Silicate Inhibits the Cytosolic Influx of Chloride in Protoplasts of Wheat and Affects the Chloride Transporters, TaCLC1 and TaNPF2.4/2.5
Abstract
1. Introduction
1.1. Salinity Stress in Plants
1.2. CLCs Channels Involved in Chloride Transport
1.3. NPF Transporters Involved in Chloride Transport
1.4. NPF Transporters in Wheat (Triticum aestivum L.)
1.5. Silicon Effects
1.6. Chloride in the Cytosol of Plant Cells
2. Results
2.1. Cytosolic Uptake of Chloride in Mesophyll Protoplasts
2.2. RT-qPCR Was Used for Expression Analyses of TaCLC1 and TaNPF2.4 Genes
3. Discussion
4. Materials and Methods
4.1. Plant Material and Cultivation
4.2. Protoplast Isolation and Loading with MQAE Dye
4.3. Fluorescence Measurement
4.4. Statistical Analysis
4.5. Expression Analysis of TaCLC1 and Ta NPF2.4 in Roots and Leaves by RT-qPCR
4.5.1. Total RNA Extraction
4.5.2. cDNA Synthesis
4.5.3. Real-Time Quantitative (RT-qPCR) Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Colmenero-Flores, J.M.; Franco-Navarro, J.D.; Cubero-Font, P.; Peinado-Torrubia, P.; Rosales, M.A. Chloride as a beneficial macronutrient in higher plants: New roles and regulation. Int. J. Mol. Sci. 2019, 20, 4686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flowers, T.J. Chloride as a nutrient and as an osmoticum. Adv. Plant Nutr. 1989, 3, 55–78. [Google Scholar]
- White, P.; Broadly, M.R. Chloride in soils and its uptake and movement within the Plant: A Review. Ann. Bot. 2001, 88, 967–988. [Google Scholar] [CrossRef] [Scilit]
- Kawakami, K.; Umena, Y.; Kamiya, N.; Shen, J.R. Location of chloride and its possible functions in oxygen-evolving photosystem II revealed by X-ray crystallography. Proc. Natl. Acad. Sci. USA 2009, 106, 8567–8572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herdean, A.; Nziengui, H.; Zsiros, O.; Solymosi, K.; Garab, G.; Lundin, B.; Spetea, C. The Arabidopsis thylakoid chloride channel AtCLCe functions in chloride homeostasis and regulation of photosynthetic electron transport. Front. Plant Sci. 2016, 7, 115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geilfus, C.M. Review on the significance of chlorine for crop yield and quality. Plant Sci. 2018, 270, 114–122. [Google Scholar] [CrossRef] [Scilit]
- Flowers, T.J.; Munns, R.; Colmer, T.D. Sodium chloride toxicity and the cellular basis of salt tolerance in halophytes. Ann. Bot. 2014, 115, 419–431. [Google Scholar] [CrossRef] [Scilit]
- Franco-Navarro, J.D.; Brumós, J.; Rosales, M.A.; Cubero-Font, P.; Talón, M.; Colmenero-Flores, J.M. Chloride regulates leaf cell size and water relations in tobacco plants. J. Exp. Bot. 2016, 67, 873–891. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Li, Z. The Importance of Cl− exclusion and vacuolar Cl− Sequestration: Revisiting the role of Cl− Transport in plant salt tolerance. Front. Plant Sci. 2019, 10, 1418. [Google Scholar] [CrossRef] [Scilit]
- Tavakkoli, E.; Rengasamy, P.; McDonald, G.K. High concentrations of Na+ and Cl− ions in soil solution have simultaneous detrimental effects on growth of faba bean under salinity stress. J. Exp. Bot. 2010, 61, 4449–4459. [Google Scholar] [CrossRef] [Scilit]
- Lüchli, A.; James, R.A.; Huang, C.X.; McCully, M.; Munns, R. Cell-specific localization of Na+ in roots of durum wheat and possible control points for salt exclusion. Plant Cell Environ. 2008, 31, 1565–1574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yong, M.-T.; Solis, C.A.; Rabbi, B.; Huda, S.; Liu, R.; Zhou, M.; Shabala, L.; Venkataraman, G.; Shabala, S.; Chen, Z.-H. Leaf mesophyll K+ and Cl− fluxes and reactive oxygen species production predict rice salt tolerance at reproductive stage in greenhouse and field conditions. Plant Growth Regul. 2020, 92, 53–64. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Chen, S.; Dai, S.; Wang, R.; Li, N.; Shen, X.; Zhou, X.; Lu, C.; Zheng, X.; Hu, Z.; et al. NaCl-induced alternations of cellular and tissue ion fluxes in roots of salt-resistant and salt-sensitive poplar species. Plant Physiol. 2009, 149, 1141–1153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teakle, N.L.; Tyerman, S.D. Mechanisms of Cl− transport contributing to salt tolerance. Plant Cell Environ. 2010, 33, 566–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbier-Brygoo, H.; Vinauger, H.; Colcombet, J.; Ephritikhine, G.; Frachisse, J.-M.; Maurel, C. Anion channels in higher plants: Functional characterization, molecular structure and physiological role. BBA Biomembr. 2000, 1465, 199–218. [Google Scholar] [CrossRef] [Scilit]
- Elzenga, J.T.M.; Van Volkenburgh, E. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum. Planta 1997, 201, 415–423. [Google Scholar] [CrossRef] [Scilit]
- Mao, P.; Run, Y.; Wang, H.; Han, C.; Zhang, L.; Zhan, K.; Xu, H.; Cheng, X. Genome-wide identification and functional characterization of the chloride channel TaCLC gene family in wheat (Triticum aestivum L.). Front. Genet. 2022, 13, 846795. [Google Scholar] [CrossRef] [Scilit]
- Wei, P.; Wang, L.; Liu, A.; Yu, B.; Lam, H.-M. GmCLC1 confers enhanced salt tolerance through regulating chloride accumulation in soybean. Front. Plant Sci. 2016, 7, 1082. [Google Scholar] [CrossRef] [Scilit]
- Wong, T.H.; Li, M.W.; Yao, X.Q.; Lam, H.M. The GmCLC1 protein from soybean functions as a chloride transporter. J. Plant Physiol. 2013, 170, 101–104. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Byrt, C.; Qiu, J.; Baumann, U.; Hermova, M.; Edvard, A.; Johnson, A.A.T.; Birnbaum, K.D.; Mayo, G.M.; Jha, D.; et al. Identification of a stelar-localized transport protein that facilitates root-to-shoot transfer of chloride in Arabidopsis. Plant Physiol. 2016, 170, 1014–1029. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Feng, J.; Ma, W.; Zhou, Y.; Ma, Z. GhCLCg-1, a vacuolar chloride channel, contributes to salt tolerance by regulating ion accumulation in upland cotton. Front. Plant Sci. 2021, 12, 765173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.; Qiu, J.; Jayakannan, M.; Xu, B.; Li, Y.; Mayo, G.M.; Tester, M.; Gilliham, M.; Roy, S.J. AtNPF2.5 modulates chloride (Cl−) efflux from roots of Arabidopsis thaliana. Front. Plant Sci. 2017, 7, 2013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henderson, S.W.; Baumann, U.; Blackmore, D.H.; Walker, A.R.; Walker, R.R.; Gilliham, M. Shoot chloride exclusion and salt tolerance in grapevine is associated with differential ion transporter expression in roots. BMC Plant Biol. 2014, 14, 273. [Google Scholar] [CrossRef] [Scilit]
- Lamichhane, S.; Murata, C.; Griffey, C.A.; Thomason, W.E.; Fukao, T. Physiological and molecular traits associated with nitrogen uptake under limited nitrogen in soft red winter wheat. Plants 2021, 10, 165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Wan, Y.; Buchner, P.J. Phylogeny and gene expression of the complete NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER FAMILY in Triticum aestivum. J. Exp. Bot. 2020, 71, 4531–4546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buchner, P.; Hawkesford, M.J. Complex phylogeny and gene expression patterns of members of the nitrate transporter 1/peptide transporter family (NPF) in wheat. J. Exp. Bot. 2014, 65, 5697–5710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Genc, Y.; Taylor, J.; Rongala, J.; Oldach, K. A major locus for chloride accumulation on chromosome 5A in bread wheat. PLoS ONE 2014, 9, e98845. [Google Scholar] [CrossRef] [Scilit]
- Liu, B.; Soundararajan, P.; Manivannan, A. Mechanisms of silicon-mediated amelioration of salt stress in plants. Plants 2019, 8, 307. [Google Scholar] [CrossRef] [Scilit]
- Ismail, L.M.; Soliman, M.I.; Abd El-Aziz, M.H.; Abdel-Aziz, H.M.M. Impact of silica ions and nano silica on growth and productivity of pea plants under salinity stress. Plants 2022, 11, 494. [Google Scholar] [CrossRef] [Scilit]
- El-Serafy, R.S.; El-Sheshtawy, A.N.A.; Atteya, A.K.; Al-Hashimi, A.; Abbasi, A.M.; Al-Ashkar, I. Seed priming with silicon as a potential to increase salt stress tolerance in Lathyrus odoratus. Plants 2021, 10, 2140. [Google Scholar] [CrossRef] [Scilit]
- Abou-Sreea, A.I.B.; Roby, M.H.H.; Mahdy, H.A.A.; Abdou, N.M.; El-Tahan, A.M.; El-Saadony, M.T.; El-Tarabily, K.A.; El-Saadony, F.M.A. Improvement of selected morphological, physiological, and biochemical parameters of roselle (Hibiscus sabdariffa L.) grown under different salinity levels using potassium silicate and Aloe saponaria extract. Plants 2022, 11, 497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Y.; Gong, H.; Yin, J. Role of silicon in mediating salt tolerance in plants: A review. Plants 2019, 8, 147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khoshgoftarmanesha, A.H.; Khodarahmia, S.; Haghighi, M. Effect of silicon nutrition on lipid peroxidation and antioxidant response of cucumber plants exposed to salinity stress. Arch. Agron. Soil Sci. 2014, 60, 639–653. [Google Scholar] [CrossRef] [Scilit]
- Mateos-Naranjo, E.; Andrades-Moreno, L.; Davy, A.J. Silicon alleviates deleterious effects of high salinity on the halophytic grass Spartina densiflora. Plant Physiol. Biochem. 2013, 63, 115–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geilfus, C.M. Chloride: From nutrient to toxicant. Plant Cell Physiol. 2018, 59, 877–886. [Google Scholar] [CrossRef] [Scilit]
- Pope, A.J.; Leigh, R.A. The use of a chloride-sensitive fluorescent probe to measure chloride transport in isolated tonoplast vesicles. Planta 1988, 176, 451–460. [Google Scholar] [CrossRef] [Scilit]
- Verkman, A.S.; Sellers, M.C.; Chao, A.C.; Leung, T.; Ketcham, R. Synthesis and characterization of improved chloride-sensitive fluorescent indicators for biological applications. Anal. Biochem. 1989, 178, 355–361. [Google Scholar] [CrossRef] [Scilit]
- Kader, M.A.; Lindberg, S.; Seidel, T.; Golldack, D.; Yemelyanov, V. Sodium sensing induces different changes in free cytosolic calcium concentration and pH in salt-tolerant and salt-sensitive rice (Oryza sativa L.) cultivars. Physiol. Plant. 2007, 130, 99–111. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Lindberg, S.; Shabala, L.; Morgan, S.; Shabala, S.; Jacobsen, S.-E. A comparative analysis of cytosolic Na+ changes under salinity between halophyte quinoa (Chenopodium quinoa) and glycophyte pea (Pisum sativum). Environ. Exp. Bot. 2017, 141, 154–160. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Zhang, X.; Giraldo, J.P.; Shabala, S. It is not all about sodium: Revealing tissue specificity and signaling roles of potassium in plant responses to salt stress. Plant Soil 2018, 431, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Maglova, L.M.; Crowe, W.E.; Smith, P.R.; Altamirano, A.A.; Russel, J.M. Na+-K+- Cl− cotransport in human fibroblasts is inhibited by cytomegalovirus infection. Am. J. Physiol. 1998, 275, C1330–C1341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munkonge, F.; Alton, E.W.F.W.; Andersson, C.; Davidson, H.; Hjelte, L.; McLachlan, G.; Stern, M.; Roomans, G.M. Measurement of halide efflux from cultured and primary airway epithelial cells using fluorescence indicators. J. Cyst. Fibros. 2004, 3, 171–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, P.P.; Che, B.N.; Shen, L.; Cui, Y.Q.; Wu, S.Y.; Cheng, C.; Liu, F.; Li, M.-W.; Yu, B.; Lam, H.-M. Identification and functional characterization of the chloride channel gene, GsCLC-c2 from wild soybean. BMC Plant Biol. 2019, 19, 121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morgan, S.H.; Lindberg, S.; Mühling, K.H. Calcium supply effects on wheat cultivars differing in salt resistance with special reference to leaf cytosol ion homeostasis. Physiol. Plant. 2013, 149, 321–328. [Google Scholar] [CrossRef] [Scilit]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [Scilit]
- Bajgain, P.; Russell, B.; Mochen, M. Phylogenetic analyses and in-seedling expression of ammonium and nitrate transporters in wheat. Sci. Rep. 2018, 8, 7082. [Google Scholar] [CrossRef] [Scilit]
- Shishova, M.; Lindberg, S. Auxin induces rapid increase of Ca2+ concentration in the cytosol of wheat leaf protoplasts. J. Plant Physiol. 2004, 161, 937–945. [Google Scholar] [CrossRef] [Scilit]
- Vicente, R.; Pérez, P.; Martinez-Carraco, R.; Usadel, B.; Kostadinova, S.; Morcuende, R. Quantitative RT-PCR platform to measure transcript levels of C and N metabolism-related genes in durum wheat: Transcript profiles in elevated [CO2] and high temperature at different levels of N supply. Plant Cell Physiol. 2015, 56, 1556–1573. [Google Scholar] [CrossRef] [Scilit]
- Paolacci, A.R.; Tanzarella, O.A.; Porceddu, E.; Ciaffi, M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol. Biol. 2009, 10, 11. [Google Scholar] [CrossRef] [Scilit]
- Mu, J.; Chen, L.; Gu, Y.; Duan, L.; Han, S.; Li, Y.; Yan, Y.; Li, X. Genome-wide identification of internal reference genes for normalization of gene expression values during endosperm development in wheat. J. Appl. Genet. 2019, 60, 233–241. [Google Scholar] [CrossRef] [Scilit]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Treatments | Fluorescence Intensity Decrease (%) | ||
|---|---|---|---|
| 1st Addition to Protoplast | 2nd Addition to Protoplast | cv. Vinjett | cv. S-24 |
| 0 mM K2SiO3 | 50 mM NaCl | 38.21 ± 0.223 cy | 33.80 ± 0.202 cz |
| 100 mM NaCl | 50.28 ± 0.305 ay | 46.71 ± 0.311 az | |
| 1 mM K2SiO3 | 50 mM NaCl | 30.33 ± 0.212 ey | 26.82 ± 0.64 dz |
| 100 mM NaCl | 45.65 ± 0.483 by | 43.3 ± 0.36 bz | |
| 50 mM NaCl | 0 mM K2SiO3 | 38.21 ± 0.223 cy | 33.80 ± 0.202 cz |
| 1 mM K2SiO3 | 35.97 ± 0.196 dy | 33.89 ± 0.163 cz | |
| 100 mM NaCl | 0 mM K2SiO3 | 50.28 ± 0.305 ay | 46.71 ± 0.311 az |
| 1 mM K2SiO3 | 47.36 ± 0.397 by | 45.99 ± 0.155 az | |
| Gene | Primers | Sequences | References |
|---|---|---|---|
| TaCLC1 | Forward | TCGTGGCTGTTGTGGTGCGA | Vicente et al., (2015) [48] |
| Reverse | AACCGCCAGCCCCAAAATGACC | ||
| TaNPF2.4/2.5 | Forward | ACAATGGACTGTCACCTTGGAACAC | Buchner and Hawkesford, (2014) [26] |
| Reverse | TGCAGTTAGGGCGATTAA GGATATGG | ||
| Ta2291 | Forward | GCTCTCCAACAACATTGCCAAC | Paolacci et al., (2009) [49] |
| Reverse | GCTTCTGCCTGTCACATACGC | ||
| Ta2776 | Forward | CGATTCAGAGCAGCGTATTGTTG | Paolacci et al., (2009) [49] |
| Reverse | AGTTGGTCGGGTCTCTTCTAAATG | ||
| Ta54227 | Forward | CAAATACGCCATCAGGGAGAACATC | Mu et al., (2019) [50] |
| Reverse | CGCTGCCGAAACCACGAGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Premkumar, A.; Javed, M.T.; Pawlowski, K.; Lindberg, S.M. Silicate Inhibits the Cytosolic Influx of Chloride in Protoplasts of Wheat and Affects the Chloride Transporters, TaCLC1 and TaNPF2.4/2.5. Plants 2022, 11, 1162. https://doi.org/10.3390/plants11091162
Premkumar A, Javed MT, Pawlowski K, Lindberg SM. Silicate Inhibits the Cytosolic Influx of Chloride in Protoplasts of Wheat and Affects the Chloride Transporters, TaCLC1 and TaNPF2.4/2.5. Plants. 2022; 11(9):1162. https://doi.org/10.3390/plants11091162
Chicago/Turabian StylePremkumar, Albert, Muhammad Tariq Javed, Katharina Pawlowski, and Sylvia M. Lindberg. 2022. "Silicate Inhibits the Cytosolic Influx of Chloride in Protoplasts of Wheat and Affects the Chloride Transporters, TaCLC1 and TaNPF2.4/2.5" Plants 11, no. 9: 1162. https://doi.org/10.3390/plants11091162
APA StylePremkumar, A., Javed, M. T., Pawlowski, K., & Lindberg, S. M. (2022). Silicate Inhibits the Cytosolic Influx of Chloride in Protoplasts of Wheat and Affects the Chloride Transporters, TaCLC1 and TaNPF2.4/2.5. Plants, 11(9), 1162. https://doi.org/10.3390/plants11091162

