Yield, Fruit Quality, and Storability of ‘Canino’ Apricot in Response to Aminoethoxyvinylglycine, Salicylic Acid, and Chitosan
Abstract
:1. Introduction
2. Results and Discussion
2.1. Preharvest Fruit Drop and Total Yield
2.2. Weight Loss and Fruit Firmness
2.3. Decay Incidence
2.4. Fruit Color and Total Carotenoids
2.5. Soluble Solid Content, Total Acidity, and Ripening Index
2.6. Sensory Analysis
2.7. Lipid Peroxidation
2.8. PaACS1 Gene Expression
3. Materials and Methods
3.1. Experiment
3.2. Studied Parameters
- PaACS1(f) 5′–ATTCAACCAGGCAAAGAAACGC–3′,
- PaACS1(r) 5′–GATGGAGTGGAAATGGACGAGA–3′,
- Pa26sRIB(f) 5′–AACGCAGGTGTCCTAAGATGAG–3′,
- Pa26sRIB(r) 5′–GCTGCCACAAGCCAGTTATCC–3′.
3.3. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hallmann, E.; Rozpara, E.; Słowianek, M.; Leszczyńska, J. The effect of organic and conventional farm management on the allergenic potency and bioactive compounds status of apricots (Prunus armeniaca L.). Food Chem. 2019, 279, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Deng, J.L.; Tian, Y. Transcriptome sequencing of the apricot (Prunus armeniaca L.) and identification of differentially expressed genes involved in drought stress. Phytochemistry 2020, 171, 112226. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations (FAO). FAO Statistics; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2019; Available online: http://www.fao.org/faostat/en/#data/QC/visualize (accessed on 2 August 2021).
- Taze, B.H.; Unluturk, S. Effect of postharvest UV-C treatment on the microbial quality of ‘Şalak’ apricot. Sci. Hortic. 2018, 233, 370–377. [Google Scholar] [CrossRef]
- Okba, S.K.; Mazrou, Y.; Elmenofy, H.M.; Ezzat, A.; Salama, A. New insights of Potassium Sources Impacts as Foliar Applica-tion on “Canino” Apricot Fruit Yield, Fruit Anatomy, Quality and Storability. Plants 2021, 10, 1163. [Google Scholar] [CrossRef]
- Nourozi, F.; Sayyari, M. Enrichment of Aloe vera gel with basil seed mucilage preserve bioactive compounds and postharvest quality of apricot fruits. Sci. Hortic. 2020, 262, 109041. [Google Scholar] [CrossRef]
- Bravin, E.; Kilchenmann, A.; Leumann, M. Six hypotheses for profitable apple production based on the economic work-package within the ISAFRUIT Project. J. Hortic. Sci. Biotechnol. 2009, 84, 164–167. [Google Scholar] [CrossRef]
- Fan, X.; Shu, C.; Zhao, K.; Wang, X.; Cao, J.; Jiang, W. Regulation of apricot ripening and softening process during shelf life by post-storage treatments of exogenous ethylene and 1-methylcyclopropene. Sci. Hortic. 2018, 232, 63–70. [Google Scholar] [CrossRef]
- He, Y.; Xue, J.; Li, H.; Han, S.; Jiao, J.; Rao, J. Ethylene response factors regulate ethylene biosynthesis and cell wall modification in persimmon (Diospyros kaki L.) fruit during ripening. Postharvest Biol. Technol. 2020, 168, 111255. [Google Scholar] [CrossRef]
- Kou, J.; Zhao, Z.; Zhang, Q.; Wei, C.; Ference, C.M.; Guan, J.; Wang, W. Comparative transcriptome analysis reveals the mechanism involving ethylene and cell wall modification related genes in Diospyros kaki fruit firmness during ripening. Genomics 2021, 113, 552–563. [Google Scholar] [CrossRef] [PubMed]
- Devlieghere, F.; Jacxsens, L.; Serna Tatay, M.; Debevere, J.; Meirlaen, J.; Vanrolleghem, P. Modelling the relation between ethylene production rate, respiration rate and their influence on climacteric and non-climacteric fruits. Acta Hortic. 2003, 600, 647–651. [Google Scholar] [CrossRef]
- Ozkan, Y.; Ozturk, B.; Yildiz, K. Effects of aminoethoxyvinylglycine and naphthaleneacetic acid on ethylene biosynthesis, pre-harvest fruit drop and fruit quality of apple. Pakistan J. Agric. Sci. 2016, 53, 893–900. [Google Scholar] [CrossRef]
- Yildiz, K.; Kilic, K.; Ozkan, Y.; Ozturk, B.; Kucuker, E. The role of Pre-harvest Aminoethoxyvinylglycine (AVG) Treatments on Total Phenolics, Antioxidant Capacity and Fruit Quality Attributes of Sweet Cherry Cultivars. Erwerbs-Obstbau 2018, 60, 221–230. [Google Scholar] [CrossRef]
- Lin, Z.; Zhong, S.; Grierson, D. Recent advances in ethylene research. J. Exp. Bot. 2009, 60, 3311–3336. [Google Scholar] [CrossRef] [Green Version]
- Yamagami, T.; Tsuchisaka, A.; Yamada, K.; Haddon, W.F.; Harden, L.A.; Theologis, A. Biochemical diversity among the 1-aminocyclopropane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene family. J. Biol. Chem. 2003, 278, 49102–49111. [Google Scholar] [CrossRef] [Green Version]
- El-Sharkawy, I.; Kim, W.S.; Jayasankar, S.; Svircev, A.M.; Brown, D.C.W. Differential regulation of four members of the ACC synthase gene family in plum. J. Exp. Bot. 2008, 59, 2009–2027. [Google Scholar] [CrossRef] [Green Version]
- Munoz-Roberdo, P.; Rubio, P.; Infante, R.; Campos-Vargas, R.; Manriquez, D.; Gonzalez-Aguero, M.; Defillipi, B.G. Ethylene biosynthesis in apricot: Identification of ripening-related 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene. Postharvest Biol. Technol. 2012, 63, 85–90. [Google Scholar] [CrossRef]
- Tarantino, A.; Lops, F.; Disciglio, G.; Lopriore, G. Effects of plant biostimulants on fruit set, growth, yield and fruit quality attributes of ‘Orange rubis®’ apricot (Prunus armeniaca L.) cultivar in two consecutive years. Sci. Hortic. 2018, 239, 26–34. [Google Scholar] [CrossRef]
- Huo, K.; Shui, L.; Mai, Y.; Zhou, N.; Liu, Y.; Zhang, C.; Niu, J. Effects of exogenous abscisic acid on oil content, fatty acid composition, biodiesel properties and lipid components in developing Siberian apricot (Prunus sibirica) seeds. Plant Physiol. Biochem. 2020, 154, 260–267. [Google Scholar] [CrossRef]
- Cui, K.; Shu, C.; Zhao, H.; Fan, X.; Cao, J.; Jiang, W. Preharvest chitosan oligochitosan and salicylic acid treatments enhance phenol metabolism and maintain the postharvest quality of apricots (Prunus armeniaca L.). Sci. Hortic. 2020, 267, 109334. [Google Scholar] [CrossRef]
- Batur, S.; Çetinbaş, M. Pre-harvest Application of ReTain (Aminoethoxyvinylglycine, AVG) Influences Pre-harvest Drop and Fruit Quality of ‘Williams’ Pears. Tarım Bilim. Derg. 2017, 90, 344–356. [Google Scholar] [CrossRef]
- Doerflinger, F.C.; Nock, J.F.; Miller, W.B.; Watkins, C.B. Preharvest aminoethoxyvinylglycine (AVG) and 1-methylcyclopropene (1-MCP) effects on ethylene and starch concentrations of ‘Empire’ and ‘McIntosh’ apples. Sci. Hortic. 2019, 244, 134–140. [Google Scholar] [CrossRef]
- Gerailoo, S.; Ghasemnezhad, M. Effect of Salicylic Acid on Antioxidant Enzyme and Petal Senescence in ‘Yellow Island’ Cut Rose Flowers. J. Fruit Ornam. Plant Res. 2011, 19, 183–193. [Google Scholar]
- Zhang, H.; Ma, Z.; Wang, J.; Wang, P.; Lu, D.; Deng, S.; Lei, H.; Gao, Y.; Tao, Y. Treatment with exogenous salicylic acid maintains quality, increases bioactive compounds, and enhances the antioxidant capacity of fresh goji (Lycium barbarum L.) fruit during storage. LWT 2021, 140, 110837. [Google Scholar] [CrossRef]
- Tezotto-Uliana, J.V.; Fargoni, G.P.; Geerdink, G.M.; Kluge, R.A. Chitosan applications pre- or postharvest prolong raspberry shelf-life quality. Postharvest Biol. Technol. 2014, 91, 72–77. [Google Scholar] [CrossRef]
- Peian, Z.; Haifeng, J.; Peijie, G.; Sadeghnezhad, E.; Qianqian, P.; Tianyu, D.; Teng, L.; Huanchun, J.; Jinggui, F. Chitosan induces jasmonic acid production leading to resistance of ripened fruit against Botrytis cinerea infection. Food Chem. 2021, 337, 127772. [Google Scholar] [CrossRef]
- Iqbal, S.; Ni, X.; Bilal, M.S.; Shi, T.; Khalil-ur-Rehman, M.; Zhenpeng, P.; Jie, G.; Usman, M.; Gao, Z. Identification and expression profiling of sugar transporter genes during sugar accumulation at different stages of fruit development in apricot. Gene 2020, 742, 144584. [Google Scholar] [CrossRef]
- García-Gómez, B.E.; Ruiz, D.; Salazar, J.A.; Rubio, M.; Martínez-García, P.J.; Martínez-Gómez, P. Analysis of Metabolites and Gene Expression Changes Relative to Apricot (Prunus armeniaca L.) Fruit Quality during Development and Ripening. Front. Plant Sci. 2020, 11, 1269. [Google Scholar] [CrossRef]
- Salazar, J.; Zapata, P.; Silva, C.; González, M.; Pacheco, I.; Bastías, M.; Meneses, C.; Jorquera, C.; Moreno, I.; Shinya, P.; et al. Transcriptome analysis and postharvest behavior of the kiwifruit ‘Actinidia deliciosa’ reveal the role of ethylene-related phytohormones during fruit ripening. Tree Genet. Genomes 2021, 17, 1–19. [Google Scholar] [CrossRef]
- Yang, R.; Lin, X.; Dou, Y.; Zhang, W.; Du, H.; Wan, C.; Chen, J.; Zhang, L.; Zhu, L. Transcriptome profiling of postharvest kiwifruit in response to exogenous nitric oxide. Sci. Hortic. 2021, 277, 109788. [Google Scholar] [CrossRef]
- Chen, J.; Chen, T.; Qiu, M.; Li, L.; Zhong, Q.; Wei, Q.; Deng, Y.; Xie, B.; Jiang, Y.; Chen, B. Identification of ACC synthetase genes in Volvariella volvacea and analysis of their response to ethephon and 1-methylcyclopropene treatments. Sci. Hortic. 2021, 278, 109848. [Google Scholar] [CrossRef]
- Yumbya, P.; Ambuko, J.; Hutchinson, M.; Owino, W.; Juma, J.; Machuka, E.; Mutuku, J.M. Transcriptome analysis to elucidate hexanal’s mode of action in preserving the post-harvest shelf life and quality of banana fruits (Musa acuminata). J. Agric. Food Res. 2021, 3, 100114. [Google Scholar] [CrossRef]
- García-Gómez, B.E.; Salazar, J.A.; Nicolás-Almansa, M.; Razi, M.; Rubio, M.; Ruiz, D.; Martínez-Gómez, P. Molecular Bases of Fruit Quality in Prunus Species: An Integrated Genomic, Transcriptomic, and Metabolic Review with a Breeding Perspective. Int. J. Mol. Sci. 2021, 22, 333. [Google Scholar] [CrossRef]
- D’Aquino, S.; Schirra, M.; Molinu, M.G.; Tedde, M.; Palma, A. Preharvest aminoethoxyvinylglycine treatments reduce internal browning and prolong the shelf-life of early ripening pears. Sci. Hortic. 2010, 125, 353–360. [Google Scholar] [CrossRef]
- Radwa, F.S.; Attia, M.M.; Hassan, A.K.; Yehia, S.M. Effect of Postharvest Aminoethoxyvinylglycine, 1-Methylcyclopropene and Jasmonic Acid Treatments on Storability and Quality Maintenance of Apricot Fruit Cv. “Canino.” Alexandria J. Agric. Sci. 2019, 64, 11–20. [Google Scholar] [CrossRef] [Green Version]
- Hatem, R.M.K. Effect of some Preharvest Treatments on Fruit Drop, Quality and Shelf Life of “Anna” Apple Fruits. J. Plant Prod. 2019, 10, 681–688. [Google Scholar] [CrossRef]
- Muzzaffar, S.; Bhat, M.M.; Wani, T.A.; Wani, I.A.; Masoodi, F.A. Postharvest biology and technology of apricot. In Postharvest Biology and Technology of Temperate Fruits, 1st ed.; Mir, S., Shah, M., Mir, M., Eds.; Springer: Cham, Germany; Copenhagen University Hospital: Copenhagen, Denmark, 2018. [Google Scholar] [CrossRef]
- Pokotylo, I.; Kravets, V.; Ruelland, E. Salicylic acid binding proteins (SABPs): The hidden forefront of salicylic acid signalling. Int. J. Mol. Sci. 2019, 20, 4377. [Google Scholar] [CrossRef] [Green Version]
- Pérez-Llorca, M.; Muñoz, P.; Müller, M.; Munné-Bosch, S. Biosynthesis, metabolism and function of auxin, salicylic acid and melatonin in climacteric and non-climacteric fruits. Front. Plant Sci. 2019, 10, 00136. [Google Scholar] [CrossRef] [Green Version]
- Lokesh, G.; Madhumathi, C.; Rama Krishna, M.; Tanuja Priya, B.; Kadiri, L. Influence of preharvest application of salicylic acid and potassium silicate on postharvest quality of mango fruits (Mangifera indica L.) cv. Alphonso. Acta Sci. Agric. 2020, 4, 11–15. [Google Scholar] [CrossRef]
- Loake, G.; Grant, M. Salicylic acid in plant defence—The players and protagonists. Curr. Opin. Plant Biol. 2007, 10, 466–472. [Google Scholar] [CrossRef]
- Arif, Y.; Sami, F.; Siddiqui, H.; Bajguz, A.; Hayat, S. Salicylic acid in relation to other phytohormones in plant: A study towards physiology and signal transduction under challenging environment. Environ. Exp. Bot. 2020, 175, 104040. [Google Scholar] [CrossRef]
- Leslie, C.A.; Romani, R.J. Inhibition of ethylene biosynthesis by salicylic acid. Plant Physiol. 1988, 88, 833–837. [Google Scholar] [CrossRef] [Green Version]
- Da Rocha Neto, A.C.; Luiz, C.; Maraschin, M.; Di Piero, R.M. Efficacy of salicylic acid to reduce Penicillium expansum inoculum and preserve apple fruits. Int. J. Food Microbiol. 2016, 221, 54–60. [Google Scholar] [CrossRef]
- Serrano, M.; Giménez, M.J.; Martínez-Esplá, A.; Valverde, J.M.; Martinez-Romero, D.; Castillo, S.; Valero, D. Effects of preharvest salicylate treatments on quality and antioxidant compounds of plums. Acta Hortic. 2018, 1194, 121–126. [Google Scholar] [CrossRef]
- Martínez-Esplá, A.; Zapata, P.J.; Valero, D.; Martínez-Romero, D.; Díaz-Mula, H.M.; Serrano, M. Preharvest treatments with salicylates enhance nutrient and antioxidant compounds in plum at harvest and after storage. J. Sci. Food Agric. 2018, 98, 2742–2750. [Google Scholar] [CrossRef]
- Giménez, M.J.; Serrano, M.; Valverde, J.M.; Martínez-Romero, D.; Castillo, S.; Valero, D.; Guillén, F. Preharvest salicylic acid and acetylsalicylic acid treatments preserve quality and enhance antioxidant systems during postharvest storage of sweet cherry cultivars. J. Sci. Food Agric. 2017, 97, 1220–1228. [Google Scholar] [CrossRef] [PubMed]
- Mansour, A.H.A.; Elmenofy, H.M.; Salama, A.-M. Effect of Preharvest Application of Some Antioxidants on The Fruit Yield, Quality and Storability of “Manfalouty” Pomegranate Fruits (Punica granatum L.). Middle East J. Agric. Res. 2020, 9, 970–983. [Google Scholar] [CrossRef]
- Ezzat, A.; Ammar, A.; Szabó, Z.; Nyéki, J.; Holb, I.J. Postharvest Treatments with Methyl Jasmonate and Salicylic Acid for Maintaining Physico-Chemical Characteristics and Sensory Quality Properties of Apricot Fruit during Cold Storage and Shelf-Life. Pol. J. Food Nutr. Sci. 2017, 67, 159–166. [Google Scholar] [CrossRef]
- Ezzat, A.; Hegedűs, A.; Szabó, S.; Ammar, A.; Szabó, Z.; Nyéki, J.; Molnár, B.; Holb, I.J. Temporal changes and correlations between quality loss parameters, antioxidant properties and enzyme activities in apricot fruit treated with methyl jasmonate and salicylic acid during cold storage and shelf-life. Appl. Sci. 2020, 10, 71. [Google Scholar] [CrossRef]
- Batool, M.; Bashir, O.; Amin, T.; Wani, S.M.; Masoodi, F.A.; Jan, N.; Bhat, S.A.; Gul, A. Investigating the effect of oxalic acid and salicylic acid treatments on the post-harvest life of temperate grown apricot varieties (Prunus armeniaca) during controlled atmosphere storage. Food Sci. Technol. Int. 2021, 7. [Google Scholar] [CrossRef]
- Sharif, R.; Mujtaba, M.; Rahman, M.U.; Shalmani, A.; Ahmad, H.; Anwar, T.; Tianchan, D.; Wang, X. The multifunctional role of in horticultural crops; a review. Molecules 2018, 23, 872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gull, A.; Bhat, N.; Wani, S.M.; Masoodi, F.A.; Amin, T.; Ganai, S.A. Shelf life extension of apricot fruit by application of nanochitosan emulsion coatings containing pomegranate peel extract. Food Chem. 2021, 349, 129149. [Google Scholar] [CrossRef]
- Baswal, A.K.; Dhaliwal, H.S.; Singh, Z.; Mahajan, B.V.C.; Kalia, A.; Gill, K.S. Influence of carboxy methylcellulose, chitosan and beeswax coatings on cold storage life and quality of Kinnow mandarin fruit. Sci. Hortic. 2020, 260, 108887. [Google Scholar] [CrossRef]
- Cindi, M.D.; Shittu, T.; Sivakumar, D.; Bautista-Baños, S. Chitosan boehmite-alumina nanocomposite films and thyme oil vapour control brown rot in peaches (Prunus persica L.) during postharvest storage. Crop Prot. 2015, 72, 127–131. [Google Scholar] [CrossRef]
- Zhao, H.; Fan, Z.; Wu, J.; Zhu, S. Effects of pre-treatment with S-nitrosoglutathione-chitosan nanoparticles on quality and antioxidant systems of fresh-cut apple slices. LWT 2021, 139, 110565. [Google Scholar] [CrossRef]
- Munhuweyi, K.; Lennox, C.L.; Meitz-Hopkins, J.C.; Caleb, O.J.; Sigge, G.O.; Opara, U.L. Investigating the effects of crab shell chitosan on fungal mycelial growth and postharvest quality attributes of pomegranate whole fruit and arils. Sci. Hortic. 2017, 220, 78–89. [Google Scholar] [CrossRef]
- Elmenofy, H.M.; Mark, C. Effect of Natural Antimicrobial Substances with Packaging System on Improving Quality of ‘ETMANI’ Guava (Psidium guajava L.) Fruit during cold storage. J. Plant Prod. 2021, 12, 527–540. [Google Scholar] [CrossRef]
- Arseneault, M.H.; Cline, J.A. A review of apple preharvest fruit drop and practices for horticultural management. Sci. Hortic. 2016, 211, 40–52. [Google Scholar] [CrossRef]
- Souza, K.O.; Silveira, A.G.; Lopes, M.M.A.; Moura, C.F.H.; Silva, E.O.; Fernando Ayala-Zavala, J.; Soares, L.S.P.; Miranda, M.R.A. AVG and GA3 prevent preharvest fruit drop and enhance postharvest quality of “BRS 189” cashew. Sci. Hortic. 2019, 257, 108771. [Google Scholar] [CrossRef]
- Arseneault, M.H.; Cline, J.A. AVG, NAA, boron, and magnesium influence preharvest fruit drop and fruit quality of ‘Honeycrisp’ apples. Can. J. Plant Sci. 2017, 98, 741–752. [Google Scholar] [CrossRef]
- Gomes, E.P.; Vanz Borges, C.; Monteiro, G.C.; Filiol Belin, M.A.; Minatel, I.O.; Pimentel Junior, A.; Tecchio, M.A.; Lima, G.P.P. Preharvest salicylic acid treatments improve phenolic compounds and biogenic amines in ‘Niagara Rosada’ table grape. Postharvest Biol. Technol. 2021, 176, 111505. [Google Scholar] [CrossRef]
- Wu, P.; Xin, F.; Xu, H.; Chu, Y.; Du, Y.; Tian, H.; Zhu, B. Chitosan inhibits postharvest berry abscission of ‘Kyoho’ table grapes by affecting the structure of abscission zone, cell wall degrading enzymes and SO2 permeation. Postharvest Biol. Technol. 2021, 176, 111507. [Google Scholar] [CrossRef]
- Hou, Y.; Wu, F.; Zhao, Y.; Shi, L.; Zhu, X. Cloning and expression analysis of polygalacturonase and pectin methylesterase genes during softening in apricot (Prunus armeniaca L.) fruit. Sci. Hortic. 2019, 256, 108607. [Google Scholar] [CrossRef]
- Parven, A.; Sarker, M.R.; Megharaj, I.M. Meftaul, I. Prolonging the shelf life of Papaya (Carica papaya L.) using Aloe vera gel at ambient temperature. Sci. Hortic. 2020, 265, 109228. [Google Scholar] [CrossRef]
- Jongsri, P.; Wangsomboondee, T.; Rojsitthisak, P.; Seraypheap, K. Effect of molecular weights of chitosan coating on postharvest quality and physicochemical characteristics of mango fruit. LWT-Food Sci. Technol. 2016, 73, 28–36. [Google Scholar] [CrossRef]
- Coggins, C.W., Jr.; Scora, R.W.; Lewis, L.N.; Knapp, C.F. Gibberellin-delayed senescence and essential oil vhanges in the Navel orange rind. J. Agric. Food Vhem. 1969, 17, 807–809. [Google Scholar] [CrossRef]
- El-Otmani, M. Growth regulator improvement of postharvest quality. In Fresh Citrus Fruits; Wardowski, W.E., Miller, W.M., Hall, D.J., Grierson, W., Eds.; Florida Service Source Inc.: Longboat Key, FL, USA, 2006; pp. 67–104. [Google Scholar]
- Eckert, J.W.; Eaks, I.L. Postharvest disorders and diseases of citrus fruits. In The Citus Industry; Reuther, W., Calavan, E.C., Carman, G.E., Eds.; University of California, Division of Agriculture and Natural Resource: Oakland, CA, USA, 1989; pp. 179–260. [Google Scholar]
- Smilanick, J.L.; Brown, G.E.; Eckert, J.W. The biology and control of postharvest diseases. In Fresh Citrus Fruits; Wardowski, W.E., Miller, W.M., Hall, D.J., Grierson, W., Eds.; Florida Service Source Inc.: Longboat Key, FL, USA, 2006; pp. 353–355. [Google Scholar]
- De Vleesschauwer, D.; Seifi, H.S.; Filipe, O.; Haeck, A.; Huu, S.N.; Demeestere, K.; Höfte, M. The DELLA protein SLR1 integrates and amplifies salicylic acid- and jasmonic acid-dependent innate immunity in rice. Plant Physiol. 2016, 170, 1831–1847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmad, S.; Singh, Z.; Khan, A.S.; Iqbal, Z. Preharvest applications of salicylic acid maintain the rind textural properities and reduce fruit rot and chilling injury of sweet orange during cold storage. Pak. J. Agric. Sci. 2013, 50, 559–569. [Google Scholar]
- Shemy, M.A. El Effect of some essential oils, salts and salicylic acid on reducing decay, keeping quality and prolonging shelf-life of canino apricot fruits. Menoufia J. Plant Prod. 2020, 5, 111–128. [Google Scholar] [CrossRef]
- De Oliveira, C.E.V.; Magnani, M.; de Sales, C.V.; de Souza Pontes, A.L.; Campos-Takaki, G.M.; Stamford, T.C.M.; de Souza, E.L. Effects of chitosan from Cunninghamella elegans on virulence of post-harvest pathogenic fungi in table grapes (Vitis labrusca L.). Int. J. Food Microbiol. 2014, 171, 54–61. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.; Yang, L.; Yan, H.; Kennedy, J.F.; Meng, X. Chitosan and oligochitosan enhance the resistance of peach fruit to brown rot. Carbohydr. Polym. 2013, 94, 272–277. [Google Scholar] [CrossRef] [PubMed]
- Romanazzi, G.; Feliziani, E.; Baños, S.B.; Sivakumar, D. Shelf life extension of fresh fruit and vegetables by chitosan treatment. Crit. Rev. Food Sci. Nutr. 2017, 57, 579–601. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Xu, Q.; Yang, S.X.; Chen, C.; Tang, Y.; Sun, S.; Zhang, L.; Che, Z.; Li, X. Preservation mechanism of chitosan-based coating with cinnamon oil for fruits storage based on sensor data. Sensors 2016, 16, 1111. [Google Scholar] [CrossRef] [Green Version]
- Xu, D.; Qin, H.; Ren, D. Prolonged preservation of tangerine fruits using chitosan/montmorillonite composite coating. Postharvest Biol. Technol. 2018, 143, 50–57. [Google Scholar] [CrossRef]
- Cai, C.; Ma, R.; Duan, M.; Deng, Y.; Liu, T.; Lu, D. Effect of starch film containing thyme essential oil microcapsules on physicochemical activity of mango. LWT 2020, 131, 109700. [Google Scholar] [CrossRef]
- Arroyo, B.J.; Bezerra, A.C.; Oliveira, L.L.; Arroyo, S.J.; de Melo, E.A.; Santos, A.M.P. Antimicrobial active edible coating of alginate and chitosan add ZnO nanoparticles applied in guavas (Psidium guajava L.). Food Chem. 2020, 309, 125566. [Google Scholar] [CrossRef] [PubMed]
- Ayala-Silva, T.; Schnell, R.J.; Meerow, A.W.; Winterstein, M.; Cervantes, C.; Brown, J.S. Determination of color and fruit traits of half-sib families of mango (Mangifers indica L.). Proc. Fla. State Hort. Soc. 2005, 118, 253–257. [Google Scholar]
- Zhou, W.; Niu, Y.; Ding, X.; Zhao, S.; Li, Y.; Fan, G.; Zhang, S.; Liao, K. Analysis of carotenoid content and diversity in apricots (Prunus armeniaca L.) grown in China. Food Chem. 2020, 330, 127223. [Google Scholar] [CrossRef] [PubMed]
- Valdés, H.; Pizarro, M.; Campos-Vargas, R.; Infante, R.; Defilippi, B.G. Effect of ethylene inhibitors on quality attributes of apricot cv. Modesto and Patterson during Storage. Chil. J. Agric. Res. 2009, 69, 134–144. [Google Scholar] [CrossRef]
- Ruiz, D.; Egea, J.; Tomás-Barberán, F.A.; Gil, M.I. Carotenoids from new apricot (Prunus armeniaca L.) varieties and their relationship with flesh and skin color. J. Agric. Food Chem. 2005, 53, 6368–6374. [Google Scholar] [CrossRef]
- Intrigliolo, D.S.; Castel, J.R. Response of plum trees to deficit irrigation under two crop levels: Tree growth, yield and fruit quality. Irrig. Sci. 2010, 28, 525–534. [Google Scholar] [CrossRef]
- Batista-Silva, W.; Nascimento, V.L.; Medeiros, D.B.; Nunes-Nesi, A.; Ribeiro, D.M.; Zsögön, A.; Araújo, W.L. Modifications in organic acid profiles during fruit development and ripening: Correlation or causation? Front. Plant Sci. 2018, 871, 1–20. [Google Scholar] [CrossRef]
- Stanley, J.; Prakash, R.; Marshall, R.; Schröder, R. Effect of harvest maturity and cold storage on correlations between fruit properties during ripening of apricot (Prunus armeniaca). Postharvest Biol. Technol. 2013, 82, 39–50. [Google Scholar] [CrossRef]
- Dragovic-Uzelac, V.; Levaj, B.; Mrkic, V.; Bursac, D.; Boras, M. The content of polyphenols and carotenoids in three apricot cultivars depending on stage of maturity and geographical region. Food Chem. 2007, 102, 966–975. [Google Scholar] [CrossRef]
- Balasundram, N.; Sundram, K.; Samman, S. Phenolic compounds in plants and agri-industrial by-products: Antioxidant activity, occurrence, and potential uses. Food Chem. 2006, 99, 191–203. [Google Scholar] [CrossRef]
- Gao, H.; Zhang, Z.K.; Chai, H.K.; Cheng, N.; Yang, Y.; Wang, D.N.; Yang, T.; Cao, W. Melatonin treatment delays postharvest senescence and regulates reactive oxygen species metabolism in peach fruit. Postharvest Biol. Technol. 2016, 118, 103–110. [Google Scholar] [CrossRef]
- Wang, Q.J.; Sun, H.; Dong, Q.L.; Sun, T.Y.; Jin, Z.X.; Hao, Y.J.; Yao, Y.X. The enhancement of tolerance to salt and cold stresses by modifying the redox state and salicylic acid content via the cytosolic malate dehydrogenase gene in transgenic apple plants. Plant Biotechnol. J. 2016, 14, 1986–1997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adiletta, G.; Pasquariello, M.S.; Zampella, L.; Mastrobuoni, F.; Scortichini, M.; Petriccione, M. Chitosan coating: A Postharvest treatment to delay oxidative stress in loquat fruits during cold storage. Agronomy 2018, 8, 54. [Google Scholar] [CrossRef] [Green Version]
- Cetinbas, M.; Butar, S.; Onursal, C.E.; Koyuncu, M.A. The effects of pre-harvest ReTain [aminoethoxyvinylglycine (AVG)] application on quality change of ‘Monroe’ peach during normal and controlled atmosphere storage. Sci. Hortic. 2012, 147, 1–7. [Google Scholar] [CrossRef]
- Karacali, I. Preservation and marketing of horticultural products. Ege Univ. Fac. Agric. Publ. 2009, 494, 444. [Google Scholar]
- McGlasson, W.B.; Rath, A.C.; Legendre, L. Preharvest application of aminoethoxyvinyleglycine (AVC) modifies harvest maturity abd cool storage life of ‘Arctic Snow’ nextarines. Postharvest Biol. Technol. 2005, 36, 93–102. [Google Scholar] [CrossRef]
- Jemric, T.; Ivic, D.; Fruk, G.; Skutin Matijas, H.; Cvjetkovic, B.; Bupic, M.; Pavkovic, B. Reduction of postharvest decay of peach and nectarine caused by monilinia laxa using hot water dipping. Food Biopocess Technol. 2011, 4, 149–154. [Google Scholar] [CrossRef]
- Snedecor, G.W.; Cochran, W.G. Statistical Methods, 7th ed.; Iowa State University Press: Ames, IA, USA, 1990. [Google Scholar]
- McGuire, R.G. Reporting of objective color measurements. HortScience 1992, 27, 1254–1255. [Google Scholar] [CrossRef] [Green Version]
- Bhanushree, L.; Vasudeva, K.; Suresha, G.; Sadananda, G.; Mohamad Tayeebulla, H.; Halesh, G. Influence of chitosan on postharvest behavior of papaya (Carica papaya L.) Fruits under different storage conditions. J. Pharmacogn. Phytochem. 2018, 7, 2010–2014. [Google Scholar]
- Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- AOAC. Official Method of Analysis, 18th ed.; Method 935.14 and 992.24; Association of Officiating Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar]
- Jatoi, M.A.; Jurić, S.; Vidrih, R.; Vinceković, M.; Vuković, M.; Jemrić, T. The effects of postharvest application of lecithin to improve storage potential and quality of fresh goji (Lycium barbarum L.) berries. Food Chem. 2017, 230, 241–249. [Google Scholar] [CrossRef]
- Zhao, H.; Dai, T.; Jing, Q.; Jiang, D.; Cao, W. Leaf senescence and grain filling affected by post-anthesis high temperatures in two different wheat cultivars. Plant Growth Regul. 2007, 51, 149–158. [Google Scholar] [CrossRef]
- Fan, X.J.; Zhang, B.; Yan, H.; Feng, J.T.; Ma, Z.Q.; Zhang, X. Effect of lotus leaf extract incorporated composite coating on the postharvest quality of fresh goji (Lycium barbarum L.) fruit. Postharvest Biol. Technol. 2019, 148, 132–140. [Google Scholar] [CrossRef]
- El-Adawy, M.; El-Aziz, M.A.; El-Shazly, K.; Ali, N.G.; El-Magd, M.A. Dietary propionic acid enhances antibacterial and immunomodulatory effects of oxytetracycline on Nile tilapia, Oreochromis niloticus. Environ. Sci. Pollut. Res. 2018, 25, 34200–34211. [Google Scholar] [CrossRef]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(–delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinforma. Biomath. 2013, 3, 71–85. [Google Scholar] [PubMed]
- Duncan, D.B. Multiple ranges and multiple F test. Biometrics 1955, 11, 1–42. [Google Scholar] [CrossRef]
Treatment | Harvest Date | 28-Day Storage | ΔE | ||||
---|---|---|---|---|---|---|---|
L* | a* | b* | L* | a* | b* | ||
Season 2019 | |||||||
Control | 56.90a ± 0.83 | 4.37a ± 0.07 | 42.22a ± 0.10 | 65.20e ± 0.22 | 14.32a ± 0.07 | 48.43a ± 0.46 | 14.39g ± 0.51 |
AVG-a | 41.85e ± 0.46 | −10.0g ± 0.20 | 30.00f ± 0.20 | 68.52d ± 0.46 | 2.00g ± 0.08 | 35.59e ± 0.76 | 29.78d ± 0.27 |
AVG-b | 50.38d ± 0.32 | −8.36f ± 0.15 | 32.48e ± 0.06 | 68.77d ± 0.33 | 8.23f ± 0.07 | 37.66d ± 1.16 | 25.32e ± 0.29 |
SA-a | 52.86c ± 0.67 | −6.57e ± 0.07 | 34.77d ± 0.36 | 85.63a ± 0.84 | 10.45e ± 0.16 | 44.44d ± 0.53 | 38.18a ± 0.27 |
SA-b | 53.7bc ± 0.40 | −4.95d ± 0.06 | 36.08t ± 0.09 | 82.08b ± 0.87 | 10.91d ± 0.15 | 47.33a ± 0.34 | 34.40b ± 0.58 |
Chitosan-a | 54.64b ± 0.13 | 1.44c ± 0.11 | 35.02d ± 0.18 | 85.74a ± 0.36 | 12.72c ± 0.09 | 39.87c ± 1.34 | 33.45c ± 0.39 |
Chitosan-b | 56.42a ± 0.44 | 2.22b ± 0.11 | 37.70b ± 0.20 | 72.43c ± 0.12 | 13.49b ± 0.19 | 45.45b ± 1.36 | 21.08f ± 0.14 |
Season 2020 | |||||||
Control | 62.59a ± 0.91 | 4.73a ± 0.10 | 38.36a ± 0.10 | 74.51e ± 0.15 | 13.20a ± 0.01 | 47.95a ± 0.45 | 17.51e ± 0.47 |
AVG-a | 46.04e ± 0.50 | −10.0g ± 0.14 | 28.59e ± 0.46 | 75.03e ± 0.18 | 1.90g ± 0.07 | 35.09f ± 0.04 | 32.07b ± 0.77 |
AVG-b | 55.41d ± 0.35 | −8.74f ± 0.11 | 30.32d ± 0.69 | 77.25d ± 0.38 | 7.68f ± 0.24 | 37.81e ± 0.70 | 28.33c ± 0.71 |
SA-a | 58.15c ± 0.73 | −7.25e ± 0.07 | 35.78b ± 0.12 | 89.92a ± 0.88 | 9.70e ± 0.03 | 44.00c ± 0.53 | 36.93a ± 0.30 |
SA-b | 59.08bc ± 0.44 | −5.49d ± 0.06 | 37.93a ± 0.16 | 86.18b ± 0.91 | 9.94d ± 0.08 | 46.86ab ± 0.34 | 32.44b ± 0.69 |
Chitosan-a | 60.10b ± 0.15 | 1.63c ± 0.06 | 32.21c ± 0.67 | 90.02a ± 0.38 | 11.74c ± 0.05 | 39.47d ± 1.33 | 32.41b ± 0.41 |
Chitosan-b | 62.06a ± 0.48 | 2.53b ± 0.04 | 36.48b ± 0.03 | 78.91c ± 0.12 | 12.56b ± 0.04 | 46.18b ± 0.06 | 21.88d ± 0.35 |
Treatment | SSC (%) | ||||
---|---|---|---|---|---|
0 Day | 7 Days | 14 Days | 21 Days | 28 Days | |
Season 2019 | |||||
Control | 11.46a ± 0.01 | 12.50a ± 0.15 | 12.93a ± 0.12 | 13.84a ± 0.15 | 14.82a ± 0.08 |
AVG-a | 7.80f ± 0.10 | 9.77f ± 0.09 | 10.10e ± 0.05 | 10.26g ± 0.04 | 11.36f ± 0.24 |
AVG-b | 8.12e ± 0.08 | 9.97 e ± 0.12 | 11.16d ± 0.01 | 11.71f ± 0.14 | 12.13e ± 0.07 |
SA-a | 9.28d ± 0.18 | 11.03c ± 0.06 | 11.32d ± 0.12 | 12.40d ± 0.10 | 13.32d ± 0.08 |
SA-b | 10.72b ± 0.13 | 11.17c ± 0.01 | 11.38d ± 0.18 | 12.87b ± 0.12 | 14.13b ± 0.07 |
Chitosan-a | 9.82c ± 0.07 | 10.81d ± 0.04 | 11.70c ± 0.15 | 11.90e ± 0.02 | 13.82c ± 0.03 |
Chitosan-b | 10.63b ± 0.09 | 11.59b ± 0.06 | 12.07b ± 0.12 | 12.64c ± 0.11 | 14.20b ± 0.10 |
Season 2020 | |||||
Control | 10.96a ± 0.11 | 11.85a ± 0.11 | 12.32a ± 0.08 | 12.93a ± 0.10 | 14.82a ± 0.08 |
AVG-a | 7.28f ± 0.02 | 9.87 e ± 0.08 | 10.02f ± 0.07 | 11.07d ± 0.18 | 11.26e ± 0.05 |
AVG-b | 7.78e ± 0.12 | 10.89c ± 0.09 | 11.17e ± 0.01 | 11.71c ± 0.09 | 12.09d ± 0.11 |
SA-a | 8.80d ± 0.10 | 10.59d ± 0.18 | 11.39d ± 0.14 | 11.74c ± 0.07 | 12.50d ± 0.13 |
SA-b | 9.25c ± 0.12 | 11.40b ± 0.07 | 12.14b ± 0.02 | 12.90a ± 0.10 | 14.14b ± 0.10 |
Chitosan-a | 10.48b ± 0.11 | 11.33b ± 0.17 | 11.40d ± 0.05 | 12.42b ± 0.12 | 13.66c ± 0.66 |
Chitosan-b | 10.78a ± 0.18 | 11.47b ± 0.01 | 11.76c ± 0.09 | 12.57b ± 0.28 | 14.22b ± 0.10 |
Treatment | TA (%) | ||||
---|---|---|---|---|---|
0 Day | 7 Days | 14 Days | 21 Days | 28 Days | |
Season 2019 | |||||
Control | 2.10e ± 0.03 | 1.31e ± 0.02 | 1.30g ± 0.02 | 1.08e ± 0.01 | 0.68f ± 0.01 |
AVG-a | 2.59a ± 0.05 | 2.32a ± 0.03 | 2.27a ± 0.05 | 2.15a ± 0.03 | 1.50a ± 0.02 |
AVG-b | 2.43bc ± 0.04 | 2.12b ± 0.02 | 1.96c ± 0.01 | 1.78b ± 0.05 | 1.17c ± 0.02 |
SA-a | 2.47b ± 0.05 | 2.13b ± 0.01 | 2.06b ± 0.03 | 1.87b ± 0.04 | 1.34b ± 0.03 |
SA-b | 2.31d ± 0.02 | 2.06c ± 0.01 | 1.70e ± 0.03 | 1.41c ± 0.01 | 1.07d ± 0.01 |
Chitosan-a | 2.36cd ± 0.04 | 2.09bc ± 0.03 | 1.78d ± 0.01 | 1.42c ± 0.10 | 1.17c ± 0.03 |
Chitosan-b | 2.12e ± 0.01 | 1.95d ± 0.03 | 1.37f ± 0.00 | 1.31d ± 0.03 | 0.85e ± 0.02 |
Season 2020 | |||||
Control | 1.97c ± 0.02 | 1.29d ± 0.00d | 1.22d ± 0.01 | 0.99e ± 0.02 | 0.66e ± 0.03 |
AVG-a | 2.37a ± 0.05 | 2.30a ± 0.01a | 2.25a ± 0.00 | 1.77a ± 0.03 | 1.41a ± 0.06 |
AVG-b | 2.27ab ± 0.00 | 1.94b ± 0.06b | 1.87b ± 0.01 | 1.70b ± 0.01 | 1.37a ± 0.04 |
SA-a | 2.34ab ± 0.01 | 1.94b ± 0.12b | 1.88b ± 0.07 | 1.78a ± 0.01 | 1.01b ± 0.02 |
SA-b | 2.08c ± 0.01 | 1.83c ± 0.05c | 1.70bc ± 0.02 | 1.32cd ± 0.10 | 0.91c ± 0.01 |
Chitosan-a | 2.22b ± 0.19 | 1.93bc ± 0.03 | 1.70bc ± 0.01 | 1.37c ± 0.02 | 0.97b ± 0.04 |
Chitosan-b | 2.07c ± 0.01 | 1.88bc ± 0.01 | 1.56c ± 0.37 | 1.27d ± 0.03 | 0.82d ± 0.05 |
Treatment | RI (SSC/TA) | ||||
---|---|---|---|---|---|
0 Day | 7 Days | 14 Days | 21 Days | 28 Days | |
Season 2019 | |||||
Control | 5.45a ± 0.08 | 9.57a ± 0.14 | 9.97a ± 0.25 | 12.77a ± 0.04 | 21.90a ± 0.34 |
AVG-a | 3.01g ± 0.04 | 4.22f ± 0.08 | 4.45e ± 0.12 | 4.77e ± 0.08 | 7.60g ± 0.12 |
AVG-b | 3.34f ± 0.11 | 4.69e ± 0.04 | 5.68d ± 0.02 | 6.57d ± 0.25 | 10.38e ± 0.20 |
SA-a | 3.76e ± 0.03 | 5.19d ± 0.05 | 5.49d ± 0.13 | 6.65d ± 0.21 | 9.94f ± 0.22 |
SA-b | 4.64c ± 0.09 | 5.41c ± 0.01 | 6.69c ± 0.20 | 9.15b ± 0.11 | 13.25c ± 0.17 |
Chitosan-a | 4.17d ± 0.07 | 5.16d ± 0.07 | 6.56c ± 0.11 | 8.43c ± 0.59 | 11.86d ± 0.30 |
Chitosan-b | 5.02b ± 0.07 | 5.94b ± 0.08 | 8.81b ± 0.11 | 9.64b ± 0.17 | 16.69b ± 0.28 |
Season 2020 | |||||
Control | 5.58a ± 0.05 | 9.21a ± 0.09 | 9.58a ± 0.06 | 13.03a ± 0.18 | 22.38a ± 1.19 |
AVG-a | 3.07g ± 0.05 | 4.29e ± 0.05 | 4.35e ± 0.02 | 6.24e ± 0.03 | 7.97f ± 0.32 |
AVG-b | 3.43f ± 0.06 | 5.62d ± 0.14 | 5.76d ± 0.18 | 6.91d ± 0.07 | 8.85f ± 0.23 |
SA-a | 3.77e ± 0.05 | 5.46d ± 0.29 | 5.88d ± 0.30 | 6.58de ± 0.09 | 12.41e ± 0.27 |
SA-b | 4.45d ± 0.05 | 6.23b ± 0.13 | 6.64b ± 0.18 | 9.78b ± 0.67 | 15.61c ± 0.18 |
Chitosan-a | 4.74c ± 0.39 | 5.89c ± 0.13 | 5.92d ± 0.08 | 9.04c ± 0.11 | 14.05d ± 1.17 |
Chitosan-b | 5.20b ± 0.06 | 6.11bc ± 0.02 | 6.27c ± 0.07 | 9.89b ± 0.43 | 17.35b ± 1.09 |
Chemical Characteristic | Value |
---|---|
EC (ds·m−1) | 1.45 |
pH | 7.93 |
CaCO3 (%) | 8.54 |
CO3− | 0.00 |
HCO3− | 0.90 |
Cl− | 0.50 |
SO4−2 | 0.26 |
K+ | 0.21 |
Mg+2 | 0.20 |
Na+ | 0.45 |
Ca+2 | 0.80 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elmenofy, H.M.; Okba, S.K.; Salama, A.-M.; Alam-Eldein, S.M. Yield, Fruit Quality, and Storability of ‘Canino’ Apricot in Response to Aminoethoxyvinylglycine, Salicylic Acid, and Chitosan. Plants 2021, 10, 1838. https://doi.org/10.3390/plants10091838
Elmenofy HM, Okba SK, Salama A-M, Alam-Eldein SM. Yield, Fruit Quality, and Storability of ‘Canino’ Apricot in Response to Aminoethoxyvinylglycine, Salicylic Acid, and Chitosan. Plants. 2021; 10(9):1838. https://doi.org/10.3390/plants10091838
Chicago/Turabian StyleElmenofy, Hayam M., Sameh K. Okba, Abdel-Moety Salama, and Shamel M. Alam-Eldein. 2021. "Yield, Fruit Quality, and Storability of ‘Canino’ Apricot in Response to Aminoethoxyvinylglycine, Salicylic Acid, and Chitosan" Plants 10, no. 9: 1838. https://doi.org/10.3390/plants10091838