QTL Analysis and CAPS Marker Development Linked with Russet in Pear (Pyrus spp.)
Abstract
:1. Introduction
2. Results
2.1. Genetic Linkage Map of ‘Whangkeumbae’ × ‘Minibae’
2.2. QTL Associated with Russet
2.3. CAPS Marker Discriminating Smooth and Russet Pears
3. Discussion
4. Materials and Methods
4.1. Plant Materials and DNA Extraction
4.2. Genotyping with Affymetrix Axiom® Pear 70K Genotyping SNP Array
4.3. Construction of Genetic Linkage Map
4.4. QTL Analysis
4.5. Development of CAPS Marker Associated with Russet Formation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bell, R.J. Genetic resources of temperate fruit and nut crops I. In Pears (Pyrus), 2nd ed.; Moore, J.N., Ballington, J.R., Eds.; International Society for Horticultural Science: Wageningen, The Netherland, 1990; Volume 3, pp. 655–697. [Google Scholar]
- Inoue, E.; Kasumi, M.; Sakuma, F.; Anzai, H.; Amano, K.; Hara, H. Identification of RAPD marker linked to fruit skin color in Japanese pear (Pyrus pyrifolia Nakai). Sci. Hortic. 2006, 107, 254–258. [Google Scholar] [CrossRef]
- Wang, Y.Z.; Dai, M.S.; Cai, D.Y.; Zhang, S.; Shi, Z.B. A review for the molecular research of russet/semi-russet of sand pear exocarp and their genetic characters. Sci. Hortic. 2016, 210, 138–142. [Google Scholar] [CrossRef]
- Wang, Y.Z.; Zhang, S.; Dai, M.S.; Shi, Z.B. Pigmentation in sand pear (Pyrus pyrifolia) fruit: Biochemical characterization, gene discovery and expression analysis with exocarp pigmentation mutant. Plant Mol. Biol. 2014, 85, 123–134. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, T.; Terakami, S.; Takada, N.; Nishio, S.; Onoue, N.; Nishitani, C.; Kunihisa, M.; Inoue, E.; Iwata, H.; Hayashi, T.; et al. Identification of QTLs controlling harvest time and fruit skin color in Japanese pear (Pyrus pyrifolia Nakai). Breed. Sci. 2014, 64, 351–361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minamikawa, M.F.; Takada, N.; Terakami, S.; Satio, T.; Onogi, A.; Kajiya-Kanegae, H.; Hayashi, T.; Yamamoto, T.; Iwata, H. Genome-wide association study and genomic prediction using parental and breeding populations of Japanese pear (Pyrus pyrifolia Nakai). Sci. Rep. 2018, 8, 11994. [Google Scholar] [CrossRef] [Green Version]
- Takeuchi, Y.; Nishio, S.; Terakami, S.; Takada, N.; Kato, H.; Satio, T. Haplotype structure analysis of a locus associated with fruit skin type on chromosome 8 in Japanese pear. Tree Genet. Genomes 2021, 17, 3. [Google Scholar] [CrossRef]
- Jiang, S.; Luo, J.; Wang, X.; An, H.; Zhang, J.; Li, S. QTL mapping and transcriptome analysis to identify genes associated with green/russet peel in Pyrus pyrifolia. Sci. Hortic. 2022, 293, 110714. [Google Scholar] [CrossRef]
- Bungartz, A.; Klaus, M.; Mathew, B.; Léon, J.; Naz, A.A. Development of new SNP derived cleaved amplified polymorphic sequence marker set and its successful utilization in the genetic analysis of seed color variation in barley. Genomics 2016, 107, 100–107. [Google Scholar] [CrossRef]
- Sun, C.; Dong, Z.; Zhao, L.; Ren, Y.; Zhang, N.; Chen, F. The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat. Plant Biotechnol. J. 2020, 18, 1354–1360. [Google Scholar] [CrossRef]
- Tanaka, M.; Takahata, Y.; Nakayama, H.; Yoshinaga, M.; Kumagai, T.; Nakatani, M. Development of cleaved amplified polymorphic sequence (CAPS)-based markers for identification of sweetpotato cultivars. Sci. Hortic. 2010, 123, 436–442. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, W.; Xu, L.; Wang, Y.; Chen, Y.; Luo, X.; Tang, M.; Liu, L. Development of SNP markers based on transcriptome sequences and their application in germplasm identification in radish (Raphanus sativus L.). Mol. Breed. 2017, 37, 26. [Google Scholar] [CrossRef]
- Zhu, Y.; Wang, S.; Wei, W.; Xie, H.; Liu, K.; Zhang, C.; Wu, Z.; Jiang, H.; Cao, J.; Zhao, L.; et al. Genome-wide association study of pre-harvest sprouting tolerance using a 90K SNP array in common wheat (Triticum aestivum L.). Theor. Appl. Genet. 2019, 132, 2947–2963. [Google Scholar] [CrossRef] [PubMed]
- Han, H.; Oh, Y.; Kim, K.; Oh, S.; Cho, S.; Kim, Y.K.; Kim, D. Integrated genetic linkage maps for Korean pears (Pyrus hybrid) using GBS-based SNPs and SSRs. Hortic. Environ. Biotechnol. 2019, 60, 779–786. [Google Scholar] [CrossRef]
- Kim, Y.; Oh, S.; Kim, K.; Jeong, H.W.; Kim, D. Bi-dimensional image analysis for the phenotypic evaluation of russet in Asian pear (Pyrus spp.). Hortic. Sci. Technol. 2022, 40, 192–198. [Google Scholar] [CrossRef]
- Elshire, R.J.; Glaubitz, J.C.; Sun, Q.; Poland, J.A.; Kawamoto, K.; Buckler, E.S.; Mitchell, S.E. A robust, simple genotyping-by-sequencing (GBS) approach for high density species. PLoS ONE 2011, 6, e19379. [Google Scholar] [CrossRef] [Green Version]
- Voorrips, R.E.; Gort, G.; Vosman, B. Genotype calling in tetraploid species from bi-allelic marker date using mixture models. BMC Bioinform. 2011, 12, 172. [Google Scholar] [CrossRef] [Green Version]
- Thomson, M.J. High-throughput SNP genotyping to accelerate crop improvement. Plant Breed. Biotechnol. 2014, 2, 195–212. [Google Scholar] [CrossRef]
- Gaur, R.; Azam, S.; Jeena, G.; Khan, A.W.; Choudhary, S.; Jain, M.; Yadav, G.; Tyagi, A.K.; Chattopadhyay, D.; Bhatia, S. High-throughput SNP discovery and genotyping for constructing a saturated linkage map of chickpea (Cicer arietinum L.). DNA Res. 2012, 19, 357–373. [Google Scholar] [CrossRef]
- Zhou, M.X. Accurate phenotyping reveals better QTL for waterlogging tolerance in barley. Plant Breed. 2011, 130, 203–208. [Google Scholar] [CrossRef]
- Wu, J.; Wang, Z.; Shi, Z.; Zhang, S.; Ming, R.; Zhu, S.; Khan, M.A.; Tao, S.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef]
- Xue, H.; Wang, S.; Yao, J.L.; Deng, C.H.; Wang, L.; Su, Y.; Zhang, H.; Zhou, H.; Sun, M.; Li, X.; et al. Chromosome level high-density integrated genetic maps improve the Pyrus bretschneideri ‘DangshanSuli’v1. 0 genome. BMC Genom. 2018, 19, 833. [Google Scholar] [CrossRef] [PubMed]
- Kikuchi, A. On the origin of Japanese pears and the inheritance of the skin colours of their fruits. J. Genet. 1924, 3, 1–27. [Google Scholar] [CrossRef] [Green Version]
- Montanari, S.; Bianco, L.; Allen, B.J.; Martínez-García, P.J.; Bassil, N.V.; Postman, J.; Knäbel, M.; Kitson, B.; Deng, C.H.; Chagné, D.; et al. Development of a highly efficient Axiom™ 70 K SNP array for Pyrus and evaluation for high-density mapping and germplasm characterization. BMC Genom. 2019, 20, 331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, W.; Wang, C.; Tian, Y.; Tian, W.; Yin, H. SSR molecular markers linked to the fruit russet skin of pear. Acta Hortic. Sin. 2010, 37, 1325–1328. [Google Scholar]
- Vincze, T.; Posfai, J.; Roberts, R.J. NEBcutter: A program to cleave DNA with restriction enzymes. Nucleic Acids Res. 2003, 31, 3688–3691. [Google Scholar] [CrossRef]
Linkage Group | No. of Array SNPs | No. of GBS-SNPs | No. of SSRs | No. of Total Markers | Genetic Distance (cM) | Average Interval between Markers (cM) | Linkage Group Coverage (%) |
---|---|---|---|---|---|---|---|
1 | 56 | 15 | 0 | 71 | 96.59 | 1.36 | 87.72 |
2 | 44 | 29 | 2 | 75 | 121.50 | 1.62 | 87.08 |
3 | 104 | 8 | 0 | 112 | 104.06 | 0.92 | 92.68 |
4 | 59 | 9 | 0 | 68 | 105.34 | 1.54 | 95.95 |
5 | 27 | 25 | 1 | 53 | 101.50 | 1.91 | 98.41 |
6 | 51 | 9 | 0 | 60 | 67.01 | 1.11 | 59.05 |
7 | 17 | 52 | 0 | 69 | 122.28 | 1.77 | 82.36 |
8 | 48 | 14 | 1 | 63 | 138.07 | 2.19 | 88.68 |
9 | 107 | 35 | 0 | 142 | 177.97 | 1.25 | 90.30 |
10 | 71 | 8 | 0 | 79 | 122.79 | 1.55 | 92.19 |
11 | 91 | 16 | 1 | 108 | 116.80 | 1.08 | 99.60 |
12 | 37 | 28 | 0 | 65 | 98.06 | 1.50 | 66.97 |
13 | 64 | 24 | 0 | 88 | 115.23 | 1.30 | 73.41 |
14 | 49 | 18 | 0 | 67 | 100.47 | 1.49 | 86.56 |
15 | 66 | 21 | 1 | 88 | 141.63 | 1.60 | 90.07 |
16 | 26 | 28 | 1 | 55 | 164.72 | 2.99 | 94.14 |
17 | 59 | 16 | 0 | 75 | 109.11 | 1.45 | 90.51 |
Total | 976 | 355 | 7 | 1263 | 1894.02 | ||
Avg. | 78 | 1.48 | 86.80 |
Name | Map Position (cM) | SNP ID | Restriction Enzyme | Primer Sequences (5′−3′) | Expected Size (bp) | SNP |
---|---|---|---|---|---|---|
CBp08ca01 | 94.086 | AX-172418048 | RsaI | F: GATGTGCGTGGAGATGATGT | 398 or 134/264 | A/G |
R: AAATGTGTGTCCTCCGATCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.; Oh, S.; Han, H.; Kim, D. QTL Analysis and CAPS Marker Development Linked with Russet in Pear (Pyrus spp.). Plants 2022, 11, 3196. https://doi.org/10.3390/plants11233196
Kim Y, Oh S, Han H, Kim D. QTL Analysis and CAPS Marker Development Linked with Russet in Pear (Pyrus spp.). Plants. 2022; 11(23):3196. https://doi.org/10.3390/plants11233196
Chicago/Turabian StyleKim, Yumi, Sewon Oh, Hyeondae Han, and Daeil Kim. 2022. "QTL Analysis and CAPS Marker Development Linked with Russet in Pear (Pyrus spp.)" Plants 11, no. 23: 3196. https://doi.org/10.3390/plants11233196
APA StyleKim, Y., Oh, S., Han, H., & Kim, D. (2022). QTL Analysis and CAPS Marker Development Linked with Russet in Pear (Pyrus spp.). Plants, 11(23), 3196. https://doi.org/10.3390/plants11233196