Plant-Programmed Cell Death-Associated Genes Participation in Pinus sylvestris L. Trunk Tissue Formation
Abstract
1. Introduction
2. Results
2.1. Identification of BFN, CEP, and MC Genes in the Scots Pine Genome
2.1.1. BFN Gene Family
2.1.2. CEP Gene Family
2.1.3. MC Gene Family
2.2. Cytology
2.3. Metabolic Status
2.3.1. Activity of AOS and Phenolic Metabolism Enzymes
2.3.2. Carbohydrate Metabolism
2.3.3. Principal Components Analysis Using Enzyme Activity
2.4. Expression of PCD Genes in Scots Pine Trunk Tissue
2.4.1. Expression of BFN, CEP, and MC Genes during Cambium Differentiation
2.4.2. Expression of Genes Related to Heartwood Formation
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Study Objects
5.2. Plant Sampling
5.3. Microscopy
5.4. Gene Retrieval from the Scots Pine Genome by Bioinformatics Methods
5.5. qRT-PCR
5.6. Enzyme Activity Analysis
5.7. Statistical Data Processing
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Dominguez, F.; Moreno, J.; Cejudo, F.J. The nucellus degenerates by a process of programmed cell death during the early stages of wheat grain development. Planta 2001, 213, 352–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lam, E. Controlled cell death, plant survival and development. Nat. Rev. Mol. Cell Biol. 2004, 5, 305–315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Doorn, W.G.; Woltering, E.J. Many ways to exit? Cell death categories in plants. Trends Plant Sci. 2005, 10, 117–122. [Google Scholar] [CrossRef] [Scilit]
- Gunawardena, A.H.; Greenwood, J.S.; Dengler, N.G. Cell wall degradation and modification during programmed cell death in lace plant, Aponogeton madagascariensis (Aponogetonaceae). Am. J. Bot. 2007, 94, 1116–1128. [Google Scholar] [CrossRef] [Scilit]
- Daneva, A.; Gao, Z.; Van Durme, M.; Nowack, M.K. Functions and regulation of programmed cell death in plant development. Annu. Rev. Cell Dev. Biol. 2016, 32, 441–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greenberg, J.T. Programmed cell death: A way of life for plants. Proc. Natl. Acad. Sci. USA 1996, 93, 12094–12097. [Google Scholar] [CrossRef] [Scilit]
- Fukuda, H. Tracheary element differentiation. Plant Cell 1997, 9, 1147–1156. [Google Scholar] [CrossRef] [Scilit]
- Groover, A.; DeWitt, N.; Heidel, A.; Jones, A. Programmed cell death of plant tracheary elements differentiating in vitro. Protoplasma 1997, 196, 197–211. [Google Scholar] [CrossRef] [Scilit]
- Geldner, N. Making phloem—a near-death experience. Science 2014, 345, 875–876. [Google Scholar] [CrossRef] [Scilit]
- Gamalei, Y.V. The Cellular Basis for Transport Processes in Plants; Transport System of Vascular Plants Publishing House of Saint-Petersburg State University: Saint-Petersburg, Russia, 2004; pp. 17–51. [Google Scholar]
- Bonke, M.; Thitamadee, S.; Mähönen, A.P.; Hauser, M.T.; Helariutta, Y. APL regulates vascular tissue identity in Arabidopsis. Nature 2003, 426, 181–186. [Google Scholar] [CrossRef] [Scilit]
- Furuta, K.M.; Yadav, S.R.; Lehesranta, S.; Belevich, I.; Miyashima, S.; Heo, J.O.; Vatén, A.; Lindgren, O.; De Rybel, B.; Van Isterdael, G.; et al. Arabidopsis NAC45/86 direct sieve element morphogenesis culminating in enucleation. Science 2014, 345, 933–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nieminen, K.M.; Kauppinen, L.; Helariutta, Y. A weed for wood? Arabidopsis as a genetic model for xylem development. Plant Physiol. 2004, 135, 653–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaguchi, M.; Mitsuda, N.; Ohtani, M.; Ohme-Takagi, M.; Kato, K.; Demura, T. VASCULAR-RELATED NAC-DOMAIN 7 directly regulates the expression of a broad range of genes for xylem vessel formation. Plant J. 2011, 66, 579–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fukuda, H. Programmed cell death of tracheary elements as a paradigm in plants. In Programmed Cell Death in Higher Plants; Lam, E., Fukuda, H., Greenberg, J., Eds.; Springer Science+Business Media: New York, NY, USA, 2000; Volume 44, pp. 1–9. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Amador, M.A.; Abler, M.L.; De Rocher, E.J.; Thompson, D.M.; van Hoof, A.; LeBrasseur, N.D.; Lers, A.; Green, P.J. Identification of BFN1, a bifunctional nuclease induced during leaf and stem senescence in Arabidopsis. Plant Physiol. 2000, 122, 169–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hillis, D.M. Molecular Versus Morphological Approaches to Systematics. Annu. Rev. Ecol. Evol. Syst. 1987, 18, 23–42. [Google Scholar] [CrossRef]
- Taylor, A.M.; Gartner, B.L.; Morrell, J.J. Heartwood formation and natural durability—A review. Wood Fiber Sci. 2002, 34, 587–611. [Google Scholar]
- Beekwilder, J.; van Houwelingen, A.; Cankar, K.; van Dijk, A.D.; de Jong, R.M.; Stoopen, G.; Bouwmeester, H.; Achkar, J.; Sonke, T.; Bosch, D. Valencene synthase from the heartwood of N ootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene. Plant Biotechnol. J. 2014, 12, 174–182. [Google Scholar] [CrossRef] [Scilit]
- Celedon, J.M.; Chiang, A.; Yuen, M.M.; Diaz-Chavez, M.L.; Madilao, L.L.; Finnegan, P.M.; Barbour, E.L.; Bohlmann, J. Heartwood-specific transcriptome and metabolite signatures of tropical sandalwood (Santalum album) reveal the final step of (Z)-santalol fragrance biosynthesis. Plant J. 2016, 86, 289–299. [Google Scholar] [CrossRef] [Scilit]
- Galibina, N.A.; Nikerova, K.M.; Moshchenskaya, Y.L.; Ershova, M.A. Physiological, biochemical and molecular genetic aspects of heartwood formation mechanisms. Trans. KarRC RAS 2020, 11, 20–37. [Google Scholar] [CrossRef] [Scilit]
- Nakada, R.; Fukatsu, E. Seasonal variation of heartwood formation in Larix kaempferi. Tree Physiol. 2012, 32, 1497–1508. [Google Scholar] [CrossRef] [Scilit]
- Lim, K.J.; Paasela, T.; Harju, A.; Venäläinen, M.; Paulin, L.; Auvinen, P.; Kärkkäinen, K.; Teeri, T.H. Developmental changes in Scots pine transcriptome during heartwood formation. Plant Physiol. 2016, 172, 1403–1417. [Google Scholar] [CrossRef] [Scilit]
- Galibina, N.A.; Moshnikov, S.A.; Nikerova, K.M.; Afoshin, N.V.; Ershova, M.A.; Ivanova, D.S.; Kharitonov, V.A.; Romashkin, I.V.; Semenova, L.I.; Serkova, A.A.; et al. Changes in the intensity of heartwood formation in Scots pine (Pinus sylvestris L.) ontogenesis. IAWA J. 2022, 43, 299–321. [Google Scholar] [CrossRef] [Scilit]
- Jokipii-Lukkari, S.; Delhomme, N.; Schiffthaler, B.; Mannapperuma, C.; Prestele, J.; Nilsson, O.; Street, N.R.; Tuominen, H. Transcriptional roadmap to seasonal variation in wood formation of Norway spruce. Plant Physiol. 2018, 176, 2851–2870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Escamez, S.; Tuominen, H. Programmes of cell death and autolysis in tracheary elements: When a suicidal cell arranges its own corpse removal. J. Exp. Bot. 2014, 65, 1313–1321. [Google Scholar] [CrossRef] [Scilit]
- Fukuda, H.; Komamine, A. Establishment of an experimental system for the study of tracheary element differentiation from single cells isolated from the mesophyll of Zinnia elegans. Plant Physiol. 1980, 65, 57–60. [Google Scholar] [CrossRef] [Scilit]
- Oda, Y.; Mimura, T.; Hasezawa, S. Regulation of secondary cell wall development by cortical microtubules during tracheary element differentiation in Arabidopsis cell suspensions. Plant Physiol. 2005, 137, 1027–1036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palavan-Unsal, N.; Buyuktuncer, E.D.; Tufekci, M.A. Programmed cell death in plants. J. Mol. Cell Biol. 2005, 4, 9–23. [Google Scholar]
- Yang, J.H.; Wang, H. Molecular mechanisms for vascular development and secondary cell wall formation. Front. Plant Sci. 2016, 7, 356. [Google Scholar] [CrossRef] [Scilit]
- Růžička, K.; Ursache, R.; Hejátko, J.; Helariutta, Y. Xylem development—From the cradle to the grave. New Phytol. 2015, 207, 519–535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakano, Y.; Yamaguchi, M.; Endo, H.; Rejab, N.A.; Ohtani, M. NAC-MYB-based transcriptional regulation of secondary cell wall biosynthesis in land plants. Front. Plant Sci. 2015, 6, 288. [Google Scholar] [CrossRef] [Scilit]
- Galibina, N.A.; Tarelkina, T.V.; Chirva, O.V.; Moshchenskaya, Y.u.L.; Nikerova, K.M.; Ivanova, D.S.; Semenova, L.I.; Serkova, A.A.; Novitskaya, L.L. Molecular Genetic Characteristics of Different Scenarios of Xylogenesis on the Example of Two Forms of Silver Birch Differing in the Ratio of Structural Elements in the Xylem. Plants 2021, 10, 1593. [Google Scholar] [CrossRef] [Scilit]
- Kubo, M.; Udagawa, M.; Nishikubo, N.; Horiguchi, G.; Yamaguchi, M.; Ito, J.; Mimura, T.; Fukuda, H.; Demura, T. Transcription switches for protoxylem and metaxylem vessel formation. Genes Dev. 2005, 19, 1855–1860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, R.; Demura, T.; Ye, Z.-H. SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. Plant Cell 2006, 18, 3158–3170. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Zhong, R.; Ye, Z.-H. Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels. PLoS ONE 2014, 9, e105726. [Google Scholar] [CrossRef] [Scilit]
- Endo, H.; Yamaguchi, M.; Tamura, T.; Nakano, Y.; Nishikubo, N.; Yoneda, A.; Kato, K.; Kubo, M.; Kajita, S.; Katayama, Y.; et al. Multiple classes of transcription factors regulate the expression of Vascular-related NAC-DOMAIN7, a master switch of xylem vessel differentiation. Plant Cell Physiol. 2015, 56, 242–254. [Google Scholar] [CrossRef] [Scilit]
- Galibina, N.A.; Moshchenskaya, Y.L.; Tarelkina, T.V.; Chirva, O.V.; Nikerova, K.M.; Serkova, A.A.; Semenova, L.I.; Ivanova, D.S. Changes in the Activity of the CLE41/PXY/WOX Signaling Pathway in the Birch Cambial Zone under Different Xylogenesis Patterns. Plants 2022, 11, 1727. [Google Scholar] [CrossRef] [Scilit]
- Bollhoner, B.; Zhang, B.; Stael, S.; Denance, N.; Overmyer, K.; Goffner, D.; Breusegem, F.; Tuominen, H. Post mortem function of AtMC9 in xylem vessel elements. New Phytol. 2013, 200, 498–510. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Park, S.; Kamdem, D.P.; Keathley, D.E.; Retzel, E.; Paule, C.; Kapur, V.; Han, K.H. Novel gene expression profiles define the metabolic and physiological processes characteristic of wood and its extractive formation in a hardwood tree species, Robinia pseudoacacia. Plant Mol. Biol. 2003, 52, 935–956. [Google Scholar] [CrossRef] [Scilit]
- Eklund, L. Internal oxygen levels decrease during the growing season and with increasing stem height. Trees 2000, 14, 177–180. [Google Scholar] [CrossRef] [Scilit]
- Spicer, R.; Holbrook, N.M. Parenchyma cell respiration and survival in secondary xylem: Does metabolic activity decline with cell age? Plant Cell Environ. 2007, 30, 934–943. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amor, Y.; Haigler, C.H.; Johnson, S.; Wainscott, M.; Delmer, D.P. A membrane-associated form of sucrose synthase and its potential role in synthesis of cellulose and callose in plants. Proc. Natl. Acad. Sci. USA 1995, 92, 9353–9357. [Google Scholar] [CrossRef] [Scilit]
- Delmer, D.P.; Amor, Y. Cellulose Biosynthesis. Plant Cell 1995, 7, 987–1000. [Google Scholar] [CrossRef] [Scilit]
- Sturm, A.; Tang, G.Q. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends Plant Sci. 1999, 4, 401–407. [Google Scholar] [CrossRef] [Scilit]
- Koch, K.E. Sucrose metabolism: Regulatory mechanisms and pivotal roles in sugar sensing and plant development. Curr. Opin. Plant Biol. 2004, 7, 235–246. [Google Scholar] [CrossRef] [Scilit]
- Ruan, Y.L.; Llewellyn, D.J.; Furbank, R.T. Suppression of sucrose synthase gene expression represses cotton fiber cell initiation, elongation, and seed development. Plant Cell 2003, 15, 952–964. [Google Scholar] [CrossRef] [Scilit]
- Coleman, H.D.; Yan, J.; Mansfield, S.D. Sucrose synthase affects carbon partitioning to increase cellulose production and altered cell wall ultrastructure. Proc. Natl. Acad. Sci. USA 2009, 106, 13118–13123. [Google Scholar] [CrossRef] [Scilit]
- Ebermann, R.; Stich, K. Distribution and seasonal variation of wood peroxidase activity in oak (Quercus robur). Wood Fiber Sci. 1985, 3, 391–396. [Google Scholar]
- Arakawa, I.; Funada, R.; Nakaba, S. Changes in the morphology and functions of vacuoles during the death of ray parenchyma cells in Cryptomeria japonica. J. Wood Sci. 2018, 64, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Hillis, W.E. Wood and biomass ultrastructure. In Fundamentals of Thermochemical Biomass Conversion; Springer: Dordrecht, The Netherlands, 1985; pp. 1–33. [Google Scholar] [CrossRef] [Scilit]
- Sperry, J.S.; Perry, A.H.; Sullivan, J.E.M. Pit membrane degradation and air-embolism formation in ageing xylem vessels of Populus tremuloides Michx. J. Exp. Bot. 1991, 42, 1399–1406. [Google Scholar] [CrossRef] [Scilit]
- Magel, E.A. Biochemistry and physiology of heartwood formation. In Cell and Molecular Biology of Wood Formation; Savidge, J.R., Barnett, R., Eds.; BIOS Scientific Publishers: Oxford, UK, 2000; pp. 363–376. [Google Scholar]
- Yang, J.; Kamdem, D.P.; Keathley, D.E.; Han, K.H. Seasonal changes in gene expression at the sapwood—heartwood transition zone of black locust (Robinia pseudoacacia) revealed by cDNA microarray analysis. Tree Physiol. 2004, 24, 461–474. [Google Scholar] [CrossRef] [Scilit]
- Higuchi, T. Biochemistry and Molecular Biology of Wood; Timell, T.E., Ed.; Springer Science Business Media: New York, NY, USA, 2012. [Google Scholar] [CrossRef] [Scilit]
- Bhat, K.V.; Patel, J.D. Nuclear studies in relation to heartwood formation in Ougeinia oojeinensis Roxb. and Garuga Pinnata Roxb. Caryologia 1980, 33, 519–526. [Google Scholar] [CrossRef] [Scilit]
- Magel, E.; Hübner, B. Distribution of phenylalanine ammonia lyase and chalcone synthase within trunks of Robinia pseudoacacia L. Bot. Acta 1997, 110, 314–322. [Google Scholar] [CrossRef] [Scilit]
- Beritognolo, I.; Magel, E.; Abdel-Latif, A.; Charpentier, J.P.; Jay-Allemand, C.; Breton, C. Expression of genes encoding chalcone synthase, flavanone 3-hydroxylase and dihydroflavonol 4-reductase correlates with flavanol accumulation during heartwood formation in Juglans nigra. Tree Physiol. 2002, 22, 291–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishra, G.; Collings, D.A.; Altaner, C.M. Cell organelles and fluorescence of parenchyma cells in Eucalyptus bosistoana sapwood and heartwood investigated by microscopy. N. Z. J. For. Sci. 2018, 48, 13. [Google Scholar] [CrossRef] [Scilit]
- Magel, E.; Jay-Allemand, C.; Ziegler, H. Formation of heartwood substances in the stemwood of Robinia pseudoacacia L. II. Distribution of nonstructural carbohydrates and wood extractives across the trunk. Trees 1994, 8, 165–171. [Google Scholar] [CrossRef] [Scilit]
- Yeung, E.C.T.; Stasolla, C.; Sumner, M.J.; Huang, B.Q. Plant Microtechniques and Protocols; Springer International Publishing: Cham, Switzerland, 2015; ISBN 978-3-319-19943-6. [Google Scholar]
- Marchler-Bauer, A.; Bryant, S.H. CD-Search: Protein Domain Annotations on the Fly. Nucleic Acids Res. 2004, 32, W327–W331. [Google Scholar] [CrossRef] [Scilit]
- de Castro, E.; Sigrist, C.J.; Gattiker, A.; Bulliard, V.; Langendijk-Genevaux, P.S.; Gasteiger, E.; Bairoch, A.; Hulo, N. ScanProsite: Detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Res. 2006, 34, W362–W365. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Felsenstein, J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [Scilit]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: Oxford, UK; New York, NY, USA, 2000; ISBN 978-0-19-513584-8. [Google Scholar]
- Xu, M.; Zang, B.; Yao, H.S.; Huang, M.R. Isolation of high quality RNA and molecular manipulations with various tissues of Populus. Russ. J. Plant Physiol. 2009, 56, 716–719. [Google Scholar] [CrossRef] [Scilit]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serkova, A.A.; Tarelkina, T.V.; Galibina, N.A.; Nikerova, K.M.; Moshchenskaya, Y.L.; Sofronova, I.N.; Nikolaeva, N.N.; Ivanova, D.S.; Semenova, L.I.; Novitskaya, L.L. Changes in the Differentiation Program of Birch Cambial Derivatives following Trunk Girdling. Forests 2022, 13, 1171. [Google Scholar] [CrossRef] [Scilit]
- Ershova, M.A.; Nikerova, K.M.; Galibina, N.A.; Sofronova, I.N.; Borodina, M.N. Some Minor Characteristics of Spectrophotometric Determination of Antioxidant System and Phenolic Metabolism Enzyme Activity in Wood Plant Tissues of Pinus sylvestris L. Protein Pept. Lett. 2022, 29, 711–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Gene Name | Citation/ID GymnoPlaza | Forward/Reverse Primer | Amplicon Length | Annealing Temperature, °C |
|---|---|---|---|---|
| GAPDH | PSY00009485 | GGACAGTGGAAGCATCAT AACCGAATACAGCAACAGA | 82 | 54.2 54.2 |
| BFN | Lim et al., 2016 | GGCTTACAAAGACGCTGAGG | 158 | 53.8 |
| CTGAATCCCGAGTGTGGTCT | 53.8 | |||
| BFN1 | PSY00012931 | CCATAATGCCGAAGGAGAA | 87 | 61.1 |
| GCTCTGCTGCCATAAGTT | 61.6 | |||
| BFN2 | PSY00013485 | AAGACGCTGATGAAGACA | 96 | 60 |
| CCAACCTTACACCTCCTT | 60 | |||
| BFN3 | PSY00022159 | TGATGAGATTCGTTATTG | 163 | 53 |
| CTGGTCAGTATAATTGTTA | 52.7 | |||
| CEP | PSY00006946 | AAGGAATCAATTACTGGATAG TTCAACTGCTTCAATACC | 95 | 56.5 56.3 |
| MC5 | PSY00023144 | TAACGCTCTTCAATCAAT ATGCTGTGAGTATTCTTC | 106 | 55.2 55.3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moshchenskaya, Y.L.; Galibina, N.A.; Nikerova, K.M.; Tarelkina, T.V.; Korzhenevsky, M.A.; Sofronova, I.N.; Ershova, M.A.; Semenova, L.I. Plant-Programmed Cell Death-Associated Genes Participation in Pinus sylvestris L. Trunk Tissue Formation. Plants 2022, 11, 3438. https://doi.org/10.3390/plants11243438
Moshchenskaya YL, Galibina NA, Nikerova KM, Tarelkina TV, Korzhenevsky MA, Sofronova IN, Ershova MA, Semenova LI. Plant-Programmed Cell Death-Associated Genes Participation in Pinus sylvestris L. Trunk Tissue Formation. Plants. 2022; 11(24):3438. https://doi.org/10.3390/plants11243438
Chicago/Turabian StyleMoshchenskaya, Yulia L., Natalia A. Galibina, Kseniya M. Nikerova, Tatiana V. Tarelkina, Maksim A. Korzhenevsky, Irina N. Sofronova, Maria A. Ershova, and Ludmila I. Semenova. 2022. "Plant-Programmed Cell Death-Associated Genes Participation in Pinus sylvestris L. Trunk Tissue Formation" Plants 11, no. 24: 3438. https://doi.org/10.3390/plants11243438
APA StyleMoshchenskaya, Y. L., Galibina, N. A., Nikerova, K. M., Tarelkina, T. V., Korzhenevsky, M. A., Sofronova, I. N., Ershova, M. A., & Semenova, L. I. (2022). Plant-Programmed Cell Death-Associated Genes Participation in Pinus sylvestris L. Trunk Tissue Formation. Plants, 11(24), 3438. https://doi.org/10.3390/plants11243438

