Characterization of a Chickpea Mutant Resistant to Phelipanche aegyptiaca Pers. and Orobanche crenata Forsk
Abstract
1. Introduction
2. Results
2.1. Mutagenesis and Screening for Broomrape Resistance
2.2. Phenotyping
2.2.1. Resistance to P. aegyptiaca and O. crenata
2.2.2. Resistance Mechanism
2.2.3. Plant Morphology and Pigment Contents
2.3. DNA Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Mutagenesis
4.3. Screening for Broomrape Resistance
4.4. Phenotype Determination
4.4.1. Evaluation of Broomrape Resistance
4.4.2. Resistance Mechanism Determination
4.4.3. Plant Morphology and Pigment Contents
Chlorophyll B (μg/mL) = 34.09 × A652 − 15.28 × A665;
Total chlorophyll (a + b) (μg/mL) = 1.44 × A665 + 24.93 × A652;
Total carotenoids (μg/mL) = (1000 × A470 − 1.63 × Chlorophyll A − 104.96 × Chlorophyll B)/221;
Total anthocyanins (μg/mL) = (449.1 × A530 + 24.93 × 2000)/24,500.
4.5. DNA Extraction and PCR Amplification
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- FAOSTAT. Available online: http://faostat.fao.org/default.aspx (accessed on 1 January 2016).
- Galili, S.; Hovav, R.; Dor, E.; Hershenhorn, J.; Harel, A.; Amir-Segev, O.; Bellalou, A.; Badani, H.; Smirnov, E.; Achdari, G. The history of chickpea cultivation and breeding in Israel. Isr. J. Plant Sci. 2018, 65, 186–194. [Google Scholar] [CrossRef] [Scilit]
- Dor, E.; Smirnov, E.; Galili, S.; Guy, A.; Hershenhorn, J. Characterization of the novel tomato mutant HRT, resistant to acetolactate synthase–inhibiting herbicides. Weed Sci. 2016, 64, 348–360. [Google Scholar] [CrossRef] [Scilit]
- Dor, E.; Galili, S.; Smirnov, E.; Hacham, Y.; Amir, R.; Hershenhorn, J. The effects of herbicides targeting aromatic and branched chain amino acid biosynthesis support the presence of functional pathways in broomrape. Front. Plant Sci. 2017, 8, 707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venezian, A.; Dor, E.; Achdari, G.; Plakhine, D.; Smirnov, E.; Hershenhorn, J. The influence of the plant growth regulator maleic hydrazide on Egyptian broomrape early developmental stages and its control efficacy in tomato under greenhouse and field conditions. Front. Plant Sci. 2017, 8, 691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parker, C.; Riches, C.R. Parasitic Weeds of the World: Biology and Control; CAB International: Wallingford, UK, 1993. [Google Scholar]
- Joel, D.M.; Hershenhorn, J.; Eizenberg, H.; Aly, R.; Ejeta, G.; Rich, P.J.; Ransom, J.K.; Sauerborn, J.; Rubiales, D. Biology and management of weedy root parasites. In Horticultural Reviews; John Wiley & Sons: Hoboken, NJ, USA, 2007; Volume 33. [Google Scholar] [CrossRef] [Scilit]
- Joel, D.M.; Kleifeld, Y.; Losner-Goshen, D.; Herzlinger, G.; Gressel, J. Transgenic crops against parasites. Nature 1995, 374, 220–221. [Google Scholar] [CrossRef] [Scilit]
- Yokota, T.; Sakai, H.; Okuno, K.; Yoneyama, K.; Takeuchi, Y. Alectrol and orobanchol, germination stimulants for Orobanche minor, from its host red clover. Phytochemistry 1998, 49, 1967–1973. [Google Scholar] [CrossRef] [Scilit]
- Xie, X.; Yoneyama, K.; Yoneyama, K. The strigolactone story. Annu. Rev. Phytopathol. 2010, 48, 93–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boyer, F.-D.; de Saint Germain, A.; Pillot, J.-P.; Pouvreau, J.-B.; Chen, V.X.; Ramos, S.; Stévenin, A.; Simier, P.; Delavault, P.; Beau, J.-M.; et al. Structure-activity relationship studies of strigolactone-related molecules for branching inhibition in garden pea: Molecule design for shoot branching. Plant Physiol. 2012, 159, 1524–1544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sorefan, K.; Booker, J.; Haurogné, K.; Goussot, M.; Bainbridge, K.; Foo, E.; Chatfield, S.; Ward, S.; Beveridge, C.; Rameau, C.; et al. MAX4 and RMS1 are orthologous dioxygenase-like genes that regulate shoot branching in Arabidopsis and pea. Genes Dev. 2003, 17, 1469–1474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Booker, J.; Auldridge, M.; Wills, S.; McCarty, D.; Klee, H.; Leyser, O. MAX3/CCD7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel plant signaling molecule. Curr. Biol. 2004, 14, 1232–1238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matusova, R.; Rani, K.; Verstappen, F.W.A.; Franssen, M.C.R.; Beale, M.H.; Bouwmeester, H.J. The strigolactone germination stimulants of the plant-parasitic Striga and Orobanche spp. are derived from the carotenoid pathway. Plant Physiol. 2005, 139, 920–934. [Google Scholar] [CrossRef] [Scilit]
- Alder, A.; Jamil, M.; Marzorati, M.; Bruno, M.; Vermathen, M.; Bigler, P.; Ghisla, S.; Bouwmeester, H.J.; Beyer, P.; Al-Babili, S. The path from β-carotene to carlactone, a strigolactone-like plant hormone. Science 2012, 335, 1348–1351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brewer, P.B.; Yoneyama, K.; Filardo, F.; Meyers, E.; Scaffidi, A.; Frickey, T.; Akiyama, K.; Seto, Y.; Dun, E.A.; Cremer, J.E.; et al. Lateral branching oxidorreductase acts in the final stages of strigolactone biosynthesis in Arabidopsis. Proc. Natl. Acad. Sci. USA 2016, 113, 6301–6306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seto, Y.; Sado, A.; Asami, K.; Hanada, A.; Umehara, M.; Akiyama, K.; Yamaguchi, S. Carlactone is an endogenous biosynthetic precursor for strigolactones. Proc. Natl. Acad. Sci. USA 2014, 111, 1640–1645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Van Dijk, A.D.J.; Scaffidi, A.; Flematti, G.R.; Hofmann, M.; Charnikhova, T.; Verstappen, F.W.A.; Hepworth, J.; Van Der Krol, S.; Leyser, O.; et al. Rice cytochrome P450 MAX1 homologs catalyze distinct steps in strigolactone biosynthesis. Nat. Chem. Biol. 2014, 10, 1028–1033. [Google Scholar] [CrossRef] [Scilit]
- Abe, S.; Sado, A.; Tanaka, K.; Kisugi, T.; Asami, K.; Ota, S.; Kim, H.I.; Yoneyama, K.; Xie, X.; Ohnishi, T.; et al. Carlactone is converted to carlactonoic acid by MAX1 in Arabidopsis and its methyl ester can directly interact with AtD14 in vitro. Proc. Natl. Acad. Sci. USA 2014, 111, 18084–18089. [Google Scholar] [CrossRef] [Scilit]
- Al-Babili, S.; Bouwmeester, H.J. Strigolactones, a novel carotenoid-derived plant hormone. Annu. Rev. Plant Biol. 2015, 66, 161–186. [Google Scholar] [CrossRef] [Scilit]
- Kretzschmar, T.; Kohlen, W.; Sasse, J.; Borghi, L.; Schlegel, M.; Bachelier, J.B.; Reinhardt, D.; Bours, R.; Bouwmeester, H.J.; Martinoia, E. A petunia ABC protein controls strigolactone-dependent symbiotic signalling and branching. Nature 2012, 483, 341–344. [Google Scholar] [CrossRef] [Scilit]
- Sasse, J.; Simon, S.; Gübeli, C.; Liu, G.-W.; Cheng, X.; Friml, J.; Bouwmeester, H.J.; Martinoia, E.; Borghi, L. Asymmetric localizations of the ABC transporter PaPDR1 trace paths of directional strigolactone transport. Curr. Biol. 2015, 25, 647–655. [Google Scholar] [CrossRef] [Scilit]
- Delavault, P.; Montiel, G.; Brun, G.; Pouvreau, J.-B.; Thoiron, S.; Simier, P. Communication between host plants and parasitic plants. Adv. Bot. Res. 2017, 82, 55–82. [Google Scholar]
- Dor, E.; Alperin, B.; Wininger, S.; Ben-Dor, B.; Somvanshi, V.S.; Koltai, H.; Kapulnik, Y.; Hershenhorn, J. Characterization of a novel tomato mutant resistant to Orobanche and Phelipanche spp. weedy parasites. Euphytica 2010, 171, 371–380. [Google Scholar] [CrossRef] [Scilit]
- Dor, E.; Yoneyama, K.; Wininger, S.; Kapulnik, Y.; Yoneyama, K.; Koltai, H.; Xie, X.; Hershenhorn, J. Strigolactone deficiency confers resistance in tomato line SL-ORT1 to the parasitic weeds Phelipanche and Orobanche spp. Phytopathology 2011, 101, 213–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ejeta, G. Breeding for Striga resistance in sorghum: Exploitation of an intricate host–parasite biology. Crop Sci. 2007, 47, S216–S227. [Google Scholar] [CrossRef] [Scilit]
- Jamil, M.; Rodenburg, J.; Charnikhova, T.; Bouwmeester, H.J. Pre-attachment Striga hermonthica resistance of new rice for Africa (NERICA) cultivars based on low strigolactone production. New Phytol. 2011, 192, 964–975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fondevilla, S.; Fernández-Aparicio, M.; Satovic, Z.; Emeran, A.A.; Torres, A.M.; Moreno, M.T.; Rubiales, D. Identification of quantitative trait loci for specific mechanisms of resistance to Orobanche crenata Forsk. in pea (Pisum sativum L.). Mol. Breed. 2010, 25, 259–272. [Google Scholar] [CrossRef] [Scilit]
- Fernandez-Aparicio, M.; Kisugi, T.; Xie, X.; Rubiales, D.; Yoneyama, K. Low strigolactone root exudation: A novel mechanism of broomrape (Orobanche and Phelipanche spp.) resistance available for faba bean breeding. J. Agric. Food Chem. 2014, 62, 7063–7071. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pagès, V.; Dun, E.A.; Pillot, J.-P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.-C.; et al. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef] [Scilit]
- Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K.; et al. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef] [Scilit]
- Ruyter-Spira, C.; Kohlen, W.; Charnikhova, T.; van Zeijl, A.; van Bezouwen, L.; de Ruijter, N.; Cardoso, C.; Lopez-Raez, J.A.; Matusova, R.; Bours, R.; et al. Physiological effects of the synthetic strigolactone analog GR24 on root system architecture in Arabidopsis: Another belowground role for strigolactones? Plant Physiol. 2011, 155, 721–734. [Google Scholar] [CrossRef] [Scilit]
- Kapulnik, Y.; Delaux, P.-M.; Resnick, N.; Mayzlish-Gati, E.; Wininger, S.; Bhattacharya, C.; Séjalon-Delmas, N.; Combier, J.-P.; Bécard, G.; Belausov, E.; et al. Strigolactones affect lateral root formation and root-hair elongation in Arabidopsis. Planta 2011, 233, 209–216. [Google Scholar] [CrossRef] [Scilit]
- Koltai, H.; Dor, E.; Hershenhorn, J.; Joel, D.M.; Weininger, S.; Lekalla, S.; Shealtiel, H.; Bhattacharya, C.; Eliahu, E.; Resnick, N.; et al. Strigolactones’ effect on root growth and root-hair elongation may be mediated by auxin-efflux carriers. J. Plant Growth Regul. 2010, 29, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Koltai, H.; LekKala, S.P.; Bhattacharya, C.; Mayzlish-Gati, E.; Resnick, N.; Wininger, S.; Dor, E.; Yoneyama, K.; Yoneyama, K.; Hershenhorn, J.; et al. A tomato strigolactone-impaired mutant displays aberrant shoot morphology and plant interactions. J. Exp. Bot. 2010, 61, 1739–1749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, J.; Wei, Q.; Shu, J.; Gan, Z.; Li, B.; Yan, D.; Huang, Z.; Guo, Y.; Wang, X.; Zhang, L. Exploration of resistance to Phelipanche aegyptiaca in tomato. Pest Manag. Sci. 2020, 76, 3806–3821. [Google Scholar] [CrossRef] [Scilit]
- Bari, V.K.; Nassar, J.A.; Kheredin, S.M.; Gal-On, A.; Ron, M.; Britt, A.; Steele, D.; Yoder, J.; Aly, R. CRISPR/Cas9-mediated mutagenesis of Carotenoid Cleavage Dioxygenase 8 in tomato provides resistance against the parasitic weed Phelipanche aegyptiaca. Sci. Rep. 2019, 9, 11438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bari, V.K.; Nassar, J.A.; Meir, A.; Aly, R. Targeted mutagenesis of two homologous ATP-binding cassette subfamily G (ABCG) genes in tomato confers resistance to parasitic weed Phelipanche aegyptiaca. J. Plant Res. 2021, 134, 585–597. [Google Scholar] [CrossRef] [Scilit]
- Pavan, S.; Schiavulli, A.; Marcotrigiano, A.R.; Bardaro, N.; Bracuto, V.; Ricciardi, F.; Charnikhova, T.; Lotti, C.; Bouwmeester, H.J.; Ricciardi, L. Characterization of low-strigolactone germplasm in pea (Pisum sativum L.) resistant to crenate broomrape (Orobanche crenata Forsk.). Mol. Plant-Microbe Interact. 2016, 29, 743–749. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Aparicio, M.; Moral, A.; Kharrat, M.; Rubiales, D. Resistance against broomrapes (Orobanche and Phelipanche spp.) in faba bean (Vicia faba) based in low induction of broomrape seed germination. Euphytica 2012, 186, 897–905. [Google Scholar] [CrossRef] [Scilit]
- Vallabhaneni, R.; Bradbury, L.M.T.; Wurtzel, E.T. The carotenoid dioxygenase gene family in maize, sorghum, and rice. Arch. Biochem. Biophys. 2010, 504, 104–111. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, K.; Xie, X.; Yoneyama, K.; Takeuchi, Y. Strigolactones: Structures and biological activities. Pest Manag. Sci. 2009, 65, 467–470. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Bouwmeester, H.J. Structural diversity in the strigolactones. J. Exp. Bot. 2018, 69, 2219–2230. [Google Scholar] [CrossRef] [Scilit]
- Xie, X.; Kusumoto, D.; Takeuchi, Y.; Yoneyama, K.; Yamada, Y.; Yoneyama, K. 2′-Epi-orobanchol and solanacol, two unique strigolactones, germination stimulants for root parasitic weeds, produced by tobacco. J. Agric. Food Chem. 2007, 55, 8067–8072. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tokunaga, T.; Hayashi, H.; Akiyama, K. Medicaol, a strigolactone identified as a putative didehydro-orobancholisomer, from Medicago truncatula. Phytochemistry 2015, 111, 91–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, X.; Yoneyama, K.; Kusumoto, D.; Yamada, Y.; Yokota, T.; Takeuchi, Y.; Yoneyama, K. Isolation and identification of alectrol as (+)-orobanchyl acetate, a germination stimulant for root parasitic plants. Phytochemistry 2008, 69, 427–431. [Google Scholar] [CrossRef] [Scilit]
- Xie, X.; Yoneyama, K.; Kisugi, T.; Uchida, K.; Ito, S.; Akiyama, K.; Hayashi, H.; Yokota, T.; Nomura, T.; Yoneyama, K. Confirming stereochemical structures of strigolactones produced by rice and tobacco. Mol. Plant 2013, 6, 153–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoneyama, K.; Xie, X.; Kisugi, T.; Nomura, T.; Sekimoto, H.; Yokota, T.; Yoneyama, K. Characterization of strigolactones exuded by Asteraceae plants. Plant Growth Regul. 2011, 65, 495–504. [Google Scholar] [CrossRef] [Scilit]
- Trabelsi, I.; Yoneyama, K.; Abbes, Z.; Amri, M.; Xie, X.; Kisugi, T.; Kim, H.I.; Kharrat, M.; Yoneyama, K. Characterization of strigolactones produced by Orobanche foetida and Orobanche crenata resistant faba bean (Vicia faba L.) genotypes and effects of phosphorous, nitrogen, and potassium deficiencies on strigolactone production. South Afr. J. Bot. 2017, 108, 15–22. [Google Scholar] [CrossRef] [Scilit]
- Vogel, J.T.; Walter, M.H.; Giavalisco, P.; Lytovchenko, A.; Kohlen, W.; Charnikhova, T.; Simkin, A.J.; Goulet, C.; Strack, D.; Bouwmeester, H.J.; et al. SlCCD7 controls strigolactone biosynthesis, shoot branching and mycorrhiza-induced apocarotenoid formation in tomato. Plant J. 2010, 61, 300–311. [Google Scholar] [CrossRef] [Scilit]
- De Saint Germain, A.; Ligerot, Y.; Dun, E.A.; Pillot, J.-P.; Ross, J.J.; Beveridge, C.A.; Rameau, C. Strigolactones stimulate internode elongation independently of gibberellins. Plant Physiol. 2013, 163, 1012–1025. [Google Scholar] [CrossRef] [Scilit]
- Snowden, K.C.; Simkin, A.J.; Janssen, B.J.; Templeton, K.R.; Loucas, H.M.; Simons, J.L.; Karunairetnam, S.; Gleave, A.P.; Clark, D.G.; Klee, H.J. The decreased apical dominance1/Petunia hybrida Carotenoid Cleavage Dioxygenase 8 gene affects branch production and plays a role in leaf senescence, root growth, and flower development. Plant Cell 2005, 17, 746–759. [Google Scholar] [CrossRef] [Scilit]
- Muhr, M.; Prüfer, N.; Paulat, M.; Teichmann, T. Knockdown of strigolactone biosynthesis genes in Populus affects branched 1 expression and shoot architecture. New Phytol. 2016, 212, 613–626. [Google Scholar] [CrossRef] [Scilit]
- Ongaro, V.; Leyser, O. Hormonal control of shoot branching. J. Exp. Bot. 2008, 59, 67–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wakabayashi, T.; Hamana, M.; Mori, A.; Akiyama, R.; Ueno, K.; Osakabe, K.; Osakabe, Y.; Suzuki, H.; Takikawa, H.; Mizutani, M.; et al. Direct conversion of carlactonoic acid to orobanchol by cytochrome P450 CYP722C in strigolactone biosynthesis. Sci. Adv. 2019, 5, eaax9067. [Google Scholar] [CrossRef] [Scilit]
- Min, Z.; Li, R.; Chen, L.; Zhang, Y.; Li, Z.; Liu, M.; Ju, Y.; Fang, Y. Alleviation of drought stress in grapevine by foliar-applied strigolactones. Plant Physiol. Biochem. 2019, 135, 99–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Q.; Ding, F.; Li, M.; Zhang, X.; Zhang, S.; Huang, B. Strigolactone and ethylene inhibitor suppressing dark-induced leaf senescence in perennial ryegrass involving transcriptional downregulation of chlorophyll degradation. J. Am. Soc. Hortic. Sci. 2021, 146, 79–86. [Google Scholar] [CrossRef] [Scilit]
- Qiu, C.-W.; Zhang, C.; Wang, N.-H.; Mao, W.; Wu, F. Strigolactone GR24 improves cadmium tolerance by regulating cadmium uptake, nitric oxide signaling and antioxidant metabolism in barley (Hordeum vulgare L.). Environ. Pollut. 2021, 273, 116486. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Li, Y.; Xi, X.; Ma, C.; Sun, Z.; Yang, X.; Li, X.; Tian, Y.; Wang, C. Exogenous strigolactones alleviate KCl stress by regulating photosynthesis, ROS migration and ion transport in Malus hupehensis Rehd. Plant Physiol. Biochem. 2021, 159, 113–122. [Google Scholar] [CrossRef] [Scilit]
- Sarwar, Y.; Shahbaz, M. Modulation in growth, photosynthetic pigments, gas exchange attributes and inorganic ions in sunflower (Helianthus annuus L.) by strigolactones (GR24) achene priming under saline conditions. Pak. J. Bot. 2020, 52, 23–31. [Google Scholar] [CrossRef] [Scilit]
- Ferrero, M.; Pagliarani, C.; Novák, O.; Ferrandino, A.; Cardinale, F.; Visentin, I.; Schubert, A. Exogenous strigolactone interacts with abscisic acid-mediated accumulation of anthocyanins in grapevine berries. J. Exp. Bot. 2018, 69, 2391–2401. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Joo, Y.; Cao, D.; Li, R.; Lee, G.; Halitschke, R.; Baldwin, G.; Baldwin, I.T.; Wang, M. Strigolactone signaling regulates specialized metabolism in tobacco stems and interactions with stem-feeding herbivores. PLoS Biol. 2020, 18, e3000830. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Nguyen, K.H.; Tran, C.D.; Watanabe, Y.; Tian, C.; Yin, X.; Li, K.; Yang, Y.; Guo, J.; Miao, Y.; et al. Negative roles of strigolactone-related SMXL6, 7 and 8 proteins in drought resistance in Arabidopsis. Biomolecules 2020, 10, 607. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Yu, H.; Guo, H.; Lin, T.; Kou, L.; Wang, A.; Shao, N.; Ma, H.; Xiong, G. Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 2020, 583, 277–281. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, K.; Yoneyama, K.; Takeuchi, Y.; Sekimoto, H. Phosphorus deficiency in red clover promotes exudation of orobanchol, the signal for mycorrhizal symbionts and germination stimulant for root parasites. Planta 2007, 225, 1031–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Segev, A.; Badani, H.; Kapulnik, Y.; Shomer, I.; Oren-Shamir, M.; Galili, S. Determination of polyphenols, flavonoids, and antioxidant capacity in colored chickpea (Cicer arietinum L.). J. Food Sci. 2010, 75, S115–S119. [Google Scholar] [CrossRef] [Scilit]
- Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar]
- Schreiber, G.; Reuveni, M.; Evenor, D.; Oren-Shamir, M.; Ovadia, R.; Sapir-Mir, M.; Bootbool-Man, A.; Nahon, S.; Shlomo, H.; Chen, L.; et al. Anthocyanin1 from Solanum chilense is more efficient in accumulating anthocyanin metabolites than its Solanum lycopersicum counterpart in association with the Anthocyanin Fruit phenotype of tomato. TAG 2012, 124, 295–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Parameter | Chickpea Line | Average Mean | SEM | dF | F | Prob > F |
|---|---|---|---|---|---|---|
| P. aegyptiaca | ||||||
| Broomrape number | WT F01 | 16.1 | 4.23 | 1 | 99.96 | <0.0001 |
| CCD7M14 | 1.6 | 1.78 | ||||
| Broomrape biomass (g) | WT F01 | 82.11 | 6.69 | 1 | 77.17 | <0.0001 |
| CCD7M14 | 7.93 | 5.15 | ||||
| O. crenata | ||||||
| Broomrape number | WT F01 | 13.6 | 3.48 | 1 | 9.6 | 0.0062 |
| CCD7M14 | 2.2 | 1.71 | ||||
| Broomrape biomass (g) | WT F01 | 109.74 | 10.92 | 1 | 54.92 | <0.0001 |
| CCD7M14 | 13.78 | 6.96 | ||||
| Broomrape | Chickpea Line | Average Mean | SEM | dF | F | Prob > F |
|---|---|---|---|---|---|---|
| P. aegyptiaca | WT F01 | 76.84 | 6.28 | 1 | 146.00 | <0.0001 |
| CCD7M14 | 0.72 | 0.45 | ||||
| O. crenata | WT F01 | 42.21 | 2.57 | 1 | 270.07 | <0.0001 |
| CCD7M14 | 0 | 0 |
| Root Exudates Concentration (μL/mL) | Chickpea Line | Average Mean | SEM | dF | F | Prob > F |
|---|---|---|---|---|---|---|
| 1 | WT F01 | 28.10 | 5.78 | 1 | 10.71 | 0.0307 |
| CCD7M14 | 9.02 | 0.77 | ||||
| 10 | WT F01 | 77.38 | 3.13 | 1 | 336.71 | <0.0001 |
| CCD7M14 | 15.94 | 1.19 | ||||
| 100 | WT F01 | 84.84 | 4.28 | 1 | 100.95 | 0.0006 |
| CCD7M14 | 34.95 | 2.52 |
| Parameters | Chickpea Line | |
|---|---|---|
| WT F01 | CCD7M14 | |
| Foliage biomass (g) | 242.8 ± 14.5 a | 210.2 ± 12.5 a |
| Root biomass (g) | 112.3 ± 8.3 a | 113.8 ± 37.2 a |
| Primary branch number | 7.0 ± 0.8 b | 12.0 ± 1.4 a |
| Primary branch length (cm) | 62.6 ± 2.0 a | 40.3 ± 4.0 b |
| Pigment | Leaf 1 | Leaf 3 | Leaf 5 | |||
|---|---|---|---|---|---|---|
| WT F01 | CCD7M14 | WT F01 | CCD7M14 | WT F01 | CCD7M14 | |
| Chlorophyll a | 214.5 ± 9.2 a | 120.3 ± 15.1 b | 230.0 ± 30.0 a | 157.2 ± 9.5 b | 281.5 ± 48.9 a | 151.1 ± 30.6 b |
| Chlorophyll b | 183.9 ± 7.4 a | 56.0 ± 11.7 b | 184.3 ± 47.9 a | 74.5 ± 5.0 b | 200.0 ± 35.3 a | 65.2 ± 17.2 b |
| Total chlorophyll | 402.2 ± 11.5 a | 176.3 ± 26.5 b | 414.43 ± 80.5 a | 231.7 ± 6.1 b | 481.6 ± 56.7 a | 216.3 ± 53.2 b |
| Carotenoids | 62.1 ± 5.3 a | 35.1 ± 4.0 b | 66.5 ± 12.1 a | 35.8 ± 2.8 b | 61.3 ± 8.1 a | 27.2 ± 4.5 b |
| Anthocyanin | 9.7 ± 0.9 b | 33.2 ± 5.1 a | 15.2 ± 2.1 b | 32.6 ± 7.3 a | 11.9 ± 1.2 b | 29.3 ± 4.2 a |
| Primer Set | Exon | Forward Primer | Reverse Primer | Product Size (bp) | Sequenced Region (cDNA) |
|---|---|---|---|---|---|
| 1 | 1 | AGCACATTTTGTTGCCAAGC | TCCTGCTTACATGAAATGCAAACT | 1090 | 1–529 |
| 2 | 1 | GAGTACGATCGAAAGACTGACTCG | TCCTGCTTACATGAAATGCAAACT | 551 | 522–776 |
| 3 | 2 | TACAAGGTGTACAACATTGAGT | ACTGCCAATTTGTTGGCATTTC | 599 | 777–908 |
| 4 | 3 | GAAATGCCAACAAATTGGCAGT | GCATGCTTAAATTTCATTTTGGA | 621 | 909–1043 |
| 5 | 4 | TCATGAGGGAGTAAATAATCAACA | TTTAATTCACGTTTTATGTCGGT | 623 | 1044–1316 |
| 6 | 5 | AGGGACAAAAATTATCGGCTT | CTTAGGATAAACCACACATAGATAG | 361 | 1317–1404 |
| 7 | 6 | CCAATTAAGATGTTCGAGAGCT | ACATGGACAAATCTATAACGACA | 747 | 1405–1710 |
| 8 | 7 | AGTAATAGCTAATCAAAACGGGT | TTGGATTTCCAAGAGTCCAAT | 686 | 1711–1872 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galili, S.; Hershenhorn, J.; Smirnov, E.; Yoneyama, K.; Xie, X.; Amir-Segev, O.; Bellalou, A.; Dor, E. Characterization of a Chickpea Mutant Resistant to Phelipanche aegyptiaca Pers. and Orobanche crenata Forsk. Plants 2021, 10, 2552. https://doi.org/10.3390/plants10122552
Galili S, Hershenhorn J, Smirnov E, Yoneyama K, Xie X, Amir-Segev O, Bellalou A, Dor E. Characterization of a Chickpea Mutant Resistant to Phelipanche aegyptiaca Pers. and Orobanche crenata Forsk. Plants. 2021; 10(12):2552. https://doi.org/10.3390/plants10122552
Chicago/Turabian StyleGalili, Shmuel, Joseph Hershenhorn, Evgeny Smirnov, Koichi Yoneyama, Xiaonan Xie, Orit Amir-Segev, Aharon Bellalou, and Evgenia Dor. 2021. "Characterization of a Chickpea Mutant Resistant to Phelipanche aegyptiaca Pers. and Orobanche crenata Forsk" Plants 10, no. 12: 2552. https://doi.org/10.3390/plants10122552
APA StyleGalili, S., Hershenhorn, J., Smirnov, E., Yoneyama, K., Xie, X., Amir-Segev, O., Bellalou, A., & Dor, E. (2021). Characterization of a Chickpea Mutant Resistant to Phelipanche aegyptiaca Pers. and Orobanche crenata Forsk. Plants, 10(12), 2552. https://doi.org/10.3390/plants10122552
