Aqueous Extract from Leaves of Citrus unshiu Attenuates Lipopolysaccharide-Induced Inflammatory Responses in a Mouse Model of Systemic Inflammation
Abstract
1. Introduction
2. Results
2.1. Evaluation of Cytotoxicity of CLE to RAW 264.7 Cells and Mouse Peritoneal Macrophages
2.2. Effect of CLE on Production of Proinflammatory Cytokines by RAW 264.7 Cells and Mouse Peritoneal Macrophages
2.3. Effect of CLE on Nitric Oxide Production by RAW 264.7 Cells
2.4. Effect of CLE on the Inflammation-Related Genes Expression in RAW 264.7 Cells
2.5. Effect of CLE on Phagocytotic Activity of RAW 264.7 Cells
2.6. Effect of CLE on Intracellular Signaling in RAW 264.7 Cells
2.7. Effect of CLE on Cytokine Levels in a Mouse Model of LPS-Induced Systemic Inflammation
2.8. Effect of CLE on Gene Expression of Inflammation-Related Proteins in LPS-Induced Systemic Inflammation Model Mice
2.9. Flavonoids in Samples
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Preparation of C. unshiu Leaf Extract
4.3. Cells
4.4. Cell Viability
4.5. Cytokine Immunoassay
4.6. Griess Assay
4.7. Real-Time RT-PCR
4.8. Phagocytotic Activity
4.9. Immunoblot Analysis
4.10. A Mouse Model of LPS-Induced Systemic Inflammation
4.11. HPLC Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Perry, V.H.; Andersson, P.B.; Gordon, S. Macrophages and inflammation in the central nervous system. Trends Neurosci. 1993, 16, 268–273. [Google Scholar] [CrossRef] [Scilit]
- Coussens, L.M.; Werb, Z. Inflammation and cancer. Nature 2002, 420, 860–867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michels, N.; van Aart, C.; Morisse, J.; Mullee, A.; Huybrechts, I. Chronic inflammation towards cancer incidence: A systematic review and meta-analysis of epidemiological studies. Crit. Rev. Oncol. Hematol. 2021, 157, 103177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stephenson, J.; Nutma, E.; van der Valk, P.; Amor, S. Inflammation in CNS neurodegenerative diseases. Immunology 2018, 154, 204–219. [Google Scholar] [CrossRef] [Scilit]
- Esser, N.; Legrand-Poels, S.; Piette, J.; Scheen, A.J.; Paquot, N. Inflammation as a link between obesity, metabolic syndrome and type 2 diabetes. Diabetes Res. Clin. Pract. 2014, 105, 141–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotamisligil, G.S. Inflammation and metabolic disorders. Nature 2006, 444, 860–867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benavente-García, O.; Castillo, J. Update on uses and properties of citrus flavonoids: New findings in anticancer, cardiovascular, and anti-inflammatory activity. J. Agric. Food Chem. 2008, 56, 6185–6205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, H.J.; Jung, U.J.; Cho, S.J.; Jung, H.K.; Shim, S.; Choi, M.S. Citrus unshiu peel extract ameliorates hyperglycemia and hepatic steatosis by altering inflammation and hepatic glucose- and lipid-regulating enzymes in db/db mice. J. Nutr. Biochem. 2013, 24, 419–427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oh, Y.C.; Cho, W.K.; Jeong, Y.H.; Im, G.Y.; Yang, M.C.; Hwang, Y.H.; Ma, J.Y. Anti-inflammatory effect of Citrus unshiu peel in LPS-stimulated RAW 264.7 macrophage cells. Am. J. Chin. Med. 2012, 40, 611–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, X.; Jiang, X.; Jiang, X.; Wang, Y.; Miao, Z.; He, W.; Yang, G.; Lv, Z.; Yu, Y.; Zheng, Y. Micheliolide inhibits LPS-induced inflammatory response and protects mice from LPS challenge. Sci. Rep. 2016, 6, 23240. [Google Scholar] [CrossRef] [Scilit]
- Coleman, J.W. Nitric oxide in immunity and inflammation. Int. Immunopharmacol. 2001, 1, 1397–1406. [Google Scholar] [CrossRef] [Scilit]
- Förstermann, U.; Xia, N.; Li, H. Roles of vascular oxidative stress and nitric oxide in the pathogenesis of atherosclerosis. Circ. Res. 2017, 120, 713–735. [Google Scholar] [CrossRef] [Scilit]
- Kyriakis, J.M.; Avruch, J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 2001, 81, 807–869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoesel, B.; Schmid, J.A. The complexity of NF-κB signaling in inflammation and cancer. Mol. Cancer 2013, 12, 86. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Qiao, L.; Shen, Y.; Jiang, P.; Chen, J.; Ye, X. Phytochemical profile and antioxidant activity of physiological drop of citrus fruits. Food Sci. 2013, 78, C37–C42. [Google Scholar] [CrossRef] [Scilit]
- Ortuño, A.; Díaz, L.; Alvarez, N.; Porras, I.; García-Lidón, A.; Del Río, J.A. Comparative study of flavonoid and scoparone accumulation in different Citrus species and their susceptibility to Penicillium digitatum. Food Chem. 2011, 125, 232–239. [Google Scholar] [CrossRef] [Scilit]
- Kimura, A.; Naka, T.; Muta, T.; Takeuchi, O.; Akira, S.; Kawase, I.; Kishimoto, T. Suppressor of cytokine signaling-1 selectively inhibits LPS-induced IL-6 production by regulating JAK–STAT. Proc. Natl. Acad. Sci. USA 2005, 102, 17089–17094. [Google Scholar] [CrossRef] [Scilit]
- Biswas, S.K.; Lopez-Collazo, E. Endotoxin tolerance: New mechanisms, molecules and clinical significance. Trends Immunol. 2009, 30, 475–487. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.L.; Tsai, S.H.; Lin-Shiau, S.Y.; Ho, C.T.; Lin, J.K. Theaflavin-3,3′-digallate from black tea blocks the nitric oxide synthase by down-regulating the activation of NF-κB in macrophages. Eur. J. Pharmacol. 1999, 367, 379–388. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.J.; Fenwick, P.S.; Nicholson, A.G.; Kirschenbaum, F.; Finney-Hayward, T.K.; Higgins, L.S.; Giembycz, M.A.; Barnes, P.J.; Donnelly, L.E. Inhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages. Br. J. Pharmacol. 2006, 149, 393–404. [Google Scholar] [CrossRef] [Scilit]
- Jang, S.; Kelley, K.W.; Johnson, R.W. Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1. Proc. Natl. Acad. Sci. USA 2008, 105, 7534–7539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morse, D.; Pischke, S.E.; Zhou, Z.; Davis, R.J.; Flavell, R.A.; Loop, T.; Otterbein, S.L.; Otterbein, L.E.; Choi, A.M.K. Suppression of inflammatory cytokine production by carbon monoxide involves the JNK pathway and AP-1. J. Biol. Chem. 2003, 278, 36993–36998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maciel, E.; Neves, B.M.; Martins, J.; Colombo, S.; Cruz, M.T.; Domingues, P.; Domingues, M.R.M. Oxidized phosphatidylserine mitigates LPS-triggered macrophage inflammatory status through modulation of JNK and NF-κB signaling cascades. Cell Signal. 2019, 61, 30–38. [Google Scholar] [CrossRef] [Scilit]
- Paik, S.; Choe, J.H.; Choi, G.E.; Kim, J.E.; Kim, J.M.; Song, G.Y.; Jo, E.K. Rg6, a rare ginsenoside, inhibits systemic inflammation through the induction of interleukin-10 and microRNA-146a. Sci. Rep. 2019, 9, 4342. [Google Scholar] [CrossRef] [Scilit]
- Wysocka, M.; Kubin, M.; Vieira, L.Q.; Ozmen, L.; Garotta, G.; Scott, P.; Trinchieri, G. Interleukin-12 is required for interferon-γ production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 1995, 25, 672–676. [Google Scholar] [CrossRef] [Scilit]
- Li, C.C.; Munitic, I.; Mittelstadt, P.R.; Castro, E.; Ashwell, J.D. Suppression of dendritic cell-derived IL-12 by endogenous glucocorticoids is protective in LPS-induced sepsis. PLoS Biol. 2015, 13, e1002269. [Google Scholar] [CrossRef] [Scilit]
- Kawaguchi, K.; Kikuchi, S.; Hasunuma, R.; Maruyama, H.; Yoshikawa, T.; Kumazawa, Y. A citrus flavonoid hesperidin suppresses infection-induced endotoxin shock in mice. Biol. Pharm. Bull. 2004, 27, 679–683. [Google Scholar] [CrossRef] [Scilit]
- Rotimi, S.O.; Bankole, G.E.; Adelani, I.B.; Rotimi, O.A. Hesperidin prevents lipopolysaccharide-induced endotoxicity in rats. Immunopharmacol. Immunotoxicol. 2016, 38, 364–371. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.X.; Yu, D.D.; Chen, M.J.; Sun, T.; Li, G.; Huang, W.J.; Nie, H.; Wang, C.; Zhang, Y.X.; Gong, Q.; et al. Hesperidin ameliorates lipopolysaccharide-induced acute lung injury in mice by inhibiting HMGB1 release. Int. Immunopharmacol. 2015, 25, 370–376. [Google Scholar] [CrossRef] [Scilit]
- Yeh, C.C.; Kao, S.J.; Lin, C.C.; Wang, S.D.; Liu, C.J.; Kao, S.T. The immunomodulation of endotoxin-induced acute lung injury by hesperidin in vivo and in vitro. Life Sci. 2007, 80, 1821–1831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaur, G.; Tirkey, N.; Chopra, K. Beneficial effect of hesperidin on lipopolysaccharide-induced hepatotoxicity. Toxicology 2006, 226, 152–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.Q.; Shi, J.B.; Chen, C.; Huang, C.; Tang, W.J.; Li, J. Hesperetin derivatives: Synthesis and anti-inflammatory activity. Bioorg. Med. Chem. Lett. 2016, 26, 1460–1465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, H.; Hao, J.; Liu, T.; Zhang, D.; Lv, H.; Song, E.; Zhu, C. Hesperetin suppresses inflammatory responses in lipopolysaccharide-induced RAW 264.7 cells via the inhibition of NF-κB and activation of Nrf2/HO-1 pathways. Inflammation 2016, 39, 964–973. [Google Scholar] [CrossRef] [Scilit]
- Mas-Capdevila, A.; Teichenne, J.; Domenech-Coca, C.; Caimari, A.; Del Bas, J.M.; Escoté, X.; Crescenti, A. Effect of hesperidin on cardiovascular disease risk factors: The role of intestinal microbiota on hesperidin bioavailability. Nutrients 2020, 12, 1488. [Google Scholar] [CrossRef] [Scilit]
- Pereira-Caro, G.; Polyviou, T.; Ludwig, I.A.; Nastase, A.M.; Moreno-Rojas, J.M.; Garcia, A.L.; Malkova, D.; Crozier, A. Bioavailability of orange juice (poly)phenols: The impact of short-term cessation of training by male endurance athletes. Am. J. Clin. Nutr. 2017, 106, 791–800. [Google Scholar] [CrossRef] [Scilit]
- Noh, H.J.; Hwang, D.; Lee, E.S.; Hyun, J.W.; Yi, P.H.; Kim, G.S.; Lee, S.E.; Pan, C.; Park, Y.J.; Chung, K.H.; et al. Anti-inflammatory activity of a new cyclic peptide, citrusin XI, isolated from the fruits of Citrus unshiu. J. Ethnopharmacol. 2015, 163, 106–112. [Google Scholar] [CrossRef] [Scilit]
- Shin, M.S.; Park, S.B.; Shin, K.S. Molecular mechanisms of immunomodulatory activity by polysaccharide isolated from the peels of Citrus unshiu. Int. J. Biol. Macromol. 2018, 112, 576–583. [Google Scholar] [CrossRef] [Scilit]
- Putra, A.B.N.; Morishige, H.; Nishimoto, S.; Nishi, K.; Shiraishi, R.; Doi, M.; Sugahara, T. Effect of collagens from jellyfish and bovine Achilles tendon on the activity of J774.1 and mouse peritoneal macrophage cells. J. Funct. Foods 2012, 4, 504–512. [Google Scholar] [CrossRef] [Scilit]
- Nishi, K.; Kondo, A.; Okamoto, T.; Nakano, H.; Daifuku, M.; Nishimoto, S.; Ochi, K.; Takaoka, T.; Sugahara, T. Immunostimulatory in vitro and in vivo effects of a water-soluble extract from kale. Biosci. Biotechnol. Biochem. 2011, 75, 40–46. [Google Scholar] [CrossRef] [Scilit]
- Kanda, K.; Nishi, K.; Kadota, A.; Nishimoto, S.; Liu, M.C.; Sugahara, T. Nobiletin suppresses adipocyte differentiation of 3T3-L1 cells by an insulin and IBMX mixture induction. Biochim. Biophys. Acta 2012, 1820, 461–468. [Google Scholar] [CrossRef] [Scilit]
- Tagashira, A.; Nishi, K.; Sugahara, T. Lysozyme from hen egg white ameliorates lipopolysaccharide-induced systemic inflammation in mice. Cytotechnology 2019, 71, 497–506. [Google Scholar] [CrossRef] [Scilit]








| Compound | Contents in Leaf (mg/g (Dry Weight)) | Contents in Fruit (mg/g (Dry Weight)) | |
|---|---|---|---|
| Flavanone | Narirutin | 0.127 ± 0.006 | 43.90 1 |
| Naringin | N.D. | N.D. 1 | |
| Hesperidin | 10.8 ± 0.0 | 261.63 1 | |
| Polymethoxyflavone | Sinensetin | 0.0225 ± 0.0003 | 0.017 2 |
| Nobiletin | 0.223 ± 0.007 | 0.182 2 | |
| Heptamethoxyflavone | 0.0396 ± 0.0011 | 0.088 2 | |
| Tangeretin | 0.0706 ± 0.0028 1 | 0.054 2 | |
| Target | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| β-Actin | CATCCGTAAAGACCTCTATGCCAAC | ATGGAGCCACCGATCCACA |
| CCL2 | CCACTCACCTGCTGCTACTCAT | TGGTGATCTTGTAGCTCTCC |
| IL-1β | AAGCCAGAGTCCAGAGAGAT | TTGGATGGTCTTGGTCCTTAGC |
| IL-6 | AAGCCAGAGTCCTTCAGAGAGAT | TTGGATGGTCTTGGTCCTTAGC |
| iNOS | CCAAGGCCTCACCTACTTCC | CTCTGAGGGCTGACACAAGG |
| TNFα | CTACTCCCAGGTTCTCTTCAA | GCAGAGAGGAGGTTGACTTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nishi, K.; Ito, T.; Kadota, A.; Ishida, M.; Nishiwaki, H.; Fukuda, N.; Kanamoto, N.; Nagata, Y.; Sugahara, T. Aqueous Extract from Leaves of Citrus unshiu Attenuates Lipopolysaccharide-Induced Inflammatory Responses in a Mouse Model of Systemic Inflammation. Plants 2021, 10, 1708. https://doi.org/10.3390/plants10081708
Nishi K, Ito T, Kadota A, Ishida M, Nishiwaki H, Fukuda N, Kanamoto N, Nagata Y, Sugahara T. Aqueous Extract from Leaves of Citrus unshiu Attenuates Lipopolysaccharide-Induced Inflammatory Responses in a Mouse Model of Systemic Inflammation. Plants. 2021; 10(8):1708. https://doi.org/10.3390/plants10081708
Chicago/Turabian StyleNishi, Kosuke, Takako Ito, Ayumu Kadota, Momoko Ishida, Hisashi Nishiwaki, Naohiro Fukuda, Naoaki Kanamoto, Yoko Nagata, and Takuya Sugahara. 2021. "Aqueous Extract from Leaves of Citrus unshiu Attenuates Lipopolysaccharide-Induced Inflammatory Responses in a Mouse Model of Systemic Inflammation" Plants 10, no. 8: 1708. https://doi.org/10.3390/plants10081708
APA StyleNishi, K., Ito, T., Kadota, A., Ishida, M., Nishiwaki, H., Fukuda, N., Kanamoto, N., Nagata, Y., & Sugahara, T. (2021). Aqueous Extract from Leaves of Citrus unshiu Attenuates Lipopolysaccharide-Induced Inflammatory Responses in a Mouse Model of Systemic Inflammation. Plants, 10(8), 1708. https://doi.org/10.3390/plants10081708

