Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids
Abstract
1. Introduction
2. Results and Discussion
2.1. SSR Polymorphism and Genetic Diversity
2.2. Genetic Relationships by UPGMA
2.3. Analysis of Population Structure by DAPC
2.4. Genetic Diversity among Groups by AMOVA
3. Materials and Methods
3.1. Plant Material
3.2. DNA Extraction
3.3. SSR Genotyping
3.4. Data Analysis
3.4.1. Genetic Diversity Analysis
3.4.2. Detection of Homonymies and Synonymies
3.4.3. Establishment of Genetic Relationships
3.4.4. Determination of Population Structure
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Faust, M.; Timon, B.; Surányi, D.; Nyujtó, F.; Gradziel, T.M. Origin and Dissemination of Prunus Crops: Peach, Cherry, Apricot, Plum and Almond; Horticultural Reviews: Gent-Oostakker, Belgium, 2011; Volume 17, ISBN 978-90-6605-436-3. [Google Scholar]
- Okie, W.R. Introgression of Prunus species in plum. N. Y. Fruit Q. 2006, 14, 29–37. [Google Scholar]
- Manaresi, A. On the origin and genetic constitution of the black apricot Prunus dasycarpa Ehrh. Mem. Accad. Sci. Ist. di Bol. 1950, 7, 19. (In Italian) [Google Scholar]
- Hedrick, U.P. The Plums of New York; J.B. Lyon Company, State Printers: Albany, NY, USA, 1911; p. 333. [Google Scholar]
- Karp, D. Luther Burbank ’s plums. HortScience 2015, 50, 189–194. [Google Scholar] [CrossRef]
- Roeding, G.C. New Products of the Trees: A Treatise of Burbank’s Late Introductions; Roeding, G.C., Ed.; Fancher Creek Nurseries: Fresno, CA, USA, 1908. [Google Scholar]
- Okie, W.R. Spring Satin plumcot. J. Am. Pomol. Soc. 2005, 59, 119–124. [Google Scholar]
- Nicolás-Almansa, M.; Guevara, A.; Rubio, M.; Cos, J.; Carrillo, A.; García-Montiel, F.; Salazar, J.A.; Martínez-Gómez, P.; Ruiz, D. The apricot as a source of self-compatibility and Plum pox virus resistance in the generation of interspecific hybrids Prunus salicina Lindl. × Prunus armeniaca L. (plumcots). Acta Hortic. 2020, 1290, 115–118. [Google Scholar] [CrossRef]
- Brantley, W. About pluots. Gastronomica 2004, 4, 84–89. [Google Scholar] [CrossRef]
- Ramming, D.W. Diploid plum × apricot interspecific hybrids. Fruit Var. J. 1976, 30, 17. [Google Scholar]
- Nicolás-Almansa, M.; Guevara, A.; Rubio, M.; Cos, J.; Carrillo, A.; Garcıá-Montiel, F.; Salazar, J.A.; Martınez-Gómez, P.; Ruiz, D. Molecular and phenotypic characterization of interspecific Prunus salicina Lindl. × Prunus armeniaca L. (plumcot) hybrids. Acta Hortic. 2021, 1307, 267–274. [Google Scholar] [CrossRef]
- Milošević, T.; Milošević, N. Plum (Prunus spp.) breeding. In Advances in Plant Breeding Strategies: Fruits; Al-Khayri, J., Jain, S., Johnson, D., Eds.; Springer: Cham, Switzerland, 2018; Volume 3, pp. 165–215. ISBN 9783319919447. [Google Scholar] [CrossRef]
- Topp, B.L.; Russell, D.M.; Neumüller, M.; Dalbó, M.A.; Liu, W. Plum. In Fruit Breeding; Badenes, M.L., Byrne, D.H., Eds.; Springer: Boston, MA, USA, 2012; pp. 571–621. ISBN 978-1-4419-0763-9. [Google Scholar] [CrossRef]
- Faust, M.; Surányi, D. Origin and dissemination of plums. In Origin and Dissemination of Prunus Crops: Peach, Cherry, Apricot, Plum and Almond; Janick, J., Ed.; Horticultural Reviews: Gent-Oostakker, Belgium, 2011; pp. 139–186. ISBN 978-90-6605-436-3. [Google Scholar]
- Guerrero, B.I.; Guerra, M.E.; Herrera, S.; Irisarri, P.; Pina, A.; Rodrigo, J. Genetic diversity and population structure of Japanese plum-type (Hybrids of P. salicina) accessions assessed by SSR markers. Agronomy 2021, 11, 1748. [Google Scholar] [CrossRef]
- Bae, H.; Yun, S.K.; Jun, J.H.; Yoon, I.K.; Nam, E.Y.; Kwon, J.H. Assessment of organic acid and sugar composition in apricot, plumcot, plum, and peach during fruit development. J. Appl. Bot. Food Qual. 2014, 87, 24–29. [Google Scholar] [CrossRef]
- Crisosto, C.H.; Crisosto, G.M.; Echeverria, G.; Puy, J. Segregation of plum and pluot cultivars according to their organoleptic characteristics. Postharvest Biol. Technol. 2007, 44, 271–276. [Google Scholar] [CrossRef]
- Guerra, M.E.; Rodrigo, J. Japanese plum pollination: A review. Sci. Hortic. 2015, 197, 674–686. [Google Scholar] [CrossRef]
- Boonprakob, U.; Byrne, D.H.; Graham, C.J.; Okie, W.R.; Beckman, T.; Smith, B.R. Genetic relationships among cultivated diploid plums and their progenitors as determined by RAPD markers. J. Am. Soc. Hortic. Sci. 2001, 126, 451–461. [Google Scholar] [CrossRef]
- Ahmad, R.; Potter, D.; Southwick, S.M. Identification and characterization of plum and pluot cultivars by microsatellite markers. J. Hortic. Sci. Biotechnol. 2004, 79, 164–169. [Google Scholar] [CrossRef]
- Qiao, Y.S.; Fang, J.G.; Cong, Y.; Zhou, J.; Zhang, Z. Analysis of genetic diversity of Japanese plum cultivars based on RAPD, ISSR and SSR markers. Acta Hortic. 2007, 763, 177–183. [Google Scholar] [CrossRef]
- Ferrero Klabunde, G.H.; Dalbó, M.A.; Nodari, R.O. DNA fingerprinting of Japanese plum (Prunus salicina) cultivars based on microsatellite markers. Crop Breed. Appl. Biotechnol. 2014, 14, 139–145. [Google Scholar] [CrossRef]
- Merkouropoulos, G.; Ganopoulos, I.; Tsaftaris, A.; Papadopoulos, I.; Drogoudi, P. Combination of high resolution melting (HRM) analysis and SSR molecular markers speeds up plum genotyping: Case study genotyping the Greek plum GeneBank collection. Plant Genet. Resour. Charact. Util. 2017, 15, 366–375. [Google Scholar] [CrossRef]
- Hormaza, J.I. Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor. Appl. Genet. 2002, 104, 321–328. [Google Scholar] [CrossRef]
- Bourguiba, H.; Scotti, I.; Sauvage, C.; Zhebentyayeva, T.; Ledbetter, C.; Krška, B.; Remay, A.; D’Onofrio, C.; Iketani, H.; Christen, D.; et al. Genetic structure of a worldwide germplasm collection of Prunus armeniaca L. reveals three major diffusion routes for varieties coming from the species’ center of origin. Front. Plant Sci. 2020, 11, 638. [Google Scholar] [CrossRef]
- Herrera, S.; Hormaza, J.I.; Lora, J.; Ylla, G.; Rodrigo, J. Molecular characterization of genetic diversity in apricot cultivars: Current situation and future perspectives. Agronomy 2021, 11, 1714. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.; Skolnick, M.; Davis, R. Construction of a linkage map using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Abdallah, D.; Baraket, G.; Perez, V.; Ben Mustapha, S.; Salhi-Hannachi, A.; Hormaza, J.I. Analysis of self-incompatibility and genetic diversity in diploid and hexaploid plum genotypes. Front. Plant Sci. 2019, 10, 896. [Google Scholar] [CrossRef] [PubMed]
- Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef] [PubMed]
- IPS, International Plant Selection. 2022. Available online: https://www.ips-plant.com/en/ (accessed on 20 February 2022).
- Okie, W.R.; Ramming, D.W. Plum breeding worldwide. Horttechnology 1999, 9, 162–176. [Google Scholar] [CrossRef]
- Google-Patents, Google Patents. 2022. Available online: https://patents.google.com/patent/USPP16590P2/en (accessed on 16 January 2022).
- Zaiger, G.; Gardner, L.; Zaiger, G. United States Plant Patent. 2006. Available online: https://patents.justia.com/inventor/chris-floyd-zaiger (accessed on 15 February 2022).
- Okie, W.R. Register of new fruit and nut varieties. List 41. HortScience 2002, 37, 251–272. [Google Scholar] [CrossRef]
- Carrasco, B.; Díaz, C.; Moya, M.; Gebauer, M.; García-González, R. Genetic characterization of Japanese plum cultivars (Prunus salicina) using SSR and ISSR molecular markers. Cienc. Investig. Agrar. 2012, 39, 533–543. [Google Scholar] [CrossRef]
- Okie, W.R. Register of new fruit and nut varieties. List 42. HortScience 2004, 39, 1509–1523. [Google Scholar] [CrossRef]
- Okie, W.R.; Weinberger, J.H. Plums. In Fruit Breeding. Volume 1: Tree and Tropical Fruits; Janick, J., Moore, J.N., Eds.; John Wiley and Sons, Inc.: New York, NY, USA, 1996; pp. 559–608. [Google Scholar]
- Halász, J.; Kodad, O.; Galiba, G.M.; Skola, I.; Ercisli, S.; Ledbetter, C.A.; Hegedűs, A. Genetic variability is preserved among strongly differentiated and geographically diverse almond germplasm: An assessment by simple sequence repeat markers. Tree Genet. Genomes 2019, 15, 12. [Google Scholar] [CrossRef]
- Pérez, V.; Larrañaga, N.; Abdallah, D.; Wünsch, A.; Hormaza, J.I. Genetic diversity of local peach (Prunus persica) accessions from La Palma Island (Canary Islands, Spain). Agronomy 2020, 10, 457. [Google Scholar] [CrossRef]
- Guerra, M.E.; Guerrero, B.I.; Casadomet, C.; Rodrigo, J. Self-(in)compatibility, S-RNase allele identification, and selection of pollinizers in new Japanese plum-type cultivars. Sci. Hortic. 2020, 261, 109022. [Google Scholar] [CrossRef]
- Guerra, M.E.; López-Corrales, M.; Wünsch, A. Improved S-genotyping and new incompatibility groups in Japanese plum. Euphytica 2012, 186, 445–452. [Google Scholar] [CrossRef]
- Guerrero, B.I.; Guerra, M.E.; Rodrigo, J. Establishing pollination requirements in Japanese plum by phenological monitoring, hand pollinations, fluorescence microscopy and molecular genotyping. J. Vis. Exp. 2020, 165, e61897. [Google Scholar] [CrossRef] [PubMed]
- Guerra, M.E.; Rodrigo, J.; López-Corrales, M.; Wünsch, A. S-RNase genotyping and incompatibility group assignment by PCR and pollination experiments in Japanese plum. Plant Breed. 2009, 128, 304–311. [Google Scholar] [CrossRef]
- Mnejja, M.; Garcia-Mas, J.; Howad, W.; Badenes, M.L.; Arús, P. Simple-sequence repeat (SSR) markers of Japanese plum (Prunus salicina Lindl.) are highly polymorphic and transferable to peach and almond. Mol. Ecol. Notes 2004, 4, 163–166. [Google Scholar] [CrossRef]
- Sosinski, B.; Gannavarapu, M.; Hager, L.D.; Beck, L.E.; KIng, J.J.; Ryder, C.D.; Rajapakse, S.; Baird, W.V.; Ballard, R.E.; Abbot, A.G. Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch]. Theor. Appl. Genet. 2000, 101, 421–428. [Google Scholar] [CrossRef]
- Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, M.; Poizat, C.; Zanetto, A.; Arús, P.; Laigret, F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Cipriani, G.; Lot, G.; Huang, W.G.; Marrazzo, M.T.; Peterlunger, E.; Testolin, R. AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L) Batsch]: Isolation, Characterisation and Cross-species amplification in Prunus. Theor. Appl. Genet. 1999, 99, 65–72. [Google Scholar] [CrossRef]
- Aranzana, M.; García-Mas, J.; Carbó, J.; Arús, P. Development and variability analysis of microsatellite markers in peach. Plant Breed. 2002, 121, 87–92. [Google Scholar] [CrossRef]
- R Core Team R: A Language and Environment for Statistical Computing. 2022. Available online: https://www.r-project.org/ (accessed on 20 January 2022).
- Covarrubias-Pazaran, G.; Diaz-Garcia, L.; Schlautman, B.; Salazar, W.; Zalapa, J. Fragman: An R package for fragment analysis. BMC Genet. 2016, 17, 62. [Google Scholar] [CrossRef]
- Jombart, T. Adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef]
- Goudet, J. Hierfstat, a package for R to compute and test hierarchical F-statistics. Mol. Ecol. Notes 2005, 5, 184–186. [Google Scholar] [CrossRef]
- Paradis, E. Pegas: An R package for population genetics with an integrated-modular approach. Bioinformatics 2010, 26, 419–420. [Google Scholar] [CrossRef] [PubMed]
- Adamack, A.; Gruber, B. PopGenReport: Simplifying basic population genetic analyses in R. Methods Ecol. Evol. 2014, 5, 384–387. [Google Scholar] [CrossRef]
- Nei, M.; Li, W.H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 1979, 76, 5269–5273. [Google Scholar] [CrossRef] [PubMed]
- Kamvar, Z.N.; Tabima, J.F.; Grünwald, N.J. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef]
- Jombart, T. A tutorial for Discriminant Analysis of Principal Components (DAPC) using adegenet 2.0.0. 2015, pp. 1–43. Available online: https://adegenet.r-forge.r-project.org/files/tutorial-dapc.pdf (accessed on 25 January 2022).




| Locus | NA | Allele Size (bp) | PIC | Ho | He | FIS | FST |
|---|---|---|---|---|---|---|---|
| pchgms2 | 20 | 128–170 | 0.84 | 0.85 | 0.83 | −0.03 | 0.07 |
| CPPCT033 | 12 | 122–159 | 0.61 | 0.66 | 0.58 | −0.13 | 0.21 |
| BPPCT007 | 21 | 113–167 | 0.80 | 0.81 | 0.82 | 0.01 | 0.06 |
| BPPCT039 | 20 | 121–173 | 0.78 | 0.48 | 0.60 | 0.20 | 0.29 |
| BPPCT025 | 18 | 148–196 | 0.82 | 0.73 | 0.78 | 0.07 | 0.09 |
| CPSCT026 | 17 | 156–210 | 0.87 | 0.49 | 0.78 | 0.37 | 0.14 |
| CPSCT005 | 20 | 167–229 | 0.90 | 0.73 | 0.87 | 0.16 | 0.07 |
| UDP96005 | 21 | 95–73 | 0.85 | 0.83 | 0.83 | 0.00 | 0.08 |
| Mean | 19 | - | 0.81 | 0.70 | 0.76 | 0.08 | 0.13 |
| Source of Variation | df | Sum of Square | Mean Sum of Square | % of the Variance | Phi |
|---|---|---|---|---|---|
| Among groups (K = 5) | 4 | 187 | 47 | 11 | 0.20 |
| Among accessions within groups (K = 5) | 137 | 913 | 7 | 9 | 0.10 |
| Within accessions | 142 | 772 | 5 | 80 * | 0.11 |
| Total | 283 | 1872 | 7 | 100 | - |
| Group | n | NA PER LOCUS | NA TOTAL | AR | PA | Ho | He | FIS |
|---|---|---|---|---|---|---|---|---|
| G1 | 13 | 9 | 69 | 7.75 | 11 | 0.75 | 0.78 | 0.04 |
| G2 | 38 | 9 | 75 | 6.82 | 4 | 0.61 | 0.67 | 0.06 |
| G3 | 32 | 12 | 95 | 8.14 | 8 | 0.68 | 0.86 | 0.21 |
| G4 | 49 | 10 | 82 | 6.94 | 5 | 0.70 | 0.76 | 0.05 |
| G5 | 10 | 6 | 49 | 6.25 | 24 | 0.75 | 0.75 | −0.01 |
| Reference Genotypes | |
|---|---|
| Almabar 4 (P. armeniaca) | Honey Top 15 (P. persica) |
| Aprix9 8 (P. armeniaca) | Kelsey 17 (P. salicina) |
| Charisma 1 (P. armeniaca) | Mariposa 2 (P. salicina) |
| Colorado 9 (P. armeniaca) | Methley 7 (P. salicina × P. cerasifera) |
| Katy 15 (P. armeniaca) | Mitard 16 (P. cerasifera) |
| Mirlo Naranja 3 (P. armeniaca) | Queen Ann 14 (Gaviota × Eldorado) |
| Monstercot 13 (P. armeniaca) | Queen Rosa 14 (Queen Ann × Santa Rosa) |
| Muñoz 16 (P. armeniaca) | Red Beaut 10 (Burmosa × Eldorado) |
| Rubisia 6 (P. armeniaca) | Santa Rosa 7 (P. salicina) |
| Sunnycot 11 (P. armeniaca) | Simon 12 (P. simonii) |
| Abundance 17 (P. salicina) | Songold 1 (Golden King × Wickson) |
| Angeleno 5 (‘Queen Ann’ x unknown) | Splash 15 (Pluot) |
| Dapple Jack 15 (Pluot) | Sweet Treat 15 (Pluerry) |
| Honey Sun 15 (P. persica × P. armeniaca) | |
| Commercial Cultivars | Available Pedigree Information |
|---|---|
| Bella Gold | Geo Pride, Flavor Queen, Mariposa, Red Beaut |
| Candy Heart | Autumn Giant, Black Kat, Red Beaut |
| Crimson Heart | Friar, Flavorosa, Laroda, Plum Parfait, Queen Ann |
| Crimson Kat | Flaming Gold, Flavor Treat, Mariposa, Red Beaut |
| Emerald Drop | Friar, Flavor Queen, Red Beaut |
| Fall Fiesta | Dapple Fire |
| Flavor Fall | Unknown |
| Flavor Finale | Casselman, King David, Queen Ann, Red Beaut |
| Flavor Fusion | Bella Sun, Con-N-Candy, Poppy, Red Beaut |
| Flavor Grenade | Flavor Queen, Mariposa, Red Beaut |
| Flavor King | Flavor Queen, Mariposa, Red Beaut |
| Flavor Supreme | Red Beaut |
| Glory Red | Burmosa, Flavor Fall, Mariposa, Red Beaut |
| Honey Punch | Autumn Giant, Friar, Modesto, Red Beaut, Splash |
| Honey Queen | Unknown |
| Sweet Blaze | Unknown |
| Sweet Pixie | P. avium (Bing, Nadia, Royal Lee, Stella) |
| Tasty Sweet | Unknown |
| Mp | Locus | LG | Dye | PC (µM) | Primer Sequence | SSR Motif | Size Range (bp) | Species |
|---|---|---|---|---|---|---|---|---|
| M01 | pchgms2 [45] | G4 | 6-FAM | 0.2 | F: GTCAATGAGTTCAGTGTTACACTC | (CT)24 | 130–200 | Peach |
| R: AATCATAACATCATTCAGCCACTGC | ||||||||
| CPPCT033 [48] | G7 | NED | 0.2 | F: TCAGCAAACTAGAAACAAACC | (CT)16 | 151 | Peach | |
| R: TTGCAATCTGGTTGATGTT | ||||||||
| M02 | BPPCT-007 [46] | G3 | 6-FAM | 0.2 | F: TCATTGCTCGTCATCAGC | (AG)22(CG)2(AG)4 | 143–151 | Peach |
| R: CAGATTTCTGAAGTTAGCGGTA | ||||||||
| UDP96-005 [47] | G1 | VIC | 0.3 | F: GTAACGCTCGCTACCACAAA | (AC)16TG(CT)2CA(CT)11 | 100–250 | Peach | |
| R: CCTGCATATCACCACCCAG | ||||||||
| M03 | BPPCT-039 [46] | G3 | PET | 0.3 | F: ATTACGTACCCTAAAGCTTCTGC | (GA)20 | 148–158 | Peach |
| R: GATGTCATGAAGATTGGAGAGG | ||||||||
| BPPCT-025 [46] | G6 | VIC | 0.3 | F: TCCTGCGTAGAAGAAGGTAGC | (GA)29 | 178–202 | Peach | |
| R: CGACATAAAGTCCAAATGGC | ||||||||
| M04 | CPSCT026 [44] | G7 | 6-FAM | 0.3 | F: TCTCACACGCTTTCGTCAAC | (CT)16 | 177–213 | Japanese plum |
| R: AAAAAGCCAAAAGGGGTTGT | ||||||||
| M05 | CPSCT005 [44] | G4 | NED | 0.3 | F: CTGCAAGCACTGCGGATCTC | (CT)15 | 171–191 | Japanese plum |
| R: CCCATATTCCCAACCCATTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guerrero, B.I.; Guerra, M.E.; Rodrigo, J. Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants 2022, 11, 1241. https://doi.org/10.3390/plants11091241
Guerrero BI, Guerra ME, Rodrigo J. Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants. 2022; 11(9):1241. https://doi.org/10.3390/plants11091241
Chicago/Turabian StyleGuerrero, Brenda I., María Engracia Guerra, and Javier Rodrigo. 2022. "Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids" Plants 11, no. 9: 1241. https://doi.org/10.3390/plants11091241
APA StyleGuerrero, B. I., Guerra, M. E., & Rodrigo, J. (2022). Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants, 11(9), 1241. https://doi.org/10.3390/plants11091241

