q.; Zhang, M. Breeding of new varieties of Sapium sebiferum ‘Qiuyan 1’ autumn leaves. Forest Sci. Technol. 2018, 550, 57–59. [Google Scholar] [CrossRef]
- Li, Y.G.; Shen, F.Q.; Xu, Y.Q.; Jiang, D.Y.; Liu, X.H. A new ornamental Triadica sebifera cultivar ‘Hongzi Jiaren’. Acta Hortic. Sin. 2022, 47 (Suppl. S2), 3137–3138. [Google Scholar] [CrossRef]
- Gaši, F.; Sehic, J.; Grahic, J.; Hjeltnes, S.H.; Ordidge, M.; Benedikova, D.; Blouin-Delmas, M.; Drogoudi, P.; Giovannini, D.; Höfer, M.; et al. Genetic assessment of the pomological classification of plum Prunus domestica L. accessions sampled across Europe. Genet. Resour. Crop Evol. 2020, 67, 1137–1161. [Google Scholar] [CrossRef] [Scilit]
- Antanynienė, R.; Šikšnianienė, J.B.; Stanys, V.; Frercks, B. Fingerprinting of plum (Prunus domestica) genotypes in Lithuania using SSR markers. Plants 2023, 12, 1538. [Google Scholar] [CrossRef] [Scilit]
- Ma, S.N.; Han, C.Y.; Zhou, J.; Hu, R.C.; Jiang, X.; Wu, F.F.; Tian, K.; Nie, G.; Zhang, X.Q. Fingerprint identification of white clover cultivars based on SSR molecular markers. Mol. Biol. Rep. 2020, 47, 8513–8521. [Google Scholar] [CrossRef] [Scilit]
- Chau, T.P.; Samdani, M.S.; Jhanani, G.K.; Sathiyamoorthi, E.; Lee, J. Metal accumulation and genetic adaptation of Oryza sativa to Cadmiun and Chromium heavy metal stress: A hydroponic and RAPD analyses. Environ. Res. 2024, 242, 117793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bisht, V.; Rawat, J.M.; Gaira, K.S.; Purohit, S.; Anand, J.; Sinha, S.; Rawat, B. Assessment of genetic homogeneity of in-vitro propagated apple root stock MM 104 using ISSR and SCoT primers. BMC Plant Biol. 2024, 24, 240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, N.; Chen, J.; Wang, Y.; Hussain, I.; Lei, N.; Ma, X.; Li, W.; Liu, K.; Yu, H.; Zhao, K.; et al. Development and utility of SSR markers based on Brassica sp. whole-genome in triangle of U. Front. Plant Sci. 2024, 14, 1259736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santiago, E.; Caballero, A.; Köpke, C.; Novo, I. Estimation of the contemporary effective population size from SNP data while accounting for mating structure. Mol. Ecol. Resour. 2024, 24, e13890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbasov, M.; Akparov, Z.; Gross, T.; Babayeva, S.; Izzatullayeva, V.; Hajiyev, E.; Rustamov, K.; Gross, P.; Tekin, M.; Akar, T.; et al. Genetic relationship of diploid wheat (Triticum spp.) species assessed by SSR markers. Genet. Resour. Crop Evol. 2018, 65, 1441–1453. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Q.; Mu, K.M.; Ni, Z.X.; Liu, X.H.; Li, Y.G.; Xu, L.A. Analysis of genetic diversity of ancient Ginkgo populations using SSR markers. Ind. Crops Prod. 2020, 145, 111942. [Google Scholar] [CrossRef] [Scilit]
- Testolin, R.; Messina, R.; Cipriani, G.; De Mori, G. SSR-based DNA fingerprinting of fruit crops. Crop Sci. 2023, 63, 390–459. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Lyu, M.; Liu, J.; Wu, J.; Wang, Q.; Xie, T.; Li, H.; Chen, R.; Sun, D.; Yang, Y.; et al. Construction of an SNP fingerprinting database and population genetic analysis of 329 cauliflower cultivars. BMC Plant Biol. 2022, 22, 522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.X.; Zhou, Q.; Tao, Y.Y.; Xu, M.; Yu, W.W.; Xu, L.A. The fingerprints construction and genetic diversity analysis of 48 fruit-used Ginkgo cultivars based on SSR markers. Mol. Plant Breed. 2017, 15, 1963–1970. [Google Scholar] [CrossRef]
- Zhang, M.; Zheng, C.; Li, J.; Wang, X.; Liu, C.; Li, X.; Xu, Z.; Du, K. Genetic diversity, population structure, and DNA fingerprinting of Ailanthus altissima var. erythrocarpa based on EST-SSR markers. Sci. Rep. 2023, 13, 19315. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, N.; Tian, R.; Lu, J.; Li, G.; Sun, J.; Lin, R.; Zhao, C.; Zhou, C.; Chang, H.; Zhao, S.; et al. DNA fingerprinting and genetic diversity analysis in Asparagus officinalis L. cultivars using microsatellite molecular markers. Genet. Resour. Crop Evol. 2023, 70, 1163–1177. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Li, Y.; Li, Y.; Zhang, Y.; Hao, Y.; Hou, Z.; Qi, J. Development of SSR markers for and fingerprinting of walnut genetic resources. Forests 2024, 15, 405. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Chen, Y.; Yang, Y.; Wu, W.; Liu, Y.; Fan, Q.; Zhou, R. Phylogenetic relationships and natural hybridization in Triadica inferred from nuclear and chloroplast DNA analyses. Biochem. Syst. Ecol. 2016, 64, 142–148. [Google Scholar] [CrossRef] [Scilit]
- Zhi, Y.; Taylor, M.C.; Campbell, P.M.; Warden, A.C.; Shrestha, P.; El Tahchy, A.; Rolland, V.; Vanhercke, T.; Petrie, J.R.; White, R.G.; et al. Comparative lipidomics and proteomics of lipid droplets in the mesocarp and seed tissues of Chinese tallow (Triadica sebifera). Front. Plant Sci. 2017, 8, 1339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeWalt, S.J.; Siemann, E.; Rogers, W.E. Microsatellite markers for an invasive tetraploid tree, Chinese tallow (Triadica sebifera). Mol. Ecol. Notes 2006, 6, 505–507. [Google Scholar] [CrossRef] [Scilit]
- DeWalt, S.J.; Siemann, E.; Rogers, W.E. Geographic distribution of genetic variation among native and introduced populations of Chinese tallow tree, Triadica sebifera (Euphorbiaceae). Am. J. Bot. 2011, 98, 1128–1138. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, Y.F.; Wang, Z.F.; Wu, L.F. New set of microsatellites for Chinese tallow tree, Triadica sebifera. Genet. Mol. Res. 2017, 16, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forcada, J.; Hoffman, J. Climate change selects for heterozygosity in a declining fur seal population. Nature 2014, 511, 462–465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellegren, H.; Galtier, N. Determinants of genetic diversity. Nat. Rev. Genet. 2016, 17, 422–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swarup, S.; Cargill, E.J.; Crosby, K.; Flagel, L.; Kniskern, J.; Glenn, K.C. Genetic diversity is indispensable for plant breeding to improve crops. Crop Sci. 2021, 61, 839–852. [Google Scholar] [CrossRef] [Scilit]
- Fossati, T.; Zapelli, I.; Bisoffi, S.; Micheletti, A.; Vietto, L.; Sala, F.; Castiglione, S. Genetic relationships and clonal identity in a collection of commercially relevant poplar cultivars assessed by AFLP and SSR. Tree Genet. Genomes 2005, 1, 11–20. [Google Scholar] [CrossRef] [Scilit]
- Ercisli, S.; Ipek, A.; Barut, E. SSR Marker-Based DNA Fingerprinting and Cultivar Identification of Olives (Olea europaea). Biochem. Genet. 2011, 49, 555–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gökirmak, T.; Mehlenbacher, S.A.; Bassil, N.V. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resour. Crop Evol. 2009, 56, 147–172. [Google Scholar] [CrossRef] [Scilit]
- Ganopoulos, I.V.; Kazantzis, K.; Chatzicharisis, I.; Karayiannis, I.; Tsaftaris, A.S. Genetic diversity, structure and fruit trait associations in Greek sweet cherry cultivars using microsatellite based (SSR/ISSR) and morpho-physiological markers. Euphytica 2011, 181, 237–251. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Li, J.; Zhao, Y.B.; Korban, S.S.; Han, Y.P. Evaluation of Genetic Diversity in Chinese Wild Apple Species Along with Apple Cultivars Using SSR Markers. Plant Mol. Biol. Rep. 2012, 30, 539–546. [Google Scholar] [CrossRef] [Scilit]
- Chen, B.Q.; Cao, S.J.; Shen, X.; Zhuge, F.; Lu, X.C.; Li, Y.G. Phenotypic diversity analysis and comprehensive evaluation of ornamental Triadica sebiferum varieties. Mol. Plant Breed. 2022, 20, 4108–4120. [Google Scholar] [CrossRef]
- Reim, S.; Lochschmidt, F.; Proft, A.; Höfer, M. Genetic integrity is still maintained in natural populations of the indigenous wild apple species Malus sylvestris (Mill.) in Saxony as demonstrated with nuclear SSR and chloroplast DNA markers. Ecol. Evol. 2020, 10, 11798–11809. [Google Scholar] [CrossRef] [Scilit]
- Amritha, M.S.; Dhanya, O.G.; Nair, A.G.; Vidya, P.; Muthusamy, S.K.; Mohan, C. Genetic diversity studies between Ipomoea wild species and cultivated sweet potato (Ipomoea batatas (L.) Lam.) using SSR markers. S. Afr. J. Bot. 2024, 169, 452–463. [Google Scholar] [CrossRef] [Scilit]
- Impens, L.; Lorenzo, C.D.; Vandeputte, W.; Wytynck, P.; Debray, K.; Haeghebaert, J.; Herwegh, D.; Jacobs, T.B.; Ruttink, T.; Nelissen, H.; et al. Combining multiplex gene editing and doubled haploid technology in maize. New Phytol. 2023, 239, 1521–1532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.R.; Lübberstedt, T.; Frei, U.K. Development of doubled haploid inducer lines facilitates selection of superior haploid inducers in maize. Front. Plant Sci. 2024, 14, 1320660. [Google Scholar] [CrossRef] [Scilit]
- Corrado, G.; Forlani, M.; Rao, R.; Basile, B. Diversity and relationships among neglected apricot (Prunus armeniaca L.) landraces using morphological traits and SSR markers: Implications for agro-biodiversity conservation. Plants 2021, 10, 1341. [Google Scholar] [CrossRef] [Scilit]
- Gijbels, P.; De Hert, K.; Jacquemyn, H.; Honnay, O. Reduced fecundity and genetic diversity in small populations of rewarding versus deceptive orchid species: A meta-analysis. Plant Ecol. Evol. 2015, 148, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Erfani, J.; Ebadi, A.; Abdollahi, H.; Fatahi, R. Genetic Diversity of Some Pear Cultivars and Genotypes Using Simple Sequence Repeat (SSR) Markers. Plant Mol. Biol. Rep. 2012, 30, 1065–1072. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Li, R.; Zhang, N.; Zhang, J.; Hou, W.; Qu, Z.; Zheng, P. Genetic diversity and population structure of Chinese mountain cultivated Panax ginseng accessions using SSR and KASP markers. Genet. Resour. Crop Evol. 2024, 71, 1493–1506. [Google Scholar] [CrossRef] [Scilit]
- Zavinon, F.G.; Djossou, R.; Gbéto, M.; Fonhan, N.; Kouke, R.; Adoukonou-Sagbadja, H. SSR-marker assisted evaluation of genetic diversity in local and exotic pigeonpea cultivars in Benin for parental genotypes selection. Plant Gene 2024, 37, 100443. [Google Scholar] [CrossRef] [Scilit]
- Habier, D.; Fernando, R.L.; Dekkers, J.C.M. The impact of genetic relationship information on genome-assisted breeding values. Genetics 2007, 177, 2389–2397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Birchler, J. Heterosis: The genetic basis of hybrid vigour. Nat. Plants 2015, 1, 15020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, R.B.; Chan, E.K.; Cowley, M.J.; Little, P.F. The influence of genetic variation on gene expression. Genome Res. 2007, 17, 1707–1716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Li, F.; Nie, L. Integrating multiple ‘omics’ analysis for microbial biology: Application and methodologies. Microbiology 2010, 156, 287–301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiménez-Cantizano, A.; Muñoz-Martín, A.; Amores-Arrocha, A.; Sancho-Galán, P.; Palacios, V. Identification of red grapevine cultivars (Vitis vinifera L.) preserved in ancient vineyards in Axarquia (Andalusia, Spain). Plants 2020, 9, 1572. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Li, P.; Tang, W.; Zheng, J.; Fan, F.; Jiang, X.; Li, Z.; Fang, Y. Simultaneous determination of subspecies and geographic origins of 110 rice cultivars by microsatellite markers. Food Chem. 2024, 445, 138657. [Google Scholar] [CrossRef] [Scilit]
- Palero, F.; González-Candelas, F.; Pascual, M. MICROSATELIGHT—pipeline to expedite microsatellite analysis. J. Hered. 2011, 102, 247–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, K.J.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goudet, J. FSTAT (version 1.2): A computer program to calculate F-statistics. J. Hered. 1995, 86, 485–486. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. Genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]




| Locus | Sample Size | Na | Ne | Ho | He | I | PIC |
|---|---|---|---|---|---|---|---|
| SSR01 | 21 | 11 | 6.78 | 0.00 | 0.87 | 2.15 | 0.84 |
| SSR02 | 21 | 12 | 8.02 | 0.00 | 0.90 | 2.28 | 0.86 |
| SSR03 | 21 | 7 | 3.97 | 0.00 | 0.77 | 1.64 | 0.72 |
| SSR04 | 21 | 14 | 9.38 | 0.00 | 0.92 | 2.45 | 0.88 |
| SSR05 | 21 | 10 | 7.00 | 0.00 | 0.88 | 2.11 | 0.84 |
| SSR06 | 21 | 10 | 5.31 | 0.00 | 0.83 | 1.95 | 0.79 |
| SSR07 | 21 | 10 | 4.41 | 0.24 | 0.79 | 1.81 | 0.75 |
| SSR08 | 21 | 18 | 16.33 | 0.00 | 0.96 | 2.85 | 0.94 |
| SSR09 | 21 | 11 | 6.58 | 0.00 | 0.87 | 2.14 | 0.83 |
| SSR10 | 21 | 10 | 5.88 | 0.00 | 0.85 | 2.02 | 0.81 |
| SSR11 | 21 | 9 | 5.58 | 0.00 | 0.84 | 1.95 | 0.80 |
| SSR12 | 21 | 19 | 10.26 | 0.52 | 0.92 | 2.64 | 0.90 |
| SSR13 | 21 | 10 | 7.00 | 0.00 | 0.88 | 2.14 | 0.84 |
| SSR14 | 21 | 8 | 3.90 | 0.24 | 0.76 | 1.69 | 0.72 |
| SSR15 | 21 | 10 | 6.63 | 0.14 | 0.87 | 2.08 | 0.83 |
| SSR16 | 21 | 10 | 5.88 | 0.00 | 0.85 | 2.02 | 0.81 |
| Mean | 21 | 11.19 | 7.06 | 0.07 | 0.86 | 2.12 | 0.82 |
| Regions | Sample Size | Na | He | I | AR |
|---|---|---|---|---|---|
| Anhui | 7 | 4.81 | 0.78 | 1.44 | 2.92 |
| Hubei | 2 | 1.75 | 0.50 | 0.52 | 1.75 |
| Jiangsu | 8 | 6.13 | 0.84 | 1.68 | 3.15 |
| Zhejiang | 4 | 3.56 | 0.73 | 1.15 | 2.72 |
| Mean | 4.06 | 0.71 | 1.20 | 2.63 |
| Source of Variance | Variance Component | Percentage of Total | p Value |
|---|---|---|---|
| Among regions | 0.27 | 4% | <0.01 |
| Among cultivars | 6.27 | 88% | |
| Within cultivars | 0.57 | 8% | |
| Total | 7.11 | 100% |
| Cultivars | Unique Allele Lengths in bp (Locus) | Number of Unique Alleles |
|---|---|---|
| Zilinglong | 413 (SSR01); 251 (SSR08); 192 (SSR09); 136 (SSR12); 157 (SSR13) | 5 |
| Huangjinyi | 204 (SSR06); 215 (SSR15) | 2 |
| Hongfeicui | 134 (SSR05); 232 (SSR08); 190 (SSR11) | 3 |
| Zimanao | 156 (SSR12) | 1 |
| Hongzijiaren | 238 (SSR07); 169 (SSR08) | 2 |
| Zhaoxia | 391 (SSR01); 192 (SSR04); 163 (SSR05); 227 (SSR08); 196 (SSR09); 164 (SSR12); 200 (SSR15) | 7 |
| Huangjinjia | 411 (SSR01); 225 (SSR06); 202 (SSR15) | 3 |
| Huihuang | 286 (SSR02); 210 (SSR04); 262 (SSR06); 236 (SSR08); 166 (SSR10); 151 (SSR12) | 6 |
| Canlan | 396 (SSR01); 298 (SSR02); 202 (SSR04); 170 (SSR05); 249 (SSR06); 230 (SSR08); 208 (SSR15) | 7 |
| Haibinmenghuan | 119 (SSR03); 126 (SSR05); 159 (SSR10); 141 (SSR12); 162 (SSR16) | 5 |
| Haibinfeihong | 409 (SSR01); 184 (SSR11); 193 (SSR15) | 3 |
| Qiuyan 01 | 402 (SSR01); 335 (SSR02); 185 (SSR04); 230 (SSR06); 188 (SRR07); 238 (SSR08); 205 (SSR09); 167 (SSR12) | 8 |
| Haibinzijing | 280 (SSR02); 173 (SSR08); 157 (SSR10) | 3 |
| Feiyunzhaoshui | 195 (SSR04); 241 (SSR06); 218 (SSR08); 194 (SSR09); 153 (SSR10); 167 (SSR11); 160 (SSR12); 170 (SSR13); 178 (SSR14); 177 (SSR16) | 10 |
| Qiuhuang 01 | 275 (SSR02); 228 (SSR06); 190 (SSR07); 163 (SSR08); 145 (SSR10); 187 (SSR11); 147 (SSR12); 150 (SSR16) | 8 |
| Haibinwanxia | 290 (SSR02); 115 (SSR03); 187 (SSR04); 244 (SSR08); 208 (SSR09); 169 (SSR12); 164 (SSR16) | 7 |
| Ziyan | 183 (SSR04); 173 (SSR12); 206 (SSR15) | 3 |
| Puhongjiu | 278 (SSR02); 189 (SSR04); 192 (SSR07); 200 (SSR08); 184 (SSR09); 175 (SSR12); 159 (SSR14); 166 (SSR16) | 8 |
| Pudazi | 195 (SSR07); 171 (SSR08); 179 (SSR12); 154 (SSR16) | 4 |
| Xuanliheshan | 241 (SSR07); 167 (SSR08) | 2 |
| Zhengyan | 393 (SSR01); 288 (SSR02); 212 (SSR04); 161 (SSR05); 234 (SSR08); 188 (SSR09); 159 (SSR10); 160 (SSR13) | 8 |
| Total | 105 |
| Cultivars | Origins | Regions | Codes of Cultivars | Autumn Leaf Color |
|---|---|---|---|---|
| Zilinglong | Chuzhou, Anhui | Anhui | 20180091 | Purple |
| Huangjinyi | Chuzhou, Anhui | 20180391 | Yellow | |
| Hongfeicui | Guangde, Anhui | 20150168 | Red | |
| Zimanao | Guangde, Anhui | 20170053 | Purple | |
| Hongzijiaren | Qianxian, Anhui | 20190340 | Red | |
| Zhaoxia | Qianxian, Anhui | 20220211 | Orange | |
| Huangjinjia | Xuancheng, Anhui | 20150167 | Yellow | |
| Huihuang | Dawu, Hubei | Hubei | 20220215 | Yellow |
| Canlan | Dawu, Hubei | 20220214 | Yellow | |
| Haibinmenghuan | Dongtai, Jiangsu | Jiangsu | 20180072 | Red |
| Haibinfeihong | Lianyungang, Jiangsu | 20180075 | Purple | |
| Qiuyan 01 | Nanjing, Jiangsu | 20160107 | Red | |
| Haibinzijing | Nanjing, Jiangsu | 20180073 | Purple | |
| Feiyunzhaoshui | Nanjing, Jiangsu | 20200119 | Purple | |
| Qiuhuang 01 | Xinyi, Jiangsu | 20160109 | Yellow | |
| Haibinwanxia | Xuzhou, Jiangsu | 20180074 | Purple | |
| Ziyan | Zhenjiang, Jiangsu | 20160108 | Red | |
| Puhongjiu | Pujiang, Zhejiang | Zhejiang | Zhe R-SV-SS-006-2018 | Red |
| Pudazi | Pujiang, Zhejiang | 20180397 | Purple | |
| Xuanliheshan | Pujiang, Zhejiang | 20190339 | Purple | |
| Zhengyan | Suichang, Zhejiang | 20220212 | Red |
| Locus | Repeat Motif | Primer Sequence (5′~3′) | Fragment Size (bp) | Tm (°C) | Source |
|---|---|---|---|---|---|
| SSR01 | (AG)10 | AAACAAGTGAAGTGCCCAT | 392 | 51 | [1] |
| TTAGCCCAGCCCATTATTA | |||||
| SSR02 | (AAG)12 | GGTTTCTTTTGCTCTCTTC | 277 | 49 | |
| CCGGTTACTGCATTTCATA | |||||
| SSR03 | (CA)11 | CCAACAAGTTAGCATCACCT | 115 | 58 | [25] |
| CAACAGAAGTTCCTCAATGT | |||||
| SSR04 | (CT)15 | CTCCAGCAGCTCTTCATCT | 152 | 58 | |
| CGAACCAAGAATTAGGAAAAC | |||||
| SSR05 | (AAG)10 | GCCTTAAAGACATGGGATTC | 126 | 58 | |
| CGATCCATTCTCTCTTGACA | |||||
| SSR06 | (CTT)6 | CTGATGGCAGTTCTTTGAGAT | 203 | 58 | |
| GCCTGTTGTGGAATAGTGG | |||||
| SSR07 | (AG)10 | AACCCGTAAAGGGCTTGC | 192 | 55 | [27] |
| CTGGTTCTCCTGGTTATCTATGC | |||||
| SSR08 | (ATT)10 | AAGGAATGGAGCGAAACGG | 163 | 55 | |
| CCAATTGCGGCCATACTCG | |||||
| SSR09 | (CTT)10 | TCCGATCCAGTCCGTGTTG | 184 | 55 | |
| GTGCGCGTGAGAGTGAATG | |||||
| SSR10 | (CTT)9 | TCTCTCCTTCGCTCAACGG | 145 | 55 | |
| TCCGGGATCGGTGGAATTG | |||||
| SSR11 | (CT)9 | GTTTGTGAAGAGGGGTGAGC | 179 | 55 | |
| AGTTGCTGAAATCCATACCATACC | |||||
| SSR12 | (ATT)9 | TGAACCTCGAACAAAAGTCAG | 122 | 55 | |
| GTCAT(C/A)ATAACTTCGCGGG | |||||
| SSR13 | (TAA)7 | GTCAGCAGGGGAGAGCAAC | 138 | 55 | |
| AATGGACAAAATGGCGCAC | |||||
| SSR14 | (AG)16 | AAGGAACCTGTTTGCTGGG | 151 | 55 | |
| AAGTTCCGTTTCCACACGC | |||||
| SSR15 | (CT)9GCC(TG)6 | GTCAGTCGTCACCATCATCAG | 202 | 55 | |
| CTACGACGACGCAACCAAC | |||||
| SSR16 | (ATT)11 | TCTTCGGGGAAACCGATCC | 151 | 55 | |
| TGCTTTCAAAATGACACGGTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Q.; Chen, B.; Jiang, D.; Zhuge, F.; Li, Y. Genetic Analysis and Construction of a Fingerprint for Licensed Triadica sebifera Cultivars Using SSR Markers. Plants 2024, 13, 1767. https://doi.org/10.3390/plants13131767
Zhou Q, Chen B, Jiang D, Zhuge F, Li Y. Genetic Analysis and Construction of a Fingerprint for Licensed Triadica sebifera Cultivars Using SSR Markers. Plants. 2024; 13(13):1767. https://doi.org/10.3390/plants13131767
Chicago/Turabian StyleZhou, Qi, Baiqiang Chen, Dongyue Jiang, Fei Zhuge, and Yingang Li. 2024. "Genetic Analysis and Construction of a Fingerprint for Licensed Triadica sebifera Cultivars Using SSR Markers" Plants 13, no. 13: 1767. https://doi.org/10.3390/plants13131767
APA StyleZhou, Q., Chen, B., Jiang, D., Zhuge, F., & Li, Y. (2024). Genetic Analysis and Construction of a Fingerprint for Licensed Triadica sebifera Cultivars Using SSR Markers. Plants, 13(13), 1767. https://doi.org/10.3390/plants13131767

