Effect of Salt Stress on Growth and Physiological Properties of Asparagus Seedlings
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Treatments
2.2. Measurement of Plant Height and Biomass
2.3. Determination of Na+, K+ and K+/ Na+
2.4. Antioxidant Enzymesactivity and MDA Content
2.5. Determination of Proline, Soluble Sugar and Soluble Protein
2.6. RNA Isolation and Quantitativert-PCR
2.7. Statistical Analysis
3. Results
3.1. Seedling Growth
3.2. Content of K+ and Na+
3.3. Antioxidant Enzymes Assay
3.4. MDA Content
3.5. The Content of Osmolytes
3.6. Gene Expression Analysis Using qRT-PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Zelm, E.; Zhang, Y.; Testerink, C. Salt Tolerance Mechanisms of Plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, F.; Leng, B.; Wang, B. Progress in Studying Salt Secretion from the Salt Glands in Recretohalophytes: How Do Plants Secrete Salt? Front. Plant Sci. 2016, 7, 997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rengasamy, P. World salinization with emphasis on Australia. J. Exp. Bot. 2006, 57, 1017–1023. [Google Scholar] [CrossRef] [Green Version]
- Vinocur, B.; Ahman, A. Recent advances in engineering plant tolerance to abiotic stress: Achievements and limitations. Curr. Opin. Biotechnol. 2005, 16, 123–132. [Google Scholar] [CrossRef]
- Emanuel, E.; Jack, D.N.; Dale, W.R.; Ralph, W.K.; David, B.K.; Glen, A.C.; Anne, F.W. Saline culture of crops: A genetic approach. Science 1980, 210, 399–404. [Google Scholar]
- Kamran, M.; Xie, K.; Sun, J.; Wang, D.; Shi, C.; Lu, Y.; Gu, W.; Xu, P. Modulation of growth performance and coordinated induction of ascorbate-glutathione and methylglyoxal detoxification systems by salicylic acid mitigates salt toxicity in choysum (Brassica parachinensis L.). Ecotoxicol. Environ. Saf. 2020, 188, 109877. [Google Scholar] [CrossRef]
- Beacham, A.M.; Hand, P.; Pink, D.A.; Monaghan, J.M. Analysis of Brassica oleracea early stage abiotic stress responses reveals tolerance in multiple crop types and for multiple sources of stress. J. Sci. Food Agric. 2017, 97, 5271–5277. [Google Scholar] [CrossRef] [PubMed]
- Verslues, P.E.; Agarwal, M.; Katiyar-Agarwal, S.; Zhu, J.; Zhu, J.-K. Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant J. 2006, 45, 523–539. [Google Scholar] [CrossRef]
- Chen, F.; Fang, P.; Peng, Y.; Zeng, W.; Zhao, X.; Ding, Y.; Zhuang, Z.; Gao, Q.; Ren, B. Comparative Proteomics of Salt-Tolerant and Salt-Sensitive Maize Inbred Lines to Reveal the Molecular Mechanism of Salt Tolerance. Int. J. Mol. Sci. 2019, 20, 4725. [Google Scholar] [CrossRef] [Green Version]
- Sergio, C.; Laura, D.; Luna, M.J.; Manuel, L.J.; Lynne, Y.; José, M.M. Identification of distinctive physiological and molecular responses to salt stress among tolerant and sensitive cultivars of broccoli (Brassica oleracea var. Italica). BMC Plant Biol. 2021, 21, 488. [Google Scholar]
- Ashraf, M.; Foolad, M.R. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Verbruggen, N.; Hermans, C. Proline accumulation in plants: A review. Amino Acids 2008, 35, 753–759. [Google Scholar] [CrossRef]
- Huang, C.; Wei, G.; Jie, Y.; Wang, L.; Zhou, H.; Ran, C.; Huang, Z.; Jia, H.; Anjum, S.A. Effects of concentrations of sodium chloride on photosynthesis, antioxidative enzymes, growth and fiber yield of hybrid ramie. Plant Physiol. Biochem. 2014, 76, 86–93. [Google Scholar] [CrossRef]
- Mickelbart, M.V.; Hasegawa, P.M.; Bailey-Serres, J. Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. Rev. Genet. 2015, 16, 237–251. [Google Scholar] [CrossRef] [PubMed]
- Abideen, Z.; Koyro, H.-W.; Huchzermeyer, B.; Ahmed, M.Z.; Gul, B.; Khan, M.A. Moderate salinity stimulates growth and photosynthesis of Phragmites karka by water relations and tissue specific ion regulation. Environ. Exp. Bot. 2014, 105, 70–76. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Hamamoto, S.; Uozumi, N. Sodium transport system in plant cells. Front. Plant Sci. 2013, 4, 410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmadi, J.; Hossein, F.M. Identification and mapping of quantitative trait loci associated with salinity tolerance in rice (Oryza Sativa) using SSR markers. Iran J. Biotechnol. 2011, 9, 21–30. [Google Scholar]
- Chakraborty, K.; Bhaduri, D.; Meena, H.N.; Kalariya, K. External potassium (K+) application improves salinity tolerance by promoting Na+-exclusion, K+-accumulation and osmotic adjustment in contrasting peanut cultivars. Plant Physiol. Biochem. 2016, 103, 143–153. [Google Scholar] [CrossRef]
- Ozgur, R.; Uzilday, B.; Sekmen, A.H.; Turkan, I. Reactive oxygen species regulation and antioxidant defence in halophytes. Funct. Plant Biol. 2013, 40, 832–847. [Google Scholar] [CrossRef]
- Choudhury, S.; Panda, P.; Sahoo, L.; Panda, S.K. Reactive oxygen species signaling in plants under abiotic stress. Plant Signal. Behav. 2013, 8, 23681. [Google Scholar] [CrossRef] [Green Version]
- Jaleel, C.A.; Riadh, K.; Gopi, R.; Manivannan, P.; Inès, J.; Al-Juburi, H.J.; Chang-Xing, Z.; Hong-Bo, S.; Panneerselvam, R. Antioxidant defense responses: Physiological plasticity in higher plants under abiotic constraints. Acta Physiol. Plant. 2009, 31, 427–436. [Google Scholar] [CrossRef]
- Ahmed, I.M.; Dai, H.; Zheng, W.; Cao, F.; Zhang, G.; Sun, D.; Wu, F. Genotypic differences in physiological characteristics in the tolerance to drought and salinity combined stress between Tibetan wild and cultivated barley. Plant Physiol. Biochem. 2013, 63, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.-M.; Xiao, X.-R.; Yang, M.-Y.; Gao, Z.-L.; Zang, J.; Fu, X.-M.; Chen, Y.-H. Effects of salt stress on antioxidant defense system in the root of Kandelia candel. Bot. Stud. 2014, 55, 57. [Google Scholar] [CrossRef] [PubMed]
- Martínez, J.P.; Fuentes, R.; Farías, K.; Lizana, C.; Alfaro, J.F.; Fuentes, L.; Calabrese, N.; Bigot, S.; Quinet, M.; Lutts, S. Effects of salt stress on fruit antioxidant capacity of wild (Solanum chilense) and domesticated (Solanumly copersicum var. cerasiforme) tomatoes. Agronomy 2020, 10, 1481. [Google Scholar] [CrossRef]
- El-Esawi, M.A.; Elansary, H.O.; El-Shanhorey, N.A.; Abdel-Hamid, A.; Ali, H.M.; Elshikh, M.S. Salicylic Acid-Regulated Antioxidant Mechanisms and Gene Expression Enhance Rosemary Performance under Saline Conditions. Front. Physiol. 2017, 8, 716. [Google Scholar] [CrossRef]
- Li, N.; Cao, B.; Chen, Z.; Xu, K. Root morphology ion absorption and antioxidative defense system of two Chinese cabbage cultivars (Brassica rapa L.) reveal the different adaptation mechanisms to salt and alkali stress. Protoplasma 2021, 259, 385–398. [Google Scholar] [CrossRef]
- Döll, S.; Farahani-Kofoet, R.D.; Zrenner, R.; Henze, A.; Witzel, K. Tissue-specific signatures of metabolites and proteins in asparagus roots and exudates. Hortic. Res. 2021, 8, 86. [Google Scholar] [CrossRef]
- Soteriou, G.A.; Antoniou, C.; Rouphael, Y.; Kyratzis, A.C.; Kyriacou, M.C. Changes in the primary and secondary metabolome of male green asparagus (Asparagus officinalis L.) as modulated by sequential harvesting. Food Chem. 2021, 358, 129877. [Google Scholar] [CrossRef]
- Noperi-Mosqueda, L.C.; López-Moreno, F.J.; Navarro-León, E.; Sánchez, E.; Blasco, B.; Moreno, D.A.; Soriano, T.; Ruiz, J.M. Effects of asparagus decline on nutrients and phenolic compounds, spear quality, and allelopathy. Sci. Hortic. 2020, 261, 109029. [Google Scholar] [CrossRef]
- Reid, T.C.; Hausbeck, M.K.; Kizilkaya, K. Effects of Sodium Chloride on Commercial Asparagus and of Alternative Forms of Chloride Salt on Fusarium Crown and Root Rot. Plant Dis. 2001, 85, 1271–1275. [Google Scholar] [CrossRef] [Green Version]
- Van Kruistum, G.; Poll, J.-T.; Meijer, J.; Lievens, M. Effect of NaCl on Asparagus Quality, Production and Mineral Leaching. Acta Hortic. 2008, 776, 87–90. [Google Scholar] [CrossRef]
- Zhang, X.; Han, C.; Cao, Y. Transcriptomic and Physiological Analyses Reveal the Dynamic Response to Salinity Stress of the Garden Asparagus (Asparagus officinalis L.). Plant Mol. Biol. Rep. 2020, 38, 613–627. [Google Scholar] [CrossRef]
- Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases: I. Occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Nickel, K.S.; Cunningham, B. Improved peroxidase assay method using leuco 2,3′,6-trichloroindophenol and application to comparative measurements of peroxidatic catalysis. Anal. Biochem. 1969, 27, 292–299. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. Metho Enzym. 1984, 105, 121–126. [Google Scholar]
- Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Miller, G.L. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analy Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Lee, D.H.; Kim, Y.S.; Lee, C.B. The inductive responses of the antioxidant enzymes by salt stress in the rice (Oryza sativa L.). J. Plant Physiol. 2001, 158, 737–745. [Google Scholar] [CrossRef]
- Dionisio-Sese, M.L.; Tobita, S. Antioxidant responses of rice seedlings to salinity stress. Plant Sci. 1998, 135, 1–9. [Google Scholar] [CrossRef]
- Aghaei, K.; Ehsanpour, A.A.; Komatsu, S. Potato Responds to Salt Stress by Increased Activity of Antioxidant Enzymes. J. Integr. Plant Biol. 2009, 51, 1095–1103. [Google Scholar] [CrossRef] [PubMed]
- Mäser, P.; Gierth, M.; Schroeder, J.I. Molecular mechanisms of potassium and sodium uptake in plants. Plant Soil 2002, 247, 43–54. [Google Scholar] [CrossRef]
- Kaya, C.; Higgs, D.; Ashraf, M.; Alyemeni, M.N.; Ahmad, P. Integrative roles of nitric oxide and hydrogen sulfide in melatonin-induced tolerance of pepper (Capsicum annuum L.) plants to iron deficiency and salt stress alone or in combination. Physio Planta. 2020, 168, 256–277. [Google Scholar] [CrossRef]
- Dugasa, M.T.; Cao, F.B.; Ibrahim, W.; Wu, F.B. Genotypic difference in physiological and biochemical characteristics in response to single and combined stresses of drought and salinity between the two wheat genotypes (Triticum aestivum) differing in salt tolerance. Physio. Planta. 2019, 165, 134–143. Available online: https://onlinelibrary.wiley.com/doi/abs/10.1111/ppl.12743 (accessed on 1 September 2022). [CrossRef]
- Kibria, M.G.; Hossain, M.; Murata, Y.; Hoque, M.A. Antioxidant Defense Mechanisms of Salinity Tolerance in Rice Genotypes. Rice Sci. 2017, 24, 155–162. [Google Scholar] [CrossRef]
- Farooq, M.; Ahmad, R.; Shahzad, M.; Sajjad, Y.; Hassan, A.; Shah, M.M.; Naz, S.; Khan, S.A. Differential variations in total flavonoid content and antioxidant enzymes activities in pea under different salt and drought stresses. Sci. Hortic. 2021, 287, 110258. [Google Scholar] [CrossRef]
- Wang, J.Z.; Jin, C.; Wang, Y.P.; Chen, B.Q. Effects of salt stress on antioxidant system activity and peroxidation damage in root tip cells of strawberry. Afr. J. Biotec. 2019, 18, 702–706. [Google Scholar]
- Rubio, M.C.; Bustos-Sanmamed, P.; Clemente, M.R.; Becana, M. Effects of salt stress on the expression of antioxidant genes and proteins in the model legume Lotus japonicus. New Phytol. 2009, 181, 851–859. [Google Scholar] [CrossRef] [Green Version]
- Negi, N.P.; Shrivastava, D.C.; Sharma, V.; Sarin, N.B. Overexpressionof CuZnSOD from Arachis hypogaea alleviates salinity and drought stress in tobacco. Plant Cell Rep. 2015, 34, 1109–1126. [Google Scholar] [CrossRef]
- Hannachi, S.; Van Labeke, M.-C. Salt stress affects germination, seedling growth and physiological responses differentially in eggplant cultivars (Solanum melongena L.). Sci. Hortic. 2018, 228, 56–65. [Google Scholar] [CrossRef]
- Kim, J.; Liu, Y.; Zhang, X.; Zhao, B.; Childs, K.L. Analysis of salt-induced physiological and proline changes in 46 switchgrass (Panicum virgatum) lines indicates multiple response modes. Plant Physiol. Biochem. 2016, 105, 203–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, C.C.; Kao, C.H. Proline accumulation is associated with inhibition of rice seedling root growth caused by NaCl. Plant Sci. 1996, 114, 121–128. [Google Scholar] [CrossRef]
- Demiral, T.; Turkan, I. Comparative lipid peroxidation, antioxidant defense systems and proline content in roots of two rice cultivars differing in salt tolerance. Environ. Exp. Bot. 2005, 53, 247–257. [Google Scholar] [CrossRef]
- Nounjan, N.; Chansongkrow, P.; Charoensawan, V.; Siangliw, J.L.; Toojinda, T.; Chadchawan, S.; Theerakulpisut, P. High Performance of Photosynthesis and Osmotic Adjustment Are Associated with Salt Tolerance Ability in Rice Carrying Drought Tolerance QTL: Physiological and Co-expression Network Analysis. Front. Plant Sci. 2018, 9, 1135. [Google Scholar] [CrossRef]
- Khan, H.A.; Siddique, K.H.; Munir, R.; Colmer, T.D. Salt sensitivity in chickpea: Growth, photosynthesis, seed yield components and tissue ion regulation in contrasting genotypes. J. Plant Physiol. 2015, 182, 1–12. [Google Scholar] [CrossRef]
- Doganlar, Z.B.; Demir, K.; Basak, H.; Gul, I. Effects of salt stress on pigment and total soluble protein contents of three different tomato cultivars. Afr. J. Agric. Res. 2010, 5, 2056–2065. [Google Scholar]
Gene Name | Gene ID | Primer Name | Primer Sequence(5’-3’) |
---|---|---|---|
ubiquitin-40Sribosomal protein S27a | LOC109820108 | LOC109820108-F | CAATGTCAAGGCCAAGATCC |
LOC109820108-R | CTTCTGGATGTTGTAGTCGG | ||
Superoxidedismutase [Cu-Zn] | LOC109836512 | LOC109836512-F | CATCATCAGACCTTGAGCAG |
LOC109836512-R | AGGAGGAGAAATTAGGGTTAGG | ||
peroxidase 12-like | LOC109839605 | LOC109839605-F | CTCTCCTCTCATCATCTACAC |
LOC109839605-R | CTCTCCTCTCATCATCTACAC | ||
catalase isozyme 1-like | LOC109837240 | LOC109837240-F | TCACTCACGATGTTTCTCAC |
LOC109837240-R | TCAATGTTTCAGGACTCCCA |
Cultivars | Treatment | Plant Height(cm) | Root Dry Weight Per Plant (g) | Biomass Per Plant (g) |
---|---|---|---|---|
Apollo | CK | 31.84 ± 2.54 a | 0.17 ± 0.01 a | 0.32 ± 0.01 a |
Stress | 25.40 ± 2.52 b | 0.18 ± 0.02 a | 0.31 ±0.02 a | |
Relative value | 80% | 106% | 96% | |
JL1 | CK | 30.82 ± 2.33 a | 0.08 ± 0.01 a | 0.20 ± 0.03 a |
Stress | 17.02 ± 0.86 b | 0.07 ± 0.02 a | 0.14 ± 0.02 b | |
Relative value | 55% | 79% | 71% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, X.; Ahmad, N.; Zhao, S.; Zhao, C.; Zhong, W.; Wang, X.; Li, G. Effect of Salt Stress on Growth and Physiological Properties of Asparagus Seedlings. Plants 2022, 11, 2836. https://doi.org/10.3390/plants11212836
Guo X, Ahmad N, Zhao S, Zhao C, Zhong W, Wang X, Li G. Effect of Salt Stress on Growth and Physiological Properties of Asparagus Seedlings. Plants. 2022; 11(21):2836. https://doi.org/10.3390/plants11212836
Chicago/Turabian StyleGuo, Xin, Naveed Ahmad, Shuzhen Zhao, Chuanzhi Zhao, Wen Zhong, Xingjun Wang, and Guanghui Li. 2022. "Effect of Salt Stress on Growth and Physiological Properties of Asparagus Seedlings" Plants 11, no. 21: 2836. https://doi.org/10.3390/plants11212836
APA StyleGuo, X., Ahmad, N., Zhao, S., Zhao, C., Zhong, W., Wang, X., & Li, G. (2022). Effect of Salt Stress on Growth and Physiological Properties of Asparagus Seedlings. Plants, 11(21), 2836. https://doi.org/10.3390/plants11212836