Brown Seaweed Extract (BSE) Application Influences Auxin- and ABA-Related Gene Expression, Root Development, and Sugar Yield in Beta vulgaris L.
Abstract
:1. Introduction
2. Results
2.1. Chemical Characterization of the BSE Extract
2.2. Transcriptomic Analysis of Plants Grown in the Open Field
2.2.1. Identification of DEGs Response to BSE Treatment
2.2.2. Candidate Genes Validation
2.3. Root Morphological Analysis of Plants Grown in Hydroponics
2.4. Yield Analysis
3. Discussion
4. Materials and Methods
4.1. Chemical Characterization of the BSE Extract
4.2. Plant Material and Growing Conditions
4.2.1. Field Experiment
4.2.2. Pots Experiment
4.2.3. Hydroponics Experiment
4.3. RNA Sequencing and Differential Gene Expression Analysis
4.4. Validation of Selected DEGs by RT-qPCR
4.5. Root Morphological Analysis
4.6. Yield Measurements
5. Statistical Analysis
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Xu, L.; Geelen, D. Developing biostimulants from agro-food and industrial by-products. Front. Plant Sci. 2018, 9, 1567. [Google Scholar] [CrossRef] [PubMed]
- Del Buono, D. Can biostimulants be used to mitigate the effect of anthropogenic climate change on agriculture? It is time to respond. Sci. Total Environ. 2021, 751, 141763. [Google Scholar] [CrossRef] [PubMed]
- Nardi, S.; Pizzeghello, D.; Schiavon, M.; Ertani, A. Plant biostimulants: Physiological responses induced by protein hydrolyzed- based products and humic substances in plant metabolism. Sci. Agric. 2016, 73, 18–23. [Google Scholar] [CrossRef]
- Van Oosten, M.J.; Pepe, O.; De Pascale, S.; Silletti, S.; Maggio, A. The role of biostimulants and bioeffectors as alleviators of abiotic stress in crop plants. Chem. Biol. Technol. Agric. 2017, 4, 1–12. [Google Scholar] [CrossRef]
- Hellequin, E.; Monard, C.; Chorin, M.; Daburon, V.; Klarzynski, O.; Binet, F. Responses of active soil microorganisms facing to a soil biostimulant input compared to plant legacy effects. Sci. Rep. 2020, 10, 13727. [Google Scholar] [CrossRef] [PubMed]
- Della Lucia, M.C.; Bertoldo, G.; Broccanello, C.; Maretto, L.; Ravi, S.; Marinello, F.; Sartori, L.; Marsilio, G.; Baglieri, A.; Romano, A.; et al. Novel effects of leonardite-based applications on sugar beet. Front. Plant Sci. 2021, 12, 646025. [Google Scholar] [CrossRef] [PubMed]
- Courtois, J. Oligosaccharides from land plants and algae: Production and applications in therapeutics and biotechnology. Curr. Opin. Microbiol. 2009, 12, 261–273. [Google Scholar] [CrossRef]
- de Jesus Raposo, M.F.; de Morais, R.M.S.C.; de Morais, A.M.M.B. Health applications of bioactive compounds from marine microalgae. Life Sci. 2013, 93, 479–486. [Google Scholar] [CrossRef]
- Ahmadi, A.; Zorofchian Moghadamtousi, S.; Abubakar, S.; Zandi, K. Antiviral potential of algae polysaccharides isolated from marine sources: A review. BioMed Res. Int. 2015, 2015, 825203. [Google Scholar] [CrossRef]
- Shukla, P.S.; Borza, T.; Critchley, A.T.; Hiltz, D.; Norrie, J.; Prithiviraj, B. Ascophyllum nodosum extract mitigates salinity stress in Arabidopsis thaliana by modulating the expression of miRNA involved in stress tolerance and nutrient acquisition. PLoS ONE 2018, 13, e0206221. [Google Scholar] [CrossRef]
- Okolie, C.L.; Mason, B.; Critchley, A.T. Seaweeds as a source of proteins for use in pharmaceuticals and high-value applications. In Novel Proteins for Food, Pharmaceuticals, and Agriculture; Wiley Blackwell: Hoboken, NJ, USA, 2018; pp. 217–238. [Google Scholar] [CrossRef]
- Ali, O.; Ramsubhag, A.; Jayaraman, J. Biostimulatory activities of Ascophyllum nodosum extract in tomato and sweet pepper crops in a tropical environment. PLoS ONE 2019, 14, e0216710. [Google Scholar] [CrossRef] [PubMed]
- Ali, O.; Ramsubhag, A.; Jayaraman, J. Phytoelicitor activity of Sargassum vulgare and Acanthophora spicifera extracts and their prospects for use in vegetable crops for sustainable crop production. J. Appl. Phycol. 2021, 33, 639–651. [Google Scholar] [CrossRef]
- Vijayanand, N.; Ramya, S.S.; Rathinavel, S. Potential of liquid extracts of Sargassum wightii on growth. biochemical and yield parameters of cluster bean plant. Asian Pac. J. Reprod. 2014, 3, 150–155. [Google Scholar] [CrossRef]
- Craigie, J.S. Seaweed extract stimuli in plant science and agriculture. J. Appl. Phycol. 2011, 23, 371–393. [Google Scholar] [CrossRef]
- Chouliaras, V.; Tasioula, M.; Chatzissavvidis, C.; Therios, I.; Tsabolatidou, E. The effects of a seaweed extract in addition to nitrogen and boron fertilization on productivity, fruit maturation, leaf nutritional status and oil quality of the olive (Olea europaea L.) cultivar Koroneiki. J. Sci. Food Agric. 2009, 89, 984–988. [Google Scholar] [CrossRef]
- Kaladharan, P.; Sridhar, N. Cytokinins from marine green alga, Caulerpa racemosa (Kuetz) Taylor. Fish. Technol. 1999, 36, 87–89. [Google Scholar]
- Wally, O.S.; Critchley, A.T.; Hiltz, D.; Craigie, J.S.; Han, X.; Zaharia, L.I.; Abrams, S.R.; Prithiviraj, B. Regulation of phytohormone biosynthesis and accumulation in Arabidopsis following treatment with commercial extract from the marine macroalga Ascophyllum nodosum. J. Plant Growth Regul. 2013, 32, 324–339. [Google Scholar] [CrossRef]
- Biancardi, E.; McGrath, J.M.; Panella, L.W.; Lewellen, R.T.; Stevanato, P. Sugar beet. In Root and Tuber Crops. Handbook of Plant Breeding; Bradshaw, J.E., Ed.; Springer Science + Business Media, LLC.: New York, NY, USA, 2010; pp. 173–219. [Google Scholar] [CrossRef]
- Barone, V.; Baglieri, A.; Stevanato, P.; Broccanello, C.; Bertoldo, G.; Bertaggia, M.; Cagnin, M.; Pizzeghello, D.; Moliterni, V.; Mandolino, G.; et al. Root morphological and molecular responses induced by microalgae extracts in sugar beet (Beta vulgaris L.). J. Appl. Phycol. 2018, 30, 1061–1071. [Google Scholar] [CrossRef]
- Della Lucia, M.C.; Baghdadi, A.; Mangione, F.; Borella, M.; Zegada-Lizarazu, W.; Ravi, S.; Deb, S.; Broccanello, C.; Concheri, G.; Monti, A.; et al. Transcriptional and physiological analyses to assess the effects of a novel biostimulant in tomato. Front. Plant Sci. 2022, 12, 781993. [Google Scholar] [CrossRef] [PubMed]
- Briglia, N.; Petrozza, A.; Hoeberichts, F.A.; Verhoef, N.; Povero, G. Investigating the impact of biostimulants on the row crops corn and soybean using high-efficiency phenotyping and next generation sequencing. Agronomy 2019, 9, 761. [Google Scholar] [CrossRef]
- Franzoni, G.; Cocetta, G.; Prinsi, B.; Ferrante, A.; Espen, L. Biostimulants on crops: Their impact under abiotic stress conditions. Horticulturae 2022, 8, 189. [Google Scholar] [CrossRef]
- Rajput, R.S.; Ram, R.M.; Vaishnav, A.; Singh, H.B. Microbe-based novel biostimulants for sustainable crop production. In Microbial Diversity in Ecosystem Sustainability and Biotechnological Applications; Springer: Singapore, 2019; pp. 109–144. [Google Scholar]
- Di Mola, I.; Ottaiano, L.; Cozzolino, E.; Senatore, M.; Giordano, M.; El-Nakhel, C.; Sacco, A.; Rouphael, Y.; Colla, G.; Mori, M. Plant-based biostimulants influence the agronomical. physiological. and qualitative responses of baby rocket leaves under diverse nitrogen conditions. Plants 2019, 8, 522. [Google Scholar] [CrossRef] [PubMed]
- Battacharyya, D.; Babgohari, M.Z.; Rathor, P.; Prithiviraj, B. Seaweed extracts as biostimulants in horticulture. Sci. Hortic. 2015, 196, 39–48. [Google Scholar] [CrossRef]
- Bajpai, S.; Shukla, P.S.; Asiedu, S.; Pruski, K.; Prithiviraj, B. A biostimulant preparation of brown seaweed Ascophyllum nodosum suppresses powdery mildew of strawberry. Plant Pathol. J. 2019, 35, 406. [Google Scholar] [CrossRef] [PubMed]
- Nair, P.; Kandasamy, S.; Zhang, J.; Ji, X.; Kirby, C.; Benkel, B.; Hodges, M.D.; Critchley, A.T.; Hiltz, D.; Prithiviraj, B. Transcriptional and metabolomic analysis of Ascophyllum nodosum mediated freezing tolerance in Arabidopsis thaliana. BMC Genom. 2012, 13, 643. [Google Scholar] [CrossRef] [PubMed]
- Ramkissoon, A.; Ramsubhag, A.; Jayaraman, J. Phytoelicitor activity of three Caribbean seaweed species on suppression of pathogenic infections in tomato plants. J. Appl. Phycol. 2017, 29, 3235–3244. [Google Scholar] [CrossRef]
- Jayaraj, J.; Rahman, M.; Wan, A.; Punja, Z. Enhanced resistance to foliar fungal pathogens in carrot by application of elicitors. Ann. Appl. Biol. 2009, 155, 71–80. [Google Scholar] [CrossRef]
- Carmody, N.; Goñi, O.; Łangowski, Ł.; O’Connell, S. Ascophyllum nodosum extract biostimulant processing and its impact on enhancing heat stress tolerance during tomato fruit set. Front. Plant Sci. 2020, 11, 807. [Google Scholar] [CrossRef]
- Trouvelot, S.; Héloir, M.-C.; Poinssot, B.; Gauthier, A.; Paris, F.; Guillier, C.; Combier, M.; Trdá, L.; Daire, X.; Adrian, M. Carbohydrates in Plant Immunity and Plant Protection: Roles and Potential Application as Foliar Sprays. Front. Plant Sci. 2014, 5, 592. [Google Scholar] [CrossRef]
- Li, M.; Qin, C.; Welti, R.; Wang, X. Double knockouts of phospholipases D ζ 1 and D ζ 2 in Arabidopsis affect root elongation during phosphate-limited growth but do not affect root hair patterning. Plant Physiol. 2006, 140, 761–770. [Google Scholar] [CrossRef]
- Fonseca, J.P.; Dong, X. Functional characterization of a Nudix hydrolase AtNUDX8 upon pathogen attack indicates a positive role in plant immune responses. PLoS ONE 2014, 9, e114119. [Google Scholar] [CrossRef] [PubMed]
- Li, S.B.; Xie, Z.Z.; Hu, C.G.; Zhang, J.Z. A review of auxin response factors (ARFs) in plants. Front. Plant Sci. 2016, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Wilmoth, J.C.; Wang, S.; Tiwari, S.B.; Joshi, A.D.; Hagen, G.; Guilfoyle, T.J.; Alonso, J.M.; Ecker, J.R.; Reed, J.W. NPH4/ARF7 and ARF19 Promote Leaf Expansion and Auxin-Induced Lateral Root Formation. Plant J. 2005, 43, 118–130. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Yang, H.; Shang, C.; Ma, S.; Liu, L.; Cheng, J. The roles of auxin biosynthesis YUCCA gene family in plants. Int. J. Mol. Sci. 2019, 20, 6343. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.I.; Murphy, A.S.; Baek, D.; Lee, S.W.; Yun, D.J.; Bressan, R.A.; Narasimhan, M.L. YUCCA6 over-expression demonstrates auxin function in delaying leaf senescence in Arabidopsis thaliana. J. Exp. Bot. 2011, 62, 3981–3992. [Google Scholar] [CrossRef] [PubMed]
- Dittrich, M.; Mueller, H.M.; Bauer, H.; Peirats-Llobet, M.; Rodriguez, P.L.; Geilfus, C.M.; Carpentier, S.C.; Al Rasheid, K.A.; Kollist, H.; Merilo, E.; et al. The role of Arabidopsis ABA receptors from the PYR/PYL/RCAR family in stomatal acclimation and closure signal integration. Nat. Plants 2019, 5, 1002–1011. [Google Scholar] [CrossRef]
- Sakaoka, S.; Mabuchi, K.; Morikami, A.; Tsukagoshi, H. MYB30 regulates root cell elongation under abscisic acid signaling. Commun. Integr. Biol. 2018, 11, e1526604. [Google Scholar] [CrossRef]
- Zhu, J.K. Abiotic stress signaling and responses in plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef]
- Zheng, Y.; Schumaker, K.S.; Guo, Y. Sumoylation of transcription factor MYB30 by the small ubiquitin-like modifier E3 ligase SIZ1 mediates abscisic acid response in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2012, 109, 12822–12827. [Google Scholar] [CrossRef]
- Li, L.; Yu, X.; Thompson, A.; Guo, M.; Yoshida, S.; Asami, T.; Chory, J.; Yin, Y. Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid-induced gene expression. Plant J. 2009, 58, 275–286. [Google Scholar] [CrossRef]
- Raffaele, S.; Rivas, S.; Roby, D. An essential role for salicylic acid in AtMYB30-mediated control of the hypersensitive cell death program in Arabidopsis. FEBS Lett. 2006, 580, 3498–3504. [Google Scholar] [CrossRef] [PubMed]
- Meyer, K.; Leube, M.P.; Grill, E. A Protein Phosphatase 2C Involved in ABA Signal Transduction in Arabidopsis thaliana. Science 1994, 264, 1452–1455. [Google Scholar] [CrossRef]
- Ali, A.; Pardo, J.M.; Yun, D.-J. Desensitization of ABA-signaling: The swing from activation to degradation. Front. Plant Sci. 2020, 11, 379. [Google Scholar] [CrossRef] [PubMed]
- Jung, C.; Nguyen, N.H.; Cheong, J.-J. Transcriptional regulation of protein phosphatase 2c genes to modulate abscisic acid signaling. Int. J. Mol. Sci. 2020, 21, 9517. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Ni, L.; Xia, X.; Chen, S.; Zhang, Y.; Lang, M.; Li, M.; Liu, B.; Pan, Y.; Li, J.; et al. Genome-wide analysis of the protein phosphatase 2c genes in tomato. Genes 2022, 13, 604. [Google Scholar] [CrossRef] [PubMed]
- Umezawa, T.; Nakashima, K.; Miyakawa, T.; Kuromori, T.; Tanokura, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Molecular basis of the core regulatory network in ABA responses: Sensing, signaling and transport. Plant Cell Physiol. 2010, 51, 1821–1839. [Google Scholar] [CrossRef]
- Stevanato, P.; Trebbi, D.; Saccomani, M. Root traits and yield in sugar beet: Identification of AFLP markers associated with root elongation rate. Euphytica 2010, 173, 289–298. [Google Scholar] [CrossRef]
- Zhou, D.-X.; Yin, K.; Xu, Z.-H.; Xue, H.-W. Effect of polar auxin transport on rice root development. J. Integr. Plant Biol. 2003, 45, 1421. [Google Scholar]
- Moxley, G.; Zhang, Y.H.P. More accurate determination of acid-labile carbohydrates in lignocellulose by modified quantitative saccharification. Energy Fuels 2007, 21, 3684–3688. [Google Scholar] [CrossRef]
- Puglisi, I.; Barone, V.; Sidella, S.; Coppa, M.; Broccanello, C.; Gennari, M.; Baglieri, A. Biostimulant activity of humic-like substances from agro-industrial waste on Chlorella vulgaris and Scenedesmus quadricauda. Eur. J. Phycol. 2018, 53, 433–442. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Chatris, J.; Quintela, J.; Folch, J.; Planas, E.; Arnaldos, J.; Casal, J. Experimental study of burning rate in hydrocarbon pool fires. Combust. Flame 2001, 126, 1373–1383. [Google Scholar] [CrossRef]
- Arnon, D.; Hoagland, D. Crop production in artificial culture solutions and in soils with special reference to factors influencing yields and absorption of inorganic nutrients. Soil Sci. 1940, 50, 463–485. [Google Scholar]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; 1000 Genome Project Data Processing Subgroup. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Quinlan, A.R.; Hall, I.M. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2- Delta Delta CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Schneider, K.W.F. Sugar Analysis. ICUMSA Methods. Official and Tentative Methods Recommended by the International Commission for Uniform Methods of Sugar Analysis (ICUMSA). herausgeg. vom. Starch-Stärke 1980, 32, 325–326. [Google Scholar] [CrossRef]
- Kubadinow, N.; Wieninger, L. Analyses of alphaamino nitrogen in sugar beets and in processing juices. Zucker 1972, 25, 43–47. [Google Scholar]
- Stevanato, P.; Zavalloni, C.; Marchetti, R.; Bertaggia, M.; Saccomani, M.; McGrath, J.M.; Panella, L.W.; Biancardi, E. Relationship between subsoil nitrogen availability and sugarbeet processing quality. Agron. J. 2010, 102, 17–22. [Google Scholar] [CrossRef]
Composition | |
---|---|
Dry matter (g L−1) | 90.39 ± 2.3 |
Ash (%) | 29.58 ± 0.9 |
Carbohydrate (g kg−1) | 387.70 ± 12.1 |
Lipids (g kg−1) | 2.50 ± 0.1 |
Protein (g kg−1) | 37.80 ± 0.8 |
Total phenolic compounds (g kg−1) | 101.20 ± 1.8 |
Treatment | Root Yield (t ha−1) | Sugar Yield (t ha−1) | Potassium (meq % °S) | Sodium (meq % °S) | α-Amino N (meq % °S) | Sugar Purity (%) |
---|---|---|---|---|---|---|
Control | 75.6 | 11.4 | 26.12 | 5.56 | 5.71 | 92.2 |
4 mL L−1 | 76.1 | 12.7 * | 25.37 | 6.31 | 5.92 | 92.4 |
2 mL L−1 | 77.2 * | 11.9 * | 27.17 | 5.42 | 6.15 | 91.9 |
1 mL L−1 | 76.8 | 12.0 * | 25.14 | 5.23 | 5.54 | 92.3 |
Gene Cluster | Gene Name | Gene Description | Primer Sequence (5′-3′) |
---|---|---|---|
AUXIN-related genes | YUCCA6 | Indole-3-pyruvate monooxygenase | PF: GGAGGCGGCAGTGACAAC PR: GTCGCCACCACCAACCA |
ARF19 | Auxin response factor 19 | PF: ACTTTACCTGGCTCCACAGCTT PR: TCCTAGTTGACGGGATAGATCAGAA | |
NH23 | Nudix hydrolase 23, chloroplastic | PF: CCGTTTTAGACCGTTCCGAAT PR: GAAGAAGAGGAAGCACTTAAATTTGAG | |
ABA-related genes | PYL4 | Abscisic acid receptor | PF: TGAAACCCTCGTTAGCTCATGA PR: TGGAGATGGGCAGCAGAGA |
MYB30 | Transcription factor MYB30-like | PF: GCGCGGCCCTTGAAA PR: ACCCCTGAACAAGCCTCTGA | |
PP2C62 | Probable protein phosphatase 2C 62 | PF: AATTCGGAGATGCAGGTGAAA PR: TCTCTCTCCAATTCTGCTTCATTTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bertoldo, G.; Chiodi, C.; Della Lucia, M.C.; Borella, M.; Ravi, S.; Baglieri, A.; Lucenti, P.; Ganasula, B.K.; Mulagala, C.; Squartini, A.; et al. Brown Seaweed Extract (BSE) Application Influences Auxin- and ABA-Related Gene Expression, Root Development, and Sugar Yield in Beta vulgaris L. Plants 2023, 12, 843. https://doi.org/10.3390/plants12040843
Bertoldo G, Chiodi C, Della Lucia MC, Borella M, Ravi S, Baglieri A, Lucenti P, Ganasula BK, Mulagala C, Squartini A, et al. Brown Seaweed Extract (BSE) Application Influences Auxin- and ABA-Related Gene Expression, Root Development, and Sugar Yield in Beta vulgaris L. Plants. 2023; 12(4):843. https://doi.org/10.3390/plants12040843
Chicago/Turabian StyleBertoldo, Giovanni, Claudia Chiodi, Maria Cristina Della Lucia, Matteo Borella, Samathmika Ravi, Andrea Baglieri, Piergiorgio Lucenti, Bhargava Krishna Ganasula, Chandana Mulagala, Andrea Squartini, and et al. 2023. "Brown Seaweed Extract (BSE) Application Influences Auxin- and ABA-Related Gene Expression, Root Development, and Sugar Yield in Beta vulgaris L." Plants 12, no. 4: 843. https://doi.org/10.3390/plants12040843
APA StyleBertoldo, G., Chiodi, C., Della Lucia, M. C., Borella, M., Ravi, S., Baglieri, A., Lucenti, P., Ganasula, B. K., Mulagala, C., Squartini, A., Concheri, G., Magro, F., Campagna, G., Stevanato, P., & Nardi, S. (2023). Brown Seaweed Extract (BSE) Application Influences Auxin- and ABA-Related Gene Expression, Root Development, and Sugar Yield in Beta vulgaris L. Plants, 12(4), 843. https://doi.org/10.3390/plants12040843