Next Article in Journal
Detection and Simultaneous Differentiation of Three Co-infected Viruses in Zanthoxylum armatum
Next Article in Special Issue
Impacts of Chronic Habitat Fragmentation on Genetic Diversity of Natural Populations of Prunus persica in China
Previous Article in Journal
Water Deficit Improves Reproductive Fitness in Nicotiana benthamiana Plants Infected by Cucumber mosaic virus
Previous Article in Special Issue
Study on Supergenus Rubus L.: Edible, Medicinal, and Phylogenetic Characterization
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids

by
Brenda I. Guerrero
1,2,*,
María Engracia Guerra
3 and
Javier Rodrigo
1,2
1
Departamento de Ciencia Vegetal, Centro de Investigación y Tecnología Agroalimentaria de Aragón (CITA), Avda Montañana 930, 50059 Zaragoza, Spain
2
Instituto Agroalimentario de Aragón-IA2 (CITA-Universidad de Zaragoza), 50013 Zaragoza, Spain
3
Área de Fruticultura Mediterránea, CICYTEX-Centro de Investigación ‘Finca La Orden-Valdesequera’, A-V, KM 372, Guadajira, 06187 Badajoz, Spain
*
Author to whom correspondence should be addressed.
Plants 2022, 11(9), 1241; https://doi.org/10.3390/plants11091241
Submission received: 19 March 2022 / Revised: 29 April 2022 / Accepted: 30 April 2022 / Published: 4 May 2022

Abstract

The main objective of many fruit-breeding programs around the world is the release of new cultivars from interspecific hybridizations between species of the Prunus genus. Plum × apricot (Prunus salicina Lindl. × Prunus armeniaca L.) are the most widespread interspecific hybrids, which include plumcots, pluots, and apriums. In this work, 115 accessions of interspecific hybrids from different origins and 27 reference genotypes of apricot and other diploid plum species were analyzed using eight simple sequence repeat (SSR) markers to assess the population structure and current genetic diversity. A total of 149 alleles were obtained, with an average of 19 alleles per locus. The overall polymorphic information content (PIC) mean value of SSR markers was 0.81, indicating a high degree of polymorphism of the SSR. The genetic analysis revealed 141 unique genotypes and two synonyms. The unweighted pair group method with arithmetic averages (UPGMA) dendrogram and the population structure with five groups inferred through the discriminant analysis of principal components (DAPC) revealed a clear genetic differentiation between apricot genotypes and the rest of the accessions since the interspecific hybrids clustered with the Japanese plum genotypes. Repeated backcrosses between interspecific hybrids with plum genotypes could be the cause of the higher genetic proximity of the hybrids with respect to plum than with apricot genotypes. This corresponds to the fruit morphology and agronomic behavior observed in most interspecific hybrids, which also resemble plums more than apricots.

1. Introduction

The genus Prunus comprises 400–430 species and is one of the most diverse genera within the Rosaceae family, with species of great commercial interest such as Prunus armeniaca L. (apricot), Prunus avium L. (sweet cherry), Prunus domestica L. (European plum), Prunus dulcis Mill. (almond), Prunus persica (L.) Batsch (peach), and Prunus salicina Lindl. (Japanese plum) [1]. The close affinity of some species of this genus has led to spontaneous hybrids of Prunus that have been cultivated for generations in several regions of the world, such as the hybrids P. armeniaca × Prunus cerasifera Ehrh., traditionally grown in southwest Asia [2]. These hybrids, also known as ‘black apricots’, are so abundant that they have been classified as a different species, Prunus dasycarpa Ehrh. [3]. This genetic proximity between Prunus species allows the development of interspecific hybridizations for breeding purposes [4].
Luther Burbank obtained more than 100 cultivars from interspecific crosses between P. salicina and at least 15 different diploid plum species between the late 19th and early 20th centuries [5]. The Japanese plum cultivars currently grown do not belong to a pure species but are hybrids derived from the first hybridizations carried out by Burbank and the subsequent ones carried out by modern breeding programs [2]. Burbank also obtained hybrids between plum and apricot, which he called ‘plumcots’, combining the terms ‘plum’ and ‘apricot’ [6], introducing the first commercial cultivars at the beginning of the 20th century, ‘Apex’ [7] and ‘Rutland’ [4].
Currently, many fruit-breeding programs around the world use interspecific hybridizations between Prunus species for objectives such as self-compatibility and resistance to Sharka disease (Plum pox virus, PPV) [8] as well as new attractive fruits with high sugar contents [9]. In these interspecific crosses, P. salicina and P. cerasifera are usually used as female parents to ensure fruit set and obtain a greater number of offspring [10,11], and P. armeniaca, P. persica, and P. avium as male parents [12]. Plumcots are the most widespread interspecific hybrids, with a number of commercial cultivars available such as ‘Red Velvet’, ‘Royal Velvet’, ‘Flavor Supreme’, and ‘Flavor Queen’ [7]. These hybrids are highly appreciated because they combine the firmness of flesh and the wide range of flowering and ripening periods of the Japanese plum with the aroma and flavor of the apricot [13]. However, the first plumcots were not very productive and were not grown on a large scale [7,12]. In the last decades, a number of cultivars of great commercial interest have been released through back- and inter-crosses between plumcot, apricot, and Japanese plum [13]. In 1991, Zaiger Genetics (Modesto, CA, USA) registered the terms ‘pluot’ and ‘aprium’, derived from combinations of the terms ‘plumcot’, ‘plum’, and ‘apricot’ [9] and, in 2012, the terms ‘pluerry’ (plum × sweet cherry hybrids) by combining the terms ‘plum’ and ‘cherry’ and ‘peacotum’ a complex peach × apricot × plum hybrid [12]. In theory, pluots are the result of crossing plumcot × plum, so the new hybrid is 75% plum and 25% apricot. On the other hand, apriums are obtained from crossing plumcot × apricot, obtaining hybrids that are 75% apricot and 25% plum [7]. However, these are complex hybrids because the plum cultivars used as parents do not belong to a pure species but rather are hybrids of several species of diploid plums [14,15].
Plumcot fruits have a higher content of sugars, such as glucose and fructose, than plums or peaches, although they do not exceed the sugar content of apricots [16]. Pluot fruits have a higher concentration of soluble solids and lower acidity than plums [17], which makes them highly appreciated by consumers. In general, plumcot and pluot fruits have the appearance of Japanese plums, making it difficult for consumers to distinguish between them [9,13].
Although most of the currently grown Japanese plum-type cultivars are actually hybrids [18], modern stone-fruit-breeding programs use the term ‘interspecific hybrids’ to refer to releases derived from crosses between plum and apricot, as well as backcrosses of plumcots with other species of the genus Prunus [7]. The release of a large number of new interspecific hybrids has caused the genetic diversity of the currently available plant material to be unknown, since previous works have focused mainly on the identification of Japanese plum cultivars and only a low number of interspecific plum × apricot hybrids has been analyzed [15,19,20,21,22,23]. The assessment of genetic diversity and population structure of these hybrids could be very useful to determine the genealogical origin of complex interspecific hybrids and to evaluate the effects of introgression. For this purpose, SSR markers are one of the most powerful molecular tools for determining the genetic relationships, genetic diversity, and population structure because they are highly informative, polymorphic, codominant, and exhibit transferability among closely related species of the genus Prunus [20,21,24,25].
The objective of this work is to assess the genetic diversity and population structure of interspecific hybrids of plum with other Prunus species, mainly apricot. For this purpose, 115 accessions of interspecific hybrids, including commercial cultivars and advanced selections, and 27 reference genotypes have been analyzed using eight simple sequence repeat (SSR) markers.

2. Results and Discussion

2.1. SSR Polymorphism and Genetic Diversity

All the SSR markers used in this study showed correct amplification and turned out to be polymorphic in the analysis of 115 accessions of interspecific plum × apricot hybrids and 27 reference genotypes. The genetic profiles of each accession obtained with the eight SSR markers are included in Table S1 of the Supplementary Materials. The parameters of SSR genetic diversity are summarized in Table 1. A total of 149 alleles were detected in the whole population, ranging from 12 (CPPCT033) to 21 (BBPCT007 and UDP96005) alleles per locus (NA), with an average value of 19. These values were similar to those reported in previous works in apricot (48 accessions, 20 SSR, NA = 4.1 [24]; 890 accessions, 25 SSR, NA = 24.36 [25]) and Japanese plum (47 accessions, 8 SSR, NA = 13 [22]). However, the values reported herein were higher than those obtained in a previous study of commercial cultivars of apricot (202 accessions, 10 SSR, NA = 6.3 in recent releases and NA = 9.3 in commercial releases), which can be related to the genetic bottleneck as a consequence of the use of common parents in breeding programs of apricot [26]. The smaller allele was obtained with the SSR marker UDP6005 (95 bp) and the larger one with CPSCT005 (229 bp). These results confirmed the high transferability among Prunus species of the eight SSR markers used in this study and previously observed in other works [15,20,24,25] and the utility of these SSR markers in the interspecific plum × apricot hybrids and progenies.
The polymorphic information content (PIC) ranged from 0.61 (CPPCT033) to 0.90 (CPSCT005), with a mean value of 0.81; therefore, the alleles were considered to be highly polymorphic, showing their usefulness for the study of genetic diversity [27]. The observed heterozygosity values (Ho) ranged from 0.48 (BPPCT039) to 0.85 (pchgms2), with an average value of 0.70, whereas the expected heterozygosity (He) ranged from 0.58 (CPPCT033) to 0.87 (CPSCT005), with a mean value of 0.76. These values were similar to those observed in several plum species such as P. salicina (Ho = 0.71; He = 0.67), P. domestica (Ho = 0.73; He = 0.69), and P. insititia (Ho = 0.74; He = 0.70) [28], indicating that the number of accessions analyzed in this work is a representative sample of the current genetic variability. The heterozygosity (Ho and He) of the analyzed accessions was lower than that observed in apricot cultivars, a crop in which a decrease in genetic diversity has been observed [26]. The FIS values ranged from −0.13 (CPPCT033) to 0.37 (CPSCT026), with a mean of 0.08, indicating that there is no inbreeding in the whole population since values were observed close to zero. The FST ranged from 0.06 (BPPCT007) to 0.29 (BPPCT039), with a mean value of 0.13, showing low genetic differentiation due to the gene flow between accessions [29] (Table 1).

2.2. Genetic Relationships by UPGMA

The analysis for the detection of homonyms and synonyms allowed the identification of 141 unique genotypes and 2 synonyms: ‘IBG047’ and ‘IBG057’, both accessions from the Ibergen breeding program, which were grouped in the subgroup B6.
The genetic relationships between the interspecific hybrids and the reference genotypes were assessed using the unweighted pair group method based on arithmetic averages (UPGMA) to generate a dendrogram based on the Nei and Li similarity index. The dendrogram showed the first node with a high bootstrap value (100), separating the accessions into two groups: group A, formed by 12 accessions (8.5%); and group B, formed by 130 accessions (91.5%) (Figure 1a). These two groups were divided into several internal secondary nodes.
Group A was divided into two subgroups. The subgroup A1 was formed by the ten reference genotypes of apricot. In subgroup A2, two advanced selections from different breeding programs were grouped, ‘IBG024’ and ‘Z029’, which could be aprium hybrids since they showed a greater genetic relationship with the apricot reference genotypes than with those of plum [12].
Group B, the larger of the two groups, was made up of the rest of the interspecific hybrids and the reference genotypes of diploid plums (P. cerasifera, P. salicina, and P. simonii). Plumcots, pluots, and the reference genotypes were allocated into different groups, mixing and grouping mainly according to their genealogical origin. This grouping trend has been found between pluots, plumcots, plums, and apricots in a previous study, suggesting that the grouping is mainly due to the relationship between the accessions and their parents [20].
Subgroup B1 was separated a greater distance from the rest, grouping five Zaiger Genetics accessions. Two of them were reference genotypes: ‘Honey Top’, a nectarine (P. persica) with yellow flesh [30]; and ‘Honey Sun’, an apricot × peach hybrid [12]. The accessions ‘Honey Queen’, a yellow-fleshed nectarine, and ‘Bella Gold’, a peacotum [12], might have in their pedigree some genotype of P. persica. Subgroup B2 was a small but diverse group, grouping the reference genotypes ‘Kelsey’ (P. salicina), ‘Mitard’ (P. cerasifera), and ‘Songold’ (‘Golden King’ (unknown origin) × ‘Wickson’ (P. salicina)). ‘Songold’ could be a hybrid between P. salicina and P. cerasifera since it is grouped close to ‘Mitard’ (P. cerasifera). ‘Songold’ was developed by ARC-Infruitec, a public breeding program of South Africa that frequently uses ‘Methley’ (P. salicina × P. cerasifera) as a parent [31]. In subgroup B3, ‘Methley’ was grouped with ‘Angeleno’ (‘Queen Ann’ × Unknown), ‘Abundance’ (P. salicina), and the pluots of Zaiger Genetics: ‘Flavor Fusion’, ‘Flavor Finale’, and ‘Flavor Grenade’. These accessions were located near to ‘Red Beaut’ (‘Burmosa’ × ‘Eldorado’) [31], which was allocated in subgroup B4 with ‘Simon’ (P. simonii). Subgroup B5 contained some commercial cultivars from Zaiger Genetics. In subgroup B6, 16 accessions were allocated, including the reference genotype ‘Sweet Treat’ (pluerry).
‘Red Beaut’ is one of the cultivars most used by Zaiger Genetics as a parent [32], which could explain why Zaiger accessions were allocated in the same group B to which ‘Red Beaut’ and other cultivars usually used as parents such as ‘Queen Ann’ (‘Gaviota’ × ‘Eldorado’) and ‘Mariposa’ (P. salicina) [33,34,35]. ‘Queen Ann’ and ‘Mariposa’ were grouped in subgroup B7 with three pluots (‘Emerald Drop’, ‘Fall Fiesta’, and ‘Flavor King’). The subgroup B8 was the most numerous of all (n = 35), including four reference genotypes (‘Dapple Jack’, ‘Queen Rosa’, ‘Santa Rosa’, and ‘Splash’) and eight commercial cultivars. The genealogy of ‘Glory Red’ includes ‘Queen Ann’ [32], which was used as a parent of ‘Queen Rosa’ in a cross with ‘Santa Rosa’ [31]. The three cultivars ‘Glory Red’, ‘Queen Rosa’, and ‘Santa Rosa’ could therefore be genetically related. The pluot cultivars ‘Splash’ and ‘Dapple Jack’ were also genetically related, as ‘Splash’ is the ancestor of ‘Dapple Jack’ [32]. Finally, six accessions were included in subgroup B9. Subgroups B6 and B9 were made up of only interspecific hybrids, which possibly shared parents among them.
The advanced selections were allocated in the subgroups A2 and B1–B9, showing the same diversity observed among the commercial cultivars.

2.3. Analysis of Population Structure by DAPC

To establish the pattern of the population structure, discriminant analysis of principal components (DAPC) was performed. Despite the high degree of introgression in this type of interspecific hybrids [2,7,12,34,36], the DAPC analysis showed the formation of five groups (K = 5) according to the lowest BIC value (166.17) (Figure 2A). The cross-validation of the DAPC showed that the proportion of success for the prediction of the groups (K = 5) would be obtained with 25 principal components (PCs) (Figure 2b), so 25 PCs (Figure 3—inset of PCA eigenvalues) and four eigenvalues of the discriminant analysis functions (DA) (Figure 3—inset of DA eigenvalues) were retained for the DAPC analysis.
In the scatterplot of the DAPC analysis (Figure 3), groups G2, G3, and G4 overlapped near the intersection of the first two linear discriminants (LD1 and LD2). Groups G1 and G5 differed from the rest of the groups through LD2 and LD1, respectively. The membership probabilities of each accession belonging to its assigned group are shown in Figure 1b and were based on the retained discriminant functions of the DAPC analysis. The stacked bars indicate the proportions of successful reassignment of accessions to their original groups. This grouping corresponded to the UPGMA dendrogram (Figure 1a), indicating that the accessions were grouped according to their genealogical origin.
The accessions were allocated into five groups (K = 5) (Table S2 of the Supplementary Materials). Group G1 contained 13 accessions (9% of the total population), including three Zaiger Genetics commercial cultivars (‘Bella Gold’, ‘Flavor Fall’, and ‘Honey Queen’). In group G2 (n = 38, 27%), the reference genotypes ‘Dapple Jack’ (pluot) and ‘Mariposa’ (P. salicina) were grouped with ‘Queen Rosa’ and’ Santa Rosa’, which are considered simple hybrids of P. salicina [2]. Group G3 (n = 32, 23%) included reference genotypes of different species, such as ‘Abundance’ and ‘Kelsey’ (P. salicina), ‘Honey Sun’ and ‘Honey Top’ (P. persica), and ‘Mitard’ (P. ceracifera), and some hybrids of P. salicina, such as ‘Angeleno’, ‘Methley’ (P. salicina × P. cerasifera), and ‘Red Beaut’. Group G4 included the largest number of accessions (n = 49, 35%), including four reference genotypes: ‘Queen Ann’, ‘Simon’ (P. simonii), ‘Songold’, and ‘Sweet Treat’ (pluerry). Finally, group G5 was formed exclusively by the 10 reference genotypes of P. armeniaca (apricot).
The composition of groups G1, G2, G3, and G4 was homogeneous, probably due to their accessions being obtained from the selection of crosses and backcrosses in which common parents such as ‘Mariposa’, ‘Queen Ann’, ‘Queen Rosa’, ‘Friar’, and ‘Red Beaut’ were used [20,31,37].

2.4. Genetic Diversity among Groups by AMOVA

The analysis of molecular variance (AMOVA) on genetic differentiation among the five groups based on DAPC and within accessions revealed that 80% of the total variation in the genetic structure (K = 5) was attributed to the variability within accessions with significant differences (p < 0.01) (Table 2), a percentage similar to that observed in a population of Japanese plums (81.8%) in a previous study [15]. The variance among the five groups inferred with the DAPC analysis represented 11% of the total, and the variance among accessions within the five inferred groups represented the remaining 9%. Previous studies on apricot [25] and almond [38] reported that the variance between groups contributed 8 and 29% of the total variance, respectively, being much lower than the variance due to differences between the accessions, which corresponds with the results obtained in this work.
The parameters of genetic diversity were calculated for each of the five groups (K = 5) (Table 3). The number of alleles per locus (NA PER LOCUS) ranged from 6 (G5) to 12 (G3). The total number of alleles for each group ranged from 49 (G5) to 95 (G3). The same trend was observed in allelic richness (AR), with values between 6.25 (G5) and 8.14 (G3). Alleles observed in only one group were considered private alleles (PA), with the smallest value (4) in group G2 and the largest value (24) in group G5. These results showed moderate and relatively homogeneous levels of genetic diversity, except in group G3, which showed a greater number of alleles (NA PER LOCUS and NA TOTAL), greater allelic richness (AR), and a value of the coefficient of inbreeding notably higher than the rest (FIS = 0.21), revealing a heterozygosity deficit, as observed in a diverse group of apricots from different geographical origins [25]. The values of observed heterozygosity (Ho) ranged from 0.61 (G2) to 0.75 (G1 and G5), and the expected heterozygosity (He), from 0.67 (G2) to 0.86 (G3). Ho was slightly lower than He in groups G1, G2, G3, and G4, which could be attributed to the exhaustive breeding activity developed in these hybrids. The heterozygosity (Ho and He) of G5, which includes the apricot cultivars, was similar to that observed in a previous work including traditional and new apricot cultivars [26].
To validate the genetic differentiation between groups, the correlations of pairwise genetic differentiation values (FST) were determined (Figure 4). The mean value observed was 0.16 and ranged from 0.05 (between G3 and G4) to 0.28 (between G2 and G5), indicating a moderate differentiation between groups. The correlations between group G5, which was formed entirely by apricot cultivars, and the rest of the groups showed the highest values, revealing a restricted flow of genes from apricot cultivars towards the 132 accessions that were grouped in G1 to G4 (diploid plums, plumcots, pluots, and other hybrids). A moderate but significant genetic differentiation was observed in G1, G2, G3, and G4, except the correlation between groups G3 and G4, which showed slight genetic differentiation. All the correlations presented lower and upper limits different from zero within a 99% confidence interval (Figure 4).
Since their introduction at the beginning of the 20th century, the interspecific plum × apricot hybrids have generated controversy due to the lack of clarity in classifying them as plum, plumcot, pluot, or aprium for their commercialization, due to the similarity in the appearance of their fruits, as well as the difficulty in determining the quality standards that must be applied [7]. The DAPC analysis used to assess the population structure revealed the five groups in which the whole population was structured. This structure is related with the genealogical background of the accessions, which can be useful for inferring the real interspecific status of the complex interspecific plum × apricot hybrids analyzed. The ability to distinguish these hybrids is not only important to sellers and consumers but also to breeders [8] and producers [20], due to the different agronomic management. In certain markets, such as the USA, the classification as plums or pluots can greatly affect the price of the fruit [9].
The four inferred groups including the interspecific hybrids showed a weaker genetic relationship to the apricot group than would be expected if they were simple plum × apricot hybrids, as suggested by the terms ‘plumcot’, ‘pluot’, and ‘aprium’ [12]. A closer genetic relationship of pluots to Japanese plums than to apricots has also been found in a previous study [20]. Previous analysis of the genetic structure and diversity between interspecific hybrids is limited to a study that included 29 Japanese plum cultivars, 4 interspecific hybrids, 2 cultivars of P. domestica, a cultivar of P. cerasifera, and another of P. armeniaca, which showed a low genetic differentiation between the determined population structure [35]. The unexpected distance found between interspecific hybrids and apricot cultivars may be due to several backcrosses, or new crosses with plum cultivars, of the first descendants of simple plum × apricot hybrids, to search for fruits more similar to glabrous-skinned plums than to apricots [13].
Although many species are involved in the genealogy of the interspecific hybrids, our results suggest that the observed diversity is lower than expected, probably due to the use of the same parents, such as ‘Friar’, ‘Mariposa’, ‘Queen Ann’, ‘Queen Rosa’, and ‘Red Beaut’, in different breeding programs [32]. In addition, the Japanese plum cultivars used as parents are complex hybrids that come directly or indirectly from the first hybridizations carried out by Luther Burbank, who used as parents a small number of Japanese plum cultivars (‘Abundance’, ‘Burbank’, ‘Kelsey’, and ‘Satsuma’) [4], other diploid plums (‘Maritima’ (P. maritima), ‘Simon’ (P. simonii), and ‘Robinson’ (P. munsoniana)), and the first simple hybrids (‘Gaviota’, ‘Santa Rosa’, and ‘Wickson’) [5]. In previous works, low percentages of fruit set have been obtained in plum × apricot crosses, and very low or even null in apricot × plum crosses, which shows the difficulty of obtaining these hybrids [10,11]. This situation may have caused some of the hybrids to have been erroneously considered as plumcots, pluots, or apriums, being Japanese plum-type hybrids. However, it is difficult to determine the genealogy of the interspecific hybrids, since in most cases the parents are unknown.

3. Materials and Methods

3.1. Plant Material

A group of 142 accessions was analyzed, including 27 reference genotypes (Table 4), 18 commercial cultivars (Table 5), and 97 advanced selections of interspecific hybrids from three breeding programs: Ibergen (62 accessions, IBG001-IBG062), Provedo (7 accessions, P008-P014), and Zaiger Genetics (46 accessions, Z004-Z032). The plant material of the interspecific hybrids was obtained from several experimental orchards: Ibergen, located in Caspe (Zaragoza, Spain) and San Rafael del Río (Castellón, Spain) (72 accessions); Viveros Mariano Soria, in La Almunia de Doña Godina (Zaragoza, Spain) (36 accessions); and Provedo, in Don Benito (Badajoz, Spain) (7 accessions) (Table 4 and Table 5). The plant material of the 27 reference genotypes was obtained from the germplasm collections of Centro de Investigaciones Científicas y Tecnológicas de Extremadura (CICYTEX-La Orden) in Guadajira (Badajoz, Spain) (4 genotypes), Centro de Investigación y Tecnología Agroalimentaria de Aragón (CITA) in Zaragoza (Zaragoza, Spain) (14 genotypes) and Viveros Mariano Soria in La Almunia de Doña Godina (Zaragoza, Spain) (9 genotypes) (Table 5).

3.2. DNA Extraction

For each accession, DNA was extracted from young leaves collected in spring and preserved in silica gel [39]. Once dried, the leaf tissue was ground on a TissueLyser (Qiagen, Hilden, Germany). Genomic DNA extraction was carried out by using a Speedtools Plant DNA Extraction Kit (Biotools, Madrid, Spain) [40,41,42,43] following the protocol described by Hormaza [24]. The quantity and quality of each DNA sample were determined using a spectrophotometer, NanoDrop 1000 (ThermoScientific, Waltham, MA, USA). DNA of each accession was diluted to 10 ng/μL and stored at −20 °C until PCR amplification [40].

3.3. SSR Genotyping

For SSR analysis, eight SSR markers were selected from the previously reported studies in Japanese plum [44] and peach [45,46,47,48] (Table 6). The SSR markers used in this study have shown high transferability among different Prunus species in previous reports [15,20,24,25].
The amplification was performed using five sets of multiplex PCR reactions (M01 to M05). Each multiplex reaction was designed according to the protocol described by Guerrero et al. [15]. All reactions were performed with 10 ng of genomic DNA, different concentrations for each SSR marker (Table 6), and 1X Qiagen Multiplex PCR Master Mix (Qiagen, Hilden, Germany) and a SimplyAmp Thermal Cycler (Applied Biosystems, Foster City, CA, USA). A final volume of 12.5 µL was used in Multiplex PCR reactions M01–M03, and a final volume of 11.5 µL in M04 and M05. The amplification was performed with the following cycles: in M01 to M03, the temperature profile used had an initial denaturation step at 95 °C for 15 min, followed by 35 cycles at 95 °C for 45 s, 57 °C for 45 s, 72 °C for 2 min, and a final step at 72 °C for 30 min [46]. The same conditions were used for M04 and M05 but modifying the annealing temperature at 46 °C and 62 °C, respectively [44]. The amplicons were separated by capillary electrophoresis using a genetic analyzer ABI3730 (Applied Biosystems, Foster City, CA, USA). A size standard GeneScan 500LIZ (Applied Biosystems, Foster City, CA, USA) was used to estimate the molecular size (pb) of the amplicons that were scored on the R [49] package for fragment analysis ‘Fragman’ [50], and confirmed with the software PeakScanner v. 1.0 (Applied Biosystems, Foster City, CA, USA) (Supplementary Materials, Figure S1). Before the data analysis, the genetic profiles were organized on a table in CSV format (Supplementary Materials, Table S1).

3.4. Data Analysis

The data of alleles generated by the SSR markers were converted into an object of the class ‘genind’ using the ‘df2genind’ function of the ‘adegenet’ package v. 2.1.2. [51] and analyzed with the R software v 3.6.0 [49].

3.4.1. Genetic Diversity Analysis

The genetic diversity parameters (number of alleles per locus (NA), polymorphism information content (PIC), private alleles (PA), allelic richness (AR), observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (FIS), and Wright’s fixation index (FST)) were determined on the whole population using the packages ‘adegenet’ v. 2.1.2 [51], ‘hierfstat’ v. 0.5-7 [52], ‘pegas’ v. 0.13 [53] and ‘PopGenReport’ v. 3.0.4 [54].

3.4.2. Detection of Homonymies and Synonymies

The sizes of the alleles were compared by the ‘duplicated’ function to detect identical genetic profiles, which were considered as synonymies, and the accession names to detect identical names with different genetic profiles, which were considered as homonymies [15,26].

3.4.3. Establishment of Genetic Relationships

An unweighted pair group method with arithmetic averages (UPGMA) cluster analysis was used to determine the genetic relationships among accessions according to Nei and Li [55]; a UPGMA dendrogram with a ‘bootstrap’ supported by 1000 replicates was generated with the ‘poppr’ package v. 2.8.5 [56].

3.4.4. Determination of Population Structure

The population structure was analyzed by a discriminant analysis of principal components (DAPC) using the ‘adegenet’ package v. 2.1.2. [51,57]. The optimal number of groups (K) in the whole population was inferred using the ‘find.clusters’ function and according to the lowest Bayesian information criterion (BIC) value. The correct numbers of principal components (PCs) to be retained were determined using the cross-validation function ‘xvalDapc’. The membership probabilities were obtained from the DAPC objects in the slot posterior (‘class(dapc1$posterior)’). The slot ‘assign.per.pop’ was used to indicate the proportions of successful reassignment (based on the discriminant functions) of accessions to their original groups [57].
The genetic diversity analysis at the group level was performed using the same parameters determined in the whole population (3.4.1.). The package ‘hierfstat’ v. 0.5-7 [52] was used to calculate the correlation matrix of the pairwise FST values using the ‘pp.fst’ function.
Finally, the variance components among the inferred groups and the accessions were calculated with an analysis of molecular variance (AMOVA) using the ‘poppr’ package v. 2.8.5 [56].

4. Conclusions

The molecular characterization allowed structuring the interspecific plum × apricot hybrids into five groups that clearly corresponded with the genealogical background. The growing interest in obtaining new interspecific hybrids of Prunus due to their commercial potential [16] led to the fact that most of these accessions have been obtained after several backcrosses with plum [2,12], which would explain their greater genetic proximity to plum than to apricot. This genetic relationship corresponds to the fruit morphology and agronomic behavior observed in most interspecific hybrids, which also resemble plums more than apricots. The low genetic diversity found herein could be related to the repeated use of a small group of parents and the inbreeding produced by backcrosses during the breeding process, as it has been observed in apricot [26] and Japanese plum-type cultivars [15]. These results can be useful for the management of germplasm repositories in order to avoid the loss of genetic diversity and the selection of parents for breeding purposes. Further studies using other approaches such as high-throughput genotyping-by-sequencing (GBS) can be useful for mapping and for the detection of trait-associated QTLs to continue the exploitation of this material.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/plants11091241/s1. Figure S1: Representative electropherogram profiles of the fluorescence-labeled simple sequence repeat (SSR) products amplified with the pair of primer CPSCT026. (a) Japanese plum (Prunus salicina) cultivar ’Kelsey’. (b) Interspecific hybrid cultivar (pluot) ‘Flavor King’. (c) Apricot (Prunus armeniaca) cultivar ‘Charisma’. Table S1: Genotypes of 115 accessions of interspecific plum × apricot hybrids and 27 reference genotypes using eight SSR markers. Table S2: Accessions and group assignment performed by DAPC (K = 5).

Author Contributions

Conceptualization, M.E.G. and J.R.; data curation, B.I.G.; methodology, B.I.G.; writing—original draft, B.I.G., M.E.G. and J.R.; writing—review and editing, B.I.G., M.E.G. and J.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Agencia Estatal de Investigación (PID2020-115473RR-I00/AEI 436/10.13039/501100011033); Gobierno de Aragón—European Social Fund, European Union (Grupo Consolidado A12_17R), and Junta de Extremadura—Fondo Europeo de Desarrollo Regional (FEDER), Plan Regional de Investigación (IB16181), Grupo de Investigación (AGA001, GR18196). B.I. Guerrero was supported by a fellowship of Consejo Nacional de Ciencia y Tecnología of México (CONACYT, 471839).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Faust, M.; Timon, B.; Surányi, D.; Nyujtó, F.; Gradziel, T.M. Origin and Dissemination of Prunus Crops: Peach, Cherry, Apricot, Plum and Almond; Horticultural Reviews: Gent-Oostakker, Belgium, 2011; Volume 17, ISBN 978-90-6605-436-3. [Google Scholar]
  2. Okie, W.R. Introgression of Prunus species in plum. N. Y. Fruit Q. 2006, 14, 29–37. [Google Scholar]
  3. Manaresi, A. On the origin and genetic constitution of the black apricot Prunus dasycarpa Ehrh. Mem. Accad. Sci. Ist. di Bol. 1950, 7, 19. (In Italian) [Google Scholar]
  4. Hedrick, U.P. The Plums of New York; J.B. Lyon Company, State Printers: Albany, NY, USA, 1911; p. 333. [Google Scholar]
  5. Karp, D. Luther Burbank ’s plums. HortScience 2015, 50, 189–194. [Google Scholar] [CrossRef]
  6. Roeding, G.C. New Products of the Trees: A Treatise of Burbank’s Late Introductions; Roeding, G.C., Ed.; Fancher Creek Nurseries: Fresno, CA, USA, 1908. [Google Scholar]
  7. Okie, W.R. Spring Satin plumcot. J. Am. Pomol. Soc. 2005, 59, 119–124. [Google Scholar]
  8. Nicolás-Almansa, M.; Guevara, A.; Rubio, M.; Cos, J.; Carrillo, A.; García-Montiel, F.; Salazar, J.A.; Martínez-Gómez, P.; Ruiz, D. The apricot as a source of self-compatibility and Plum pox virus resistance in the generation of interspecific hybrids Prunus salicina Lindl. × Prunus armeniaca L. (plumcots). Acta Hortic. 2020, 1290, 115–118. [Google Scholar] [CrossRef]
  9. Brantley, W. About pluots. Gastronomica 2004, 4, 84–89. [Google Scholar] [CrossRef]
  10. Ramming, D.W. Diploid plum × apricot interspecific hybrids. Fruit Var. J. 1976, 30, 17. [Google Scholar]
  11. Nicolás-Almansa, M.; Guevara, A.; Rubio, M.; Cos, J.; Carrillo, A.; Garcıá-Montiel, F.; Salazar, J.A.; Martınez-Gómez, P.; Ruiz, D. Molecular and phenotypic characterization of interspecific Prunus salicina Lindl. × Prunus armeniaca L. (plumcot) hybrids. Acta Hortic. 2021, 1307, 267–274. [Google Scholar] [CrossRef]
  12. Milošević, T.; Milošević, N. Plum (Prunus spp.) breeding. In Advances in Plant Breeding Strategies: Fruits; Al-Khayri, J., Jain, S., Johnson, D., Eds.; Springer: Cham, Switzerland, 2018; Volume 3, pp. 165–215. ISBN 9783319919447. [Google Scholar] [CrossRef]
  13. Topp, B.L.; Russell, D.M.; Neumüller, M.; Dalbó, M.A.; Liu, W. Plum. In Fruit Breeding; Badenes, M.L., Byrne, D.H., Eds.; Springer: Boston, MA, USA, 2012; pp. 571–621. ISBN 978-1-4419-0763-9. [Google Scholar] [CrossRef]
  14. Faust, M.; Surányi, D. Origin and dissemination of plums. In Origin and Dissemination of Prunus Crops: Peach, Cherry, Apricot, Plum and Almond; Janick, J., Ed.; Horticultural Reviews: Gent-Oostakker, Belgium, 2011; pp. 139–186. ISBN 978-90-6605-436-3. [Google Scholar]
  15. Guerrero, B.I.; Guerra, M.E.; Herrera, S.; Irisarri, P.; Pina, A.; Rodrigo, J. Genetic diversity and population structure of Japanese plum-type (Hybrids of P. salicina) accessions assessed by SSR markers. Agronomy 2021, 11, 1748. [Google Scholar] [CrossRef]
  16. Bae, H.; Yun, S.K.; Jun, J.H.; Yoon, I.K.; Nam, E.Y.; Kwon, J.H. Assessment of organic acid and sugar composition in apricot, plumcot, plum, and peach during fruit development. J. Appl. Bot. Food Qual. 2014, 87, 24–29. [Google Scholar] [CrossRef]
  17. Crisosto, C.H.; Crisosto, G.M.; Echeverria, G.; Puy, J. Segregation of plum and pluot cultivars according to their organoleptic characteristics. Postharvest Biol. Technol. 2007, 44, 271–276. [Google Scholar] [CrossRef]
  18. Guerra, M.E.; Rodrigo, J. Japanese plum pollination: A review. Sci. Hortic. 2015, 197, 674–686. [Google Scholar] [CrossRef]
  19. Boonprakob, U.; Byrne, D.H.; Graham, C.J.; Okie, W.R.; Beckman, T.; Smith, B.R. Genetic relationships among cultivated diploid plums and their progenitors as determined by RAPD markers. J. Am. Soc. Hortic. Sci. 2001, 126, 451–461. [Google Scholar] [CrossRef]
  20. Ahmad, R.; Potter, D.; Southwick, S.M. Identification and characterization of plum and pluot cultivars by microsatellite markers. J. Hortic. Sci. Biotechnol. 2004, 79, 164–169. [Google Scholar] [CrossRef]
  21. Qiao, Y.S.; Fang, J.G.; Cong, Y.; Zhou, J.; Zhang, Z. Analysis of genetic diversity of Japanese plum cultivars based on RAPD, ISSR and SSR markers. Acta Hortic. 2007, 763, 177–183. [Google Scholar] [CrossRef]
  22. Ferrero Klabunde, G.H.; Dalbó, M.A.; Nodari, R.O. DNA fingerprinting of Japanese plum (Prunus salicina) cultivars based on microsatellite markers. Crop Breed. Appl. Biotechnol. 2014, 14, 139–145. [Google Scholar] [CrossRef]
  23. Merkouropoulos, G.; Ganopoulos, I.; Tsaftaris, A.; Papadopoulos, I.; Drogoudi, P. Combination of high resolution melting (HRM) analysis and SSR molecular markers speeds up plum genotyping: Case study genotyping the Greek plum GeneBank collection. Plant Genet. Resour. Charact. Util. 2017, 15, 366–375. [Google Scholar] [CrossRef]
  24. Hormaza, J.I. Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor. Appl. Genet. 2002, 104, 321–328. [Google Scholar] [CrossRef]
  25. Bourguiba, H.; Scotti, I.; Sauvage, C.; Zhebentyayeva, T.; Ledbetter, C.; Krška, B.; Remay, A.; D’Onofrio, C.; Iketani, H.; Christen, D.; et al. Genetic structure of a worldwide germplasm collection of Prunus armeniaca L. reveals three major diffusion routes for varieties coming from the species’ center of origin. Front. Plant Sci. 2020, 11, 638. [Google Scholar] [CrossRef]
  26. Herrera, S.; Hormaza, J.I.; Lora, J.; Ylla, G.; Rodrigo, J. Molecular characterization of genetic diversity in apricot cultivars: Current situation and future perspectives. Agronomy 2021, 11, 1714. [Google Scholar] [CrossRef]
  27. Botstein, D.; White, R.; Skolnick, M.; Davis, R. Construction of a linkage map using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
  28. Abdallah, D.; Baraket, G.; Perez, V.; Ben Mustapha, S.; Salhi-Hannachi, A.; Hormaza, J.I. Analysis of self-incompatibility and genetic diversity in diploid and hexaploid plum genotypes. Front. Plant Sci. 2019, 10, 896. [Google Scholar] [CrossRef] [PubMed]
  29. Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef] [PubMed]
  30. IPS, International Plant Selection. 2022. Available online: https://www.ips-plant.com/en/ (accessed on 20 February 2022).
  31. Okie, W.R.; Ramming, D.W. Plum breeding worldwide. Horttechnology 1999, 9, 162–176. [Google Scholar] [CrossRef]
  32. Google-Patents, Google Patents. 2022. Available online: https://patents.google.com/patent/USPP16590P2/en (accessed on 16 January 2022).
  33. Zaiger, G.; Gardner, L.; Zaiger, G. United States Plant Patent. 2006. Available online: https://patents.justia.com/inventor/chris-floyd-zaiger (accessed on 15 February 2022).
  34. Okie, W.R. Register of new fruit and nut varieties. List 41. HortScience 2002, 37, 251–272. [Google Scholar] [CrossRef]
  35. Carrasco, B.; Díaz, C.; Moya, M.; Gebauer, M.; García-González, R. Genetic characterization of Japanese plum cultivars (Prunus salicina) using SSR and ISSR molecular markers. Cienc. Investig. Agrar. 2012, 39, 533–543. [Google Scholar] [CrossRef]
  36. Okie, W.R. Register of new fruit and nut varieties. List 42. HortScience 2004, 39, 1509–1523. [Google Scholar] [CrossRef]
  37. Okie, W.R.; Weinberger, J.H. Plums. In Fruit Breeding. Volume 1: Tree and Tropical Fruits; Janick, J., Moore, J.N., Eds.; John Wiley and Sons, Inc.: New York, NY, USA, 1996; pp. 559–608. [Google Scholar]
  38. Halász, J.; Kodad, O.; Galiba, G.M.; Skola, I.; Ercisli, S.; Ledbetter, C.A.; Hegedűs, A. Genetic variability is preserved among strongly differentiated and geographically diverse almond germplasm: An assessment by simple sequence repeat markers. Tree Genet. Genomes 2019, 15, 12. [Google Scholar] [CrossRef]
  39. Pérez, V.; Larrañaga, N.; Abdallah, D.; Wünsch, A.; Hormaza, J.I. Genetic diversity of local peach (Prunus persica) accessions from La Palma Island (Canary Islands, Spain). Agronomy 2020, 10, 457. [Google Scholar] [CrossRef]
  40. Guerra, M.E.; Guerrero, B.I.; Casadomet, C.; Rodrigo, J. Self-(in)compatibility, S-RNase allele identification, and selection of pollinizers in new Japanese plum-type cultivars. Sci. Hortic. 2020, 261, 109022. [Google Scholar] [CrossRef]
  41. Guerra, M.E.; López-Corrales, M.; Wünsch, A. Improved S-genotyping and new incompatibility groups in Japanese plum. Euphytica 2012, 186, 445–452. [Google Scholar] [CrossRef]
  42. Guerrero, B.I.; Guerra, M.E.; Rodrigo, J. Establishing pollination requirements in Japanese plum by phenological monitoring, hand pollinations, fluorescence microscopy and molecular genotyping. J. Vis. Exp. 2020, 165, e61897. [Google Scholar] [CrossRef] [PubMed]
  43. Guerra, M.E.; Rodrigo, J.; López-Corrales, M.; Wünsch, A. S-RNase genotyping and incompatibility group assignment by PCR and pollination experiments in Japanese plum. Plant Breed. 2009, 128, 304–311. [Google Scholar] [CrossRef]
  44. Mnejja, M.; Garcia-Mas, J.; Howad, W.; Badenes, M.L.; Arús, P. Simple-sequence repeat (SSR) markers of Japanese plum (Prunus salicina Lindl.) are highly polymorphic and transferable to peach and almond. Mol. Ecol. Notes 2004, 4, 163–166. [Google Scholar] [CrossRef]
  45. Sosinski, B.; Gannavarapu, M.; Hager, L.D.; Beck, L.E.; KIng, J.J.; Ryder, C.D.; Rajapakse, S.; Baird, W.V.; Ballard, R.E.; Abbot, A.G. Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch]. Theor. Appl. Genet. 2000, 101, 421–428. [Google Scholar] [CrossRef]
  46. Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, M.; Poizat, C.; Zanetto, A.; Arús, P.; Laigret, F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef] [PubMed]
  47. Cipriani, G.; Lot, G.; Huang, W.G.; Marrazzo, M.T.; Peterlunger, E.; Testolin, R. AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L) Batsch]: Isolation, Characterisation and Cross-species amplification in Prunus. Theor. Appl. Genet. 1999, 99, 65–72. [Google Scholar] [CrossRef]
  48. Aranzana, M.; García-Mas, J.; Carbó, J.; Arús, P. Development and variability analysis of microsatellite markers in peach. Plant Breed. 2002, 121, 87–92. [Google Scholar] [CrossRef]
  49. R Core Team R: A Language and Environment for Statistical Computing. 2022. Available online: https://www.r-project.org/ (accessed on 20 January 2022).
  50. Covarrubias-Pazaran, G.; Diaz-Garcia, L.; Schlautman, B.; Salazar, W.; Zalapa, J. Fragman: An R package for fragment analysis. BMC Genet. 2016, 17, 62. [Google Scholar] [CrossRef]
  51. Jombart, T. Adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef]
  52. Goudet, J. Hierfstat, a package for R to compute and test hierarchical F-statistics. Mol. Ecol. Notes 2005, 5, 184–186. [Google Scholar] [CrossRef]
  53. Paradis, E. Pegas: An R package for population genetics with an integrated-modular approach. Bioinformatics 2010, 26, 419–420. [Google Scholar] [CrossRef] [PubMed]
  54. Adamack, A.; Gruber, B. PopGenReport: Simplifying basic population genetic analyses in R. Methods Ecol. Evol. 2014, 5, 384–387. [Google Scholar] [CrossRef]
  55. Nei, M.; Li, W.H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 1979, 76, 5269–5273. [Google Scholar] [CrossRef] [PubMed]
  56. Kamvar, Z.N.; Tabima, J.F.; Grünwald, N.J. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef]
  57. Jombart, T. A tutorial for Discriminant Analysis of Principal Components (DAPC) using adegenet 2.0.0. 2015, pp. 1–43. Available online: https://adegenet.r-forge.r-project.org/files/tutorial-dapc.pdf (accessed on 25 January 2022).
Figure 1. Genetic relationships and population structure from 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots). (a) The genetic relationships are represented by an unweighted pair group method based on arithmetic averages (UPGMA) dendrogram created from 1000 bootstrap replications. Bootstrap values >50% were placed on the branches. (b) The population structure is represented by the stacked bar chart. The x-axis provides the probability of each accession belonging to the assigned group identified by discriminant analysis of principal components (DAPC) (K = 5). These groups are depicted in orange (G1), yellow (G2), green (G3), purple (G4), and pink (G5).
Figure 1. Genetic relationships and population structure from 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots). (a) The genetic relationships are represented by an unweighted pair group method based on arithmetic averages (UPGMA) dendrogram created from 1000 bootstrap replications. Bootstrap values >50% were placed on the branches. (b) The population structure is represented by the stacked bar chart. The x-axis provides the probability of each accession belonging to the assigned group identified by discriminant analysis of principal components (DAPC) (K = 5). These groups are depicted in orange (G1), yellow (G2), green (G3), purple (G4), and pink (G5).
Plants 11 01241 g001
Figure 2. Clustering and DAPC cross-validation. (a) Inference of the optimal number of clusters in the 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots), and (b) DAPC cross-validation for the optimal number of principal components (PCs) retained for the analysis in the five predefined groups.
Figure 2. Clustering and DAPC cross-validation. (a) Inference of the optimal number of clusters in the 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots), and (b) DAPC cross-validation for the optimal number of principal components (PCs) retained for the analysis in the five predefined groups.
Plants 11 01241 g002
Figure 3. Scatterplot of discriminant analysis of principal components (DAPC) of population structure of 115 interspecific plum × apricot hybrids accessions and 27 reference genotypes (diploid plums and apricots) using eight SSR markers. The axes represent the first two linear discriminants (LD1 and LD2) according to the discriminant analysis functions (DA) eigenvalues. Four discriminant analysis functions (DA) eigenvalues and 25 principal component analysis (PCA) eigenvalues were retained during analyses to describe the relationship between the five groups. Each dot represents an accession, and each colored circle represents a group identified by DAPC analysis. G1 = group formed mainly by advanced selections (orange), G2 = group with more commercial cultivars (yellow), G3 = group with more reference genotypes (green), G4 = largest group (purple), and G5 = apricot group (pink).
Figure 3. Scatterplot of discriminant analysis of principal components (DAPC) of population structure of 115 interspecific plum × apricot hybrids accessions and 27 reference genotypes (diploid plums and apricots) using eight SSR markers. The axes represent the first two linear discriminants (LD1 and LD2) according to the discriminant analysis functions (DA) eigenvalues. Four discriminant analysis functions (DA) eigenvalues and 25 principal component analysis (PCA) eigenvalues were retained during analyses to describe the relationship between the five groups. Each dot represents an accession, and each colored circle represents a group identified by DAPC analysis. G1 = group formed mainly by advanced selections (orange), G2 = group with more commercial cultivars (yellow), G3 = group with more reference genotypes (green), G4 = largest group (purple), and G5 = apricot group (pink).
Plants 11 01241 g003
Figure 4. Correlation plot of pairwise genetic differentiation values (FST) among the five groups inferred by DAPC (K = 5). Lower and upper limits of the 99% confidence interval based on 1000 bootstrap replicates are shown in brackets.
Figure 4. Correlation plot of pairwise genetic differentiation values (FST) among the five groups inferred by DAPC (K = 5). Lower and upper limits of the 99% confidence interval based on 1000 bootstrap replicates are shown in brackets.
Plants 11 01241 g004
Table 1. Genetic diversity parameters of 115 accessions of interspecific plum × apricot hybrids and 27 reference genotypes using eight SSR markers. Number of alleles (NA), allele size, polymorphism information content (PIC), observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (FIS), and Wright’s fixation index (FST).
Table 1. Genetic diversity parameters of 115 accessions of interspecific plum × apricot hybrids and 27 reference genotypes using eight SSR markers. Number of alleles (NA), allele size, polymorphism information content (PIC), observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (FIS), and Wright’s fixation index (FST).
LocusNAAllele Size (bp)PICHoHeFISFST
pchgms220128–1700.840.850.83−0.030.07
CPPCT03312122–1590.610.660.58−0.130.21
BPPCT00721113–1670.800.810.820.010.06
BPPCT03920121–1730.780.480.600.200.29
BPPCT02518148–1960.820.730.780.070.09
CPSCT02617156–2100.870.490.780.370.14
CPSCT00520167–2290.900.730.870.160.07
UDP960052195–730.850.830.830.000.08
Mean19-0.810.700.760.080.13
Table 2. Analysis of molecular variance (AMOVA) for 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots) structured in five groups (K = 5).
Table 2. Analysis of molecular variance (AMOVA) for 115 interspecific plum × apricot hybrids and 27 reference genotypes (diploid plums and apricots) structured in five groups (K = 5).
Source of VariationdfSum of SquareMean Sum of Square% of the VariancePhi
Among groups (K = 5)418747110.20
Among accessions within groups (K = 5)137913790.10
Within accessions142772580 *0.11
Total28318727100-
* Significant values at p < 0.01 significance level.
Table 3. Parameters of genetic diversity of the genetic structure (K = 5) of 115 accessions of interspecific hybrids and 27 reference genotypes using eight SSR markers. Number of alleles (NA), allele richness (AR), private alleles (PA), observed heterozygosity (Ho), expected heterozygosity (He), and inbreeding coefficient (FIS).
Table 3. Parameters of genetic diversity of the genetic structure (K = 5) of 115 accessions of interspecific hybrids and 27 reference genotypes using eight SSR markers. Number of alleles (NA), allele richness (AR), private alleles (PA), observed heterozygosity (Ho), expected heterozygosity (He), and inbreeding coefficient (FIS).
GroupnNA PER LOCUSNA TOTALARPAHoHeFIS
G1139697.75110.750.780.04
G2389756.8240.610.670.06
G33212958.1480.680.860.21
G44910826.9450.700.760.05
G5106496.25240.750.75−0.01
Table 4. Reference genotypes analyzed in this study.
Table 4. Reference genotypes analyzed in this study.
Reference Genotypes
Almabar 4 (P. armeniaca)Honey Top 15 (P. persica)
Aprix9 8 (P. armeniaca)Kelsey 17 (P. salicina)
Charisma 1 (P. armeniaca)Mariposa 2 (P. salicina)
Colorado 9 (P. armeniaca)Methley 7 (P. salicina × P. cerasifera)
Katy 15 (P. armeniaca)Mitard 16 (P. cerasifera)
Mirlo Naranja 3 (P. armeniaca)Queen Ann 14 (Gaviota × Eldorado)
Monstercot 13 (P. armeniaca)Queen Rosa 14 (Queen Ann × Santa Rosa)
Muñoz 16 (P. armeniaca)Red Beaut 10 (Burmosa × Eldorado)
Rubisia 6 (P. armeniaca)Santa Rosa 7 (P. salicina)
Sunnycot 11 (P. armeniaca)Simon 12 (P. simonii)
Abundance 17 (P. salicina)Songold 1 (Golden King × Wickson)
Angeleno 5 (‘Queen Ann’ x unknown)Splash 15 (Pluot)
Dapple Jack 15 (Pluot)Sweet Treat 15 (Pluerry)
Honey Sun 15 (P. persica × P. armeniaca)
1 ARC-Infruitech, South Africa; 2 Armstrong Nursery, USA; 3 CEBAS-CSIC, Spain; 4 Frutaria, Spain; 5 Garabedian, USA; 6 IPS, France; 7 Luther Burbank, USA; 8 Proseplan, Spain; 9 PSB Producción Vegetal, Spain; 10 Reedley Nursery, USA; 11 SDR FRUIT LLC, USA; 12 Simon Brothers, USA; 13 SMS Unlimited, USA; 14 USDA, USA; 15 Zaiger Genetics, USA; 16 unknown; 17 imported from Japan by L. Burbank.
Table 5. Commercial cultivars of interspecific hybrids of Zaiger Genetics analyzed in this study and their available pedigree information.
Table 5. Commercial cultivars of interspecific hybrids of Zaiger Genetics analyzed in this study and their available pedigree information.
Commercial CultivarsAvailable Pedigree Information
Bella GoldGeo Pride, Flavor Queen, Mariposa, Red Beaut
Candy HeartAutumn Giant, Black Kat, Red Beaut
Crimson HeartFriar, Flavorosa, Laroda, Plum Parfait, Queen Ann
Crimson KatFlaming Gold, Flavor Treat, Mariposa, Red Beaut
Emerald DropFriar, Flavor Queen, Red Beaut
Fall FiestaDapple Fire
Flavor FallUnknown
Flavor FinaleCasselman, King David, Queen Ann, Red Beaut
Flavor FusionBella Sun, Con-N-Candy, Poppy, Red Beaut
Flavor GrenadeFlavor Queen, Mariposa, Red Beaut
Flavor KingFlavor Queen, Mariposa, Red Beaut
Flavor SupremeRed Beaut
Glory RedBurmosa, Flavor Fall, Mariposa, Red Beaut
Honey PunchAutumn Giant, Friar, Modesto, Red Beaut, Splash
Honey QueenUnknown
Sweet BlazeUnknown
Sweet PixieP. avium (Bing, Nadia, Royal Lee, Stella)
Tasty SweetUnknown
Table 6. Multiplex (Mp) design, SSR loci, linkage group (LG), fluorescent dyes, primer concentration (PC), PCR details and characteristics of the eight SSR markers analyzed in this study.
Table 6. Multiplex (Mp) design, SSR loci, linkage group (LG), fluorescent dyes, primer concentration (PC), PCR details and characteristics of the eight SSR markers analyzed in this study.
MpLocusLGDyePC (µM)Primer SequenceSSR MotifSize Range (bp)Species
M01pchgms2 [45]G46-FAM0.2F: GTCAATGAGTTCAGTGTTACACTC(CT)24130–200Peach
R: AATCATAACATCATTCAGCCACTGC
CPPCT033 [48]G7NED0.2F: TCAGCAAACTAGAAACAAACC(CT)16151Peach
R: TTGCAATCTGGTTGATGTT
M02BPPCT-007 [46]G36-FAM0.2F: TCATTGCTCGTCATCAGC(AG)22(CG)2(AG)4143–151Peach
R: CAGATTTCTGAAGTTAGCGGTA
UDP96-005 [47]G1VIC0.3F: GTAACGCTCGCTACCACAAA(AC)16TG(CT)2CA(CT)11100–250Peach
R: CCTGCATATCACCACCCAG
M03BPPCT-039 [46]G3PET0.3F: ATTACGTACCCTAAAGCTTCTGC(GA)20148–158Peach
R: GATGTCATGAAGATTGGAGAGG
BPPCT-025 [46]G6VIC0.3F: TCCTGCGTAGAAGAAGGTAGC(GA)29178–202Peach
R: CGACATAAAGTCCAAATGGC
M04CPSCT026 [44]G76-FAM0.3F: TCTCACACGCTTTCGTCAAC(CT)16177–213Japanese plum
R: AAAAAGCCAAAAGGGGTTGT
M05CPSCT005 [44]G4NED0.3F: CTGCAAGCACTGCGGATCTC(CT)15171–191Japanese plum
R: CCCATATTCCCAACCCATTA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Guerrero, B.I.; Guerra, M.E.; Rodrigo, J. Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants 2022, 11, 1241. https://doi.org/10.3390/plants11091241

AMA Style

Guerrero BI, Guerra ME, Rodrigo J. Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants. 2022; 11(9):1241. https://doi.org/10.3390/plants11091241

Chicago/Turabian Style

Guerrero, Brenda I., María Engracia Guerra, and Javier Rodrigo. 2022. "Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids" Plants 11, no. 9: 1241. https://doi.org/10.3390/plants11091241

APA Style

Guerrero, B. I., Guerra, M. E., & Rodrigo, J. (2022). Simple Sequence Repeat (SSR)-Based Genetic Diversity in Interspecific Plumcot-Type (Prunus salicina × Prunus armeniaca) Hybrids. Plants, 11(9), 1241. https://doi.org/10.3390/plants11091241

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop