Next Article in Journal
Comprehensive Analyses of NAC Transcription Factor Family in Almond (Prunus dulcis) and Their Differential Gene Expression during Fruit Development
Next Article in Special Issue
Challenges in Medicinal and Aromatic Plants DNA Barcoding—Lessons from the Lamiaceae
Previous Article in Journal
Comparative Investigation of Combined Metabolomics-Flavoromics during the Ripening of Mango (Mangifera indica L.) cv. ‘Nam Dok Mai Si Thong’ and ‘Nam Dok Mai No. 4’
Previous Article in Special Issue
Licorice Germplasm Resources Identification Using DNA Barcodes Inner-Variants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 10
10.3390/plants10102199
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

DNA Barcoding of Two Thymelaeaceae Species: Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl

by
Almuthanna K. Alkaraki
1,*,
Maisam A. Aldmoor
1,
Jamil N. Lahham
1 and
Mohammed Awad
2
1
Department of Biological Sciences, Faculty of Science, Yarmouk University, Irbid 21163, Jordan
2
Department of Biotechnology, Faculty of Agriculture, Al-Azhar University, Cairo 11651, Egypt
*
Author to whom correspondence should be addressed.
Plants 2021, 10(10), 2199; https://doi.org/10.3390/plants10102199
Submission received: 8 August 2021 / Revised: 30 September 2021 / Accepted: 11 October 2021 / Published: 16 October 2021
(This article belongs to the Special Issue DNA Barcoding for Herbal Medicines)
Browse Figures
Versions Notes

Abstract

Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl both belong to the Thymelaeaceae family. Both species are used traditionally to treat several diseases along with various daily applications by Jordanian Bedouins. Traditionally, those species are identified through personal proficiency, which could be misleading due to human errors or lack of expertise. This study aims to investigate an effective DNA barcoding method to identify and characterize Daphne mucronata Royle and Thymelaea hirsuta plant species at the molecular level. Daphne mucronata Royle and Thymelaea hirsuta were collected from the ancient city of Petra in the Southern part of Jordan. Sequences of candidate DNA barcodes were amplified (rbcL, matK, and rpoC1), sequenced, and aligned to the blastn database. Moreover, the obtained sequences were compared with available sequences of related species at the GenBank database. Our results showed that DNA barcoding successfully identifies the two plant species using any of chloroplast genes (rbcL, matK, or rpoC1). The results emphasize the ability of DNA barcoding for identifying and characterizing different plant species through the recruitment of different barcode loci in molecular identification.

1. Introduction

Thymelaeaceae family is a medium-sized family of Angiosperms that contains almost 898 species distributed in 50 different genera [1]. Daphne and Thymelaea genera comprise 95 and 30 species, respectively, representing around 23 percent of the family [2]. Thymelaeaceae family is widely used in folk medicine to treat several diseases as it has anti-leukemia, antitumor, anti-gout, anti-inflammatory, and antimicrobial pharmacological properties [3]. Among the Thymelaeaceae species are Daphne mucronata and Thymelaea hirsute, with various medical and daily uses.
The Daphne mucronata Royle [4] is a wild evergreen shrub distributed in Southeast Asia, Afghanistan, Pakistan, Iran, North Africa, and South Europe [5]. Daphne mucronata is used in folk medicine to treat cancer, different skin disorders, ulcer, and purgative abortifacient [3,6,7,8,9]. Moreover, Daphne mucronata has analgesic, anti-inflammatory, and antimicrobial activities [10]. Recently, Daphne mucronata Royle showed a protective and anti-inflammatory effect on the stressed human adipose-derived mesenchymal stem cells protecting human adipose stem cells against monosodium iodoacetate and enhancing cell proliferation [11]. The phytochemical screening of Daphne mucronata Royle showed antimicrobial activity and antioxidant properties [12,13,14,15]. Moreover, ethyl acetate extract of Daphne mucronata aerial parts revealed the following chemical constituents: Coumarins, flavonoids, triterpenoids, diterpenes, lignin, and glucosides [10].
Thymelaea hirsuta (shaggy sparrow-wort or Mitnan in Arabic) is a xerophyte shrub that can grow up to two meters in height with a root system reaching up to 3.5 m depth, and is known for its fleshy tiny size leaves and flowers [16]. Thymelaea hirsuta is a toxic plant with reported therapeutic properties [16]. Traditionally, the leaves of Thymelaea hirsuta were used to treat pinworms and skin conditions in the thirteenth century, while the bark was recruited to promote wound healing [16]. In addition, local Bedouins used the inner bark of Thymelaea hirsuta in manufacturing ropes and paper sheets [17,18]. Additionally, Bedouins have recruited powdered Thymelaea hirsuta in their traditional veterinary medicine to prevent miscarriages in she-camels [17]. Generally, steroidal compounds, flavonoids, coumarins, and lignans are the active chemical constituents that play a role in biological activity [19]. The Thymelaea hirsuta aqueous extracts are highly active sources of natural antioxidants, which play an essential role in controlling various pathological conditions, such as Parkinson’s disease and Alzheimer’s disease [20]. In addition, Thymelaea hirsuta plants’ aqueous extracts are rich in polyphenol contents that show antihypertensive and antidiabetic activities, thus the plant may be considered a food supplement for diabetic and hypertensive patients [21]. Furthermore, ethanolic extracts of Thymelaea hirsuta can significantly inhibit human adenocarcinoma cell growth [22]. Many Thymelaea hirsuta extract revealed antimicrobial and antifungal activities, and exhibited an excellent antioxidant activity [23]. Phytochemical screening of Thymelaea hirsuta aerial parts showed the presence of alkaloids tannins, saponins, steroids, coumarins, and anthraquinones [20]. Moreover, the aqueous extract of Thymelaea hirsuta revealed both hypoglycaemic and antidiabetic effects in normal glycaemic and induced diabetic rats, indicating the basis for Thymelaea hirsuta in diabetes treatment in Folk medicine [24]. In addition to the antidiabetic effect of Thymelaea hirsuta L. in a rat model, an antihypertensive effect was also reported [21]. In addition, Thymelaea hirsuta exhibited significant activity in acute inflammation compared to a standard anti-inflammatory drug (diclofenac) [25]. A recent study highlights the traditional usage of Thymelaea hirsuta extracts on cutaneous dermatophytosis and the new potential use of Thymelaea hirsuta as antiaging and better healing of the skin [26].
Daphne mucronata and Thymelaea hirsuta are essential as herbal medicine in folk remedies and traditional applications related to the daily life of Bedouins. The importance of both species inspires the research group to establish an effective DNA barcode to distinguish both species at the molecular level.
DNA barcoding is an identification tool of different samples based on the molecular marker of conserved regions [27,28]. DNA Barcoding is widely used to identify and classify animal and plant species; unknown samples even previously described [29,30]. Moreover, DNA barcoding is used for quality control and identification of food authentication, for example, seafood, herbal plants, and crops [31,32]. This study aims to use DNA barcoding to confirm the identity of the following two medicinal plant species: Daphne mucronata and Thymelaea hirsuta using matK, rbcL, and rpoC1 genes as a barcode region.

2. Results

DNA was isolated, and targeted sequences were amplified using the selected PCR primers for the four barcode loci of Daphne mucronata and Thymelaea hirsuta (L.) Endl. DNA sequencing was successfully performed for 5 out of 6 loci in both selected plant species (Table 1). Daphne mucronata and Thymelaea hirsuta selected barcode regions were searched against the GenBank database [33]. Obtained sequences (Appendix A) were deposited at the GenBank database [33], and the deposited accession numbers are shown in Table 1. Barcode sequences were not retrieved for Daphne mucronata for the four selected barcode loci, while Thymelaea hirsuta retrieved sequences for only matK and rbcL (see retrieved accessions in Table 1). The obtained barcode sequences for matK and rbcL showed 97.96% identity for matK and 100% for rbcL of the retrieved two accessions of Thymelaea hirsute. The obtained sequences of both species were aligned using a pairwise alignment search tool (Blastn). The two plant species showed 96% of identity for matK, and 99% for rbcL, as shown in Figure 1.
The obtained sequences were run in blastn, and five high match scores were chosen to run phylogenetic analysis. The five related sequences were selected according to the highest BLAST hits. The retrieved genes of different species related to Daphne mucronata and Thymelaea hirsute, along with E values, identity percentage, and the retrieved accessions, are shown in Table 2. Unavailable sequences (specific genes) for selected species was obtained by extracting the selected genes from the complete chloroplast genome via python code.
The results show that the percentage identity range was the highest (99.16%) between Daphne mucronata matK, and both Daphne longilobata and Daphne tangutica. In comparison, the lowest percentage of identity was reported in Daphne mucronata matK barcode locus (98.04%) and Daphne giraldii species, belonging to the Thymelaeaceae family. The highest identity percentage was among Thymelaea hirsuta rbcL (100.00%) reported earlier in the database, followed by 99.26% found in Daphne mezereum rbcL, Stellera chamaejasme rbcL, and Wikstroemia monnula rbcL (Table 2).
The top five related sequences that appeared in Table 2 were recruited in phylogenetic trees construction using Mega X software shown in (Figure 2). Figure 2 shows phylogenetic trees of Daphne mucronata related species using matK, and rbcL barcode loci. The matK barcode could discriminate Daphne mucronata from other related species (Figure 2A), while rbcL can discriminate between Daphne mucronata and Daphne mezereum, Daphne laureola, Dirca occidentalis, and Thymelaea hirsute (Figure 2B). In Figure 2, phylogenetic trees of Thymelaea hirsuta and other related species show that matK can discriminate between Thymelaea hirsuta, Daphne laureola, and Daphne mezereum (matK, rbcL, and rpoC1) barcode loci (Figure 2C). While Figure 2D shows that rbcL can discriminate between Thymelaea hirsuta and the five related species. The rpoC1 can discriminate between Thymelaea hirsuta and Stellera chamaejasme (Figure 2E). Further analysis was performed through the NCBI-Taxonomy browser to check the ability of the obtained sequences to fit within the proper plant family (Thymelaeaceae). Table 3 shows the number of obtained hits (organisms) according to the taxonomy browser (NCBI), once running sequences through blastn (NCBI) database. In Table 3 the NCBI taxonomy Entrez results of the retrieved lineage hits support that all sequences are be able to be discriminated and retained to Thymelaeaceae family.

3. Discussion

Jordanian Flora is rich with an enormous variety of plant species belonging to 112 plant families, where more than 363 species are considered medicinal due to their therapeutic activity [34,35,36]. In Jordan, the Thymelaeaceae family is represented by two genera Daphne (Daphne mucronata Royle) and Thmelaea (three species; Thymelaea hirsuta, Thymelaea passerine, and Thymelaea pubescens) [37]. Daphne mucronata is distributed in Petra, Karak, Ma’an, and Tafila [38]. At the same time, Thymelaea hirsuta is distributed in the southern part of Jordan (Petra, Tafila, Shobak, and Ma’an) [37,38]. The usage of both selected species in folk medicine and the recruitment of Thymelaea hirsuta in Bedouins’ daily life makes both species excellent candidates for molecular identification (barcoding).
Much research was conducted to investigate the therapeutic and antioxidant activities of both Daphne mucronata and Thymelaea hirsute. However, molecular identification and phylogenetic characterization were very limited. Exploring the GenBank database for Daphne mucronata retrieved no results [33], indicating that our obtained sequences are new and firsthand. At the same time, Thymelaea hirsuta search retrieved deposited sequences for both rbcL and matK sequences but nothing for both rpoC1 [39]. The length of gene sequences is within the average length, satisfying the previously reported criteria [40]. In addition, DNA barcoding was successfully identified Thymelaea hirsuta and Daphne mucronata species. A total of 5 sequences were successfully obtained for the two plant species using different chloroplast barcode loci (rbcL, matK, and rpoC1). Among those sequences, about 3 novel sequences were not included earlier within the GenBank database (OK188786, OK040775, OK040776). Moreover, the identity percent between our Thymelaea hirsuta sequence and previously deposited sequence in GenBank database is 97.96% for matK and 100.00% for rbcL.
The Molecular phylogenetic relationships of different species from Thymelaeaceae family sequences from Africa and Australia were investigated earlier by parsimony analysis [41], including Thymelaea hirsuta Endl (the original sequence was obtained from [42]). The van der Bank study was limited to rbcL, trnL intron, and trnL-F intergenic spacer sequences, and separate sequence analysis of the selected sequences produced nonidentical phylogenetic outcomes. Meanwhile, combined sequences analysis did improve the resolution of phylogenetic discrimination among different clades [41]. Furthermore, Daphne mucronata sequences were not included in the study mentioned above [41]. In another recent study, phylogenetic analysis using maximum parsimony and Bayesian inference of the internal transcribed spacer (ITS) and rbcL, trnL intron, and trnL-F intergenic spacer revealed that the Thymelaeaceae is not a monophyletic family [43]. The discrimination capacity of matK, rbcL, and rpoC1 barcode regions were divergent among studied species, indicating that each species could recruit different locus (loci), in terms of identification and molecular characterization. However, the discrimination capacity of rpoC1 as a candidate barcode region is limited and needs future study. Lower discrimination capacity of rpoC1 compared with matK and rbcL is probably due to limited sequences availability in reference databases for rpoC1, which lead to low identification capacity [44]. Many studies in plant DNA barcoding used matK and rbcL genes as barcode regions. Further studies should be done using other barcode genes, as there is no universal primer found effective in plants. DNA barcoding can be used to identify plant species, specifically medicinal plants. Further research should be carried out to establish a complete DNA barcodes database of all medicinal plants.

4. Materials and Methods

Fresh leaves of the two selected species from the Thymelaeaceae family (Daphne mucronata and Thymelaea hirsuta (L.) Endl) were collected from the ancient city of Petra (Jordan) (Locality: 30.324181945297152, 35.47997922146477). Samples collection was conducted via a specilized plant taxonomist [37]. Stored leaves were ground using liquid nitrogen, and DNA was extracted using commercial kits (Qiagen). DNA quality and quantity were checked spectrophotometrically and via 1% gel electrophoresis before the PCR amplification. Different Chloroplast loci (matK, rbcL, and rpoC1) were amplified using the following primers: matK (Forward—CCCRTYCATCTGGAAATCTTGGTTC and reverse—GCTRTRATAATGAGAAAGATTTCTGC) [45], rbcL (Forward—TGTCACCACAAACAGAAAC and reverse—TCGCATGTACCTGCAGTAGC) [46], and rpoC1 (—GGCAAAGAGGGAAGATTTCG and reverse—CCATAAGCATATCTTGAGTTGG) [47]. PCR amplifications were conducted using 5× HOT FIREPol® Blend master mix; Initial denaturation (5 min, 95 °C), followed by 40 cycles of denaturation (30 s, 95 °C), annealing (30 s at 54 °C). The final extension cycle (30 s at 72 °C) was applied for all PCR reactions, and amplified DNA fragments were qualitatively checked via Agarose gel electrophoresis before sequencing. The Amplified fragments were purified and sequenced using Sanger sequencing method (ABI PRISM® kit, Macrogen company, Korea). Chromatograms were analyzed using FinchTV software [48], and obtained sequences were further analyzed using the NCBI-BLAST online tool [49] to check related sequences in the nucleotide database. Furthermore, five related sequences with a high matching score were obtained from NCBI-GenBank Entrez for further phylogenetic analysis for each plant sample. Corresponding genes were extracted using python code for species with complete chloroplast genomes [50]. Neighbor-joining phylogenetic trees were constructed using MEGA X software [51] to evaluate the phylogenetic relationships and the effectiveness of barcode discrimination at the species level. Obtained sequences were further analyzed using the NCBI taxonomy database (Lineage), via counting the number of (hits) organisms along appeared in taxonmy browser, once running the obtained sequences through NCBI blastn.

Author Contributions

Conceptualization, A.K.A. and J.N.L.; methodology, M.A.A.; software, M.A.A. and M.A.; validation, M.A.A., A.K.A. and M.A.; formal analysis, M.A.A.; investigation, A.K.A. and J.N.L.; writing—original draft preparation A.K.A.; writing—review and editing, A.K.A., J.N.L., M.A. and M.A.A.; supervision, A.K.A. and J.N.L.; project administration, A.K.A.; funding acquisition, A.K.A. and J.N.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Dean of Graduate Studies and Scientific Research at Yarmouk University (Irbid, Jordan), grant number 17/2020.

Institutional Review Board Statement

Not Applicable.

Informed Consent Statement

Not Applicable.

Acknowledgments

The authors would like to thank the Dean of Graduate Studies and Scientific Research at Yarmouk University (Irbid, Jordan) for their support.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. List of obtained plant samples sequences in FASTA format.
Table A1. List of obtained plant samples sequences in FASTA format.
>seq1 [organism= Daphne mucronata] matK gene, partial cds, GenBank Accession Number = MZ851783.
GATGCCTCTTTTTTGCATTTATTACGGCTTCTTTTTTTCTACGAGTATTTAAATTTGAAG60
AGTCTTAGTACTTCACAGAAATGCATTTCTATTTTGAATCCAAGATTCTTCTTGTTCCTA120
TATAATTCTCATATATGTGAATGCAAATTCATTTTCCTTTTTCTCCGTAATCAGTCCTAT180
CATTTACGATCAATATCTTATGTAATCTTTCTTGAACGAATCTATTTCTATGAAAAAATC240
AAACATCTTGTAGAAGTCTCTTCAAATGATTTTCAGAACAACCTATGTTTGTTCAAGGAT300
CCCTTCATACATTTTGTTAGATATCAAGGAAAATGGATTCTCGCTTCAAAGGATACGCCT360
CTTCTGATGAATAAGTGGAAATATTACTTTATAAATTTATGGCAATATCATTTTTACGTA420
TGGTCTCAATCAGGAAGGGTCCGTATAAAGCAATTATGCAAATATTCTCTTGACTTTGTA480
GGCTATCTTTCAGATGTGCAATTAAATCCTTCCGTGGTACGGAGTCAAATGCTAGAAAAC540
TTATTTCTAATAGATAATACTATCAAGAAGTTGGATACAAAAATTCCAATTATTTCTATG600
ATTGGATCATTGTCGAAAGCGAATTTTTGTAACGCATCAGGACATCCCATTAGTAAGCCA660
ACCTGGGTTGATTTGCCAGATTCGGATATAATCGACCGATTTGTGCGTATATACAGAATC720
TTCT
>seq2 [organism= Daphne mucronata] rbcL gene, partial cds, GenBank Accession Number = OK188786.
AATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCGTTCC60
GAGTAACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAAT120
CTTCTACTGGTACATGGACAACTGTGTGGACCGACGGGCTTACCAGCCTTGATCGTTACA180
AAGGGCGATGCTACCACATCGAGCCCGTTCCTGGGGAAGAAAATCAATATATATGTTATG240
TAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTG300
TTGGTAATGTATTTGGGTTCAAAGCTCTGCGCGCTCTACGTCTAGAGGATCTGCGAATCC360
CTACTGCTTATGTTAAAACTTTCCAAGGTCCGCCCCATGGCATCCAAGTTGAAAGAGATC420
AATTGAACAAGTACGGCCGTCCCCTTTTGGGATGTACTATTAAACCTAAATTGGGGTTAT480
CCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCA540
>seq3 [organism=Thymelaea hirsuta] matK gene, partial cds, GenBank Accession Number =OK040774.
CTACGAGTATTTTAATTTGAAGAGTCTTAGTACTTCACAAAAATGCATTTCGATTTTGAA60
TCCAAGATTCTTCTTGTTCTTATATAATTCTCATATATGGGAATGCAAATTCATTTTCCT120
TTTTCTCCGTAATAAGTCCTATCATTTACGATCAATATCTTATGCAATCTTTCTTGAACG180
AATCCATTTGTATGAAAAAATCAAACATCTTGTAGAAGTCTCTTCGAATGATTTTCAGAA240
CAACCTCTGCTTGTTCAAGGATCCCTTCATACATTTTGTTAGATATCAAGGAAAATGGAT300
TCTTGCTTCAAAAGATACGCCTCTTCTGATGAATAAGTGGAAATTTTACTTTATAAATTT360
ATGGCAATATCATTTTTATGTATGGTCTCAATCAGGAAGGGTCCGTATAAAGCAATTATG420
CAAAAATTCTCTTGACTTTTTAGGCTATCTTTCAAATGTGCAATTAAATCCTTCCGTGGT480
ACGGAATCAAATGCTAGAAAACTTATTTCTCATAGATACTACTATCAAGAAGTTGGATAC540
AAAAATTCCAATTATTTATATAATTGGATCATTGTCGAAAGCTAATTTTTGTAACGTATC600
AGGACATCCTATTAGTAAGCCAACCTGGGTTGATTTGCCAGATTCGGATATTATCGACCG660
ATTTGTGCGTATATACAGAATTTTT 685
>seq4 [organism=Thymelaea hirsuta] rbcL gene, partial cds, GenBank Accession Number =OK040775.
AGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGC60
AGCGTTCCGAGTAACCCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCAGTAGC120
TGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGACGGGCTTACCAGCCTTGA180
TCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGGGAAGAAAATCAATATAT240
ATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTAC300
TTCCATTGTTGGTAATGTATTTGGGTTCAAAGCTCTGCGCGCTCTACGTCTAGAGGATCT360
GCGAATCCCTACTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGA420
AAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATT480
GGGGTTATCCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGA540
TTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTT600
CTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCA660
TTACTTGAATGCTACTGCAGGA
>seq5 [organism=Thymelaea hirsuta] rpoC1 gene, partial cds, GenBank Accession Number =OK040776.
GATCATACGGGCGTTCTGTCATTGTTGTTGGCCCCTCACTTTCATTACATCGCTGTGGGT60
TGCCTCGCGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGCGGTCTAATTAGAC120
AACATCTTGCTTCGAACATAGGAGTTGCTAAGAGTAAAATTCGCGAAAAGGGGCCGATTG180
TATGGCAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCGCCTA240
CTCTGCATAGATTAGGGATACAGGCATTCGAGCCCATTTTAGTGGAAGGGCGTGCTATTT300
GTTTACATCCATTGGTTTGTAAGGGATTTAATGCAGACTTTGATGGGGATCAAATGGCTG360
TTCATGTACCTTTGTCTTTAGAGGCTCAAGCAGAGGCTCGTTTACTTATGTTTTCTCATA420
TGAATCTCTTGTCTCCAGCTATTGGGGATCCTATTTCTGTACCAACTCAAGATAAGCGC479

References

  1. Rogers, Z. A World Checklist of Thymelaeaceae (Version 1); Missouri Botanical Garden: St. Louis, MO, USA, 2009; Available online: http://www.tropicos.org/project/thymelaeaceae (accessed on 9 July 2021).
  2. Herber, B. Thymelaeaceae: 373–396. In The Families and Genera of Vascular Plants. IV. Flowering Plants. Dicotyledons. Malvales, Capparales and Non-betalain Caryophyllales; Springer: Berlin/Heidelberg, Germany, 2003. [Google Scholar]
  3. Zaidi, A.; Bukhari, S.M.; Khan, F.A.; Noor, T.; Iqbal, N. Ethnobotanical, phytochemical and pharmacological aspects of Daphne mucronata (Thymeleaceae). Trop. J. Pharm. Res. 2015, 14, 1517–1523. [Google Scholar] [CrossRef]
  4. Royle, J.F. Illustrations of the Botany and Other Branches of the Natural History of the Himalayan Mountains (etc.); Allen: Lawrence, KS, USA, 1839; Volume 1. [Google Scholar]
  5. eflora.org. Available online: http://www.efloras.org/florataxon.aspx?flora_id=5&taxon_id=250062927 (accessed on 7 July 2021).
  6. Kupchan, S.M.; Baxter, R.L. Mezerein: Antileukemic principle isolated from Daphne mezereum L. Science 1975, 187, 652–653. [Google Scholar] [CrossRef] [PubMed]
  7. Rasool, M.A.; Imran, M.; Nawaz, H.; Malik, A.; Kazmi, S.U. Phytochemical studies on Daphne mucronata. J. Chem. Soc. Pak. 2009, 31, 845–850. [Google Scholar]
  8. Moshiashvili, G.; Tabatadze, N.; Mshvildadze, V. The genus Daphne: A review of its traditional uses, phytochemistry and pharmacology. Fitoterapia 2020, 143, 104540. [Google Scholar] [CrossRef] [PubMed]
  9. Amir, G.Z.; Miri, R.; Javidnia, K.; Davoudi, M. Study of cytotoxic activity of Daphne mucronata Royle grown in Iran. Iran. J. Med. Sci. 2001, 26, 146–151. [Google Scholar]
  10. Al-Snafi, A.E. Therapeutic and biological activities of Daphne mucronata—A review. Indo Am. J. Pharm. Sci. 2017, 4, 235–240. [Google Scholar]
  11. Fazal, N.; Khawaja, H.; Naseer, N.; Khan, A.J.; Latief, N. Daphne mucronata enhances cell proliferation and protects human adipose stem cells against monosodium iodoacetate induced oxidative stress in vitro. Adipocyte 2020, 9, 495–508. [Google Scholar] [CrossRef]
  12. Ashraf, I.; Zubair, M.; Rizwan, K.; Rasool, N.; Jamil, M.; Khan, S.A.; Tareen, R.B.; Ahmad, V.U.; Mahmood, A.; Riaz, M. Chemical composition, antioxidant and antimicrobial potential of essential oils from different parts of Daphne mucronata Royle. Chem. Cent. J. 2018, 12, 1–8. [Google Scholar] [CrossRef]
  13. Lutfullah, G.; Shah, A.; Ahmad, K.; Haider, J. Phytochemical screening, antioxidant and antibacterial properties of Daphne mucronata. J. Tradit. Chin. Med. 2019, 39, 764–771. [Google Scholar]
  14. Javidnia, K.; Miri, R.; Bahri, N.R.; Khademzadeh, J.N. A preliminary study on the biological activity of Daphne mucronata Royle. DARU J. Pharm. Sci. 2003, 11, 28–31. [Google Scholar]
  15. Karamolah, K.S.; Mousavi, F.; Mahmoudi, H. Antimicrobial inhibitory activity of aqueous, hydroalcoholic and alcoholic extracts of leaves and stem of Daphne mucronata on growth of oral bacteria. GMS Hyg. Infect. Control 2017, 12. [Google Scholar] [CrossRef]
  16. KEW. Plants of the World Online. Available online: http://www.plantsoftheworldonline.org/taxon/urn:lsid:ipni.org:names:832995-1 (accessed on 7 July 2021).
  17. Bailey, C.; Danin, A. Bedouin plant utilization in Sinai and the Negev. Econ. Bot. 1981, 35, 145–162. [Google Scholar] [CrossRef]
  18. Schmidt, J.; Stavisky, N. Uses ofThymelaea hirsuta (Mitnan) with emphasis on hand papermaking. Econ. Bot. 1983, 37, 310–321. [Google Scholar] [CrossRef]
  19. Badawy, A.M. Review article on Chemical constituents and Biological activity of Thymelaea hirsuta. Rec. Pharm. Biomed. Sci. 2019, 3, 28–32. [Google Scholar] [CrossRef][Green Version]
  20. Amari, N.O.; Bouzouina, M.; Berkani, A.; Lotmani, B. Phytochemical screening and antioxidant capacity of the aerial parts of Thymelaea hirsuta L. Asian Pac. J. Trop. Dis. 2014, 4, 104–109. [Google Scholar] [CrossRef]
  21. Bnouham, M.; Benalla, W.; Bellahcen, S.; Hakkou, Z.; Ziyyat, A.; Mekhfi, H.; Aziz, M.; Legssyer, A. Antidiabetic and antihypertensive effect of a polyphenol-rich fraction of Thymelaea hirsuta L. in a model of neonatal streptozotocin-diabetic and NG-nitro-l-arginine methyl ester-hypertensive rats. J. Diabetes 2012, 4, 307–313. [Google Scholar] [CrossRef] [PubMed]
  22. Akrout, A.; Gonzalez, L.A.; El Jani, H.; Madrid, P.C. Antioxidant and antitumor activities of Artemisia campestris and Thymelaea hirsuta from southern Tunisia. Food Chem. Toxicol. 2011, 49, 342–347. [Google Scholar] [CrossRef] [PubMed]
  23. Trigui, M.; Hsouna, A.B.; Tounsi, S.; Jaoua, S. Chemical composition and evaluation of antioxidant and antimicrobial activities of Tunisian Thymelaea hirsuta with special reference to its mode of action. Ind. Crop. Prod. 2013, 41, 150–157. [Google Scholar] [CrossRef]
  24. El Amrani, F.; Rhallab, A.; Alaoui, T.; El Badaoui, K.; Chakir, S. Hypoglycaemic effect of Thymelaea hirsuta in normal and streptozotocin-induced diabetic rats. J. Med. Plants Res. 2009, 3, 625–629. [Google Scholar]
  25. Azza, Z.; Oudghiri, M. In vivo anti-inflammatory and antiarthritic activities of aqueous extracts from Thymelaea hirsuta. Pharmacogn. Res. 2015, 7, 213. [Google Scholar]
  26. Amari, N.O.; Razafimandimby, B.; Auberon, F.; Azoulay, S.; Fernandez, X.; Berkani, A.; Bouchara, J.-P.; Landreau, A. Antifungal and Antiaging Evaluation of Aerial Part Extracts of Thymelaea hirsuta (L.) Endl. Nat. Prod. Commun. 2021, 16, 1934578X20987932. [Google Scholar]
  27. Hebert, P.D.; Cywinska, A.; Ball, S.L.; Dewaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed]
  28. Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. Camb. Philos. Soc. 2015, 90, 157–166. [Google Scholar] [CrossRef] [PubMed]
  29. Gesto-Borroto, R.; Medina-Jiménez, K.; Lorence, A.; Villarreal, M.L. Application of DNA barcoding for quality control of herbal drugs and their phytopharmaceuticals. Rev. Bras. Farmacogn. 2021, 1–15. [Google Scholar]
  30. Raupach, M.J.; Barco, A.; Steinke, D.; Beermann, J.; Laakmann, S.; Mohrbeck, I.; Neumann, H.; Kihara, T.C.; Pointner, K.; Radulovici, A. The application of DNA barcodes for the identification of marine crustaceans from the North Sea and adjacent regions. PLoS ONE 2015, 10, e0139421. [Google Scholar] [CrossRef] [PubMed]
  31. Galimberti, A.; Labra, M.; Sandionigi, A.; Bruno, A.; Mezzasalma, V.; De Mattia, F. DNA barcoding for minor crops and food traceability. Adv. Agric. 2014, 2014, 831875. [Google Scholar] [CrossRef]
  32. Khaksar, R.; Carlson, T.; Schaffner, D.W.; Ghorashi, M.; Best, D.; Jandhyala, S.; Traverso, J.; Amini, S. Unmasking seafood mislabeling in US markets: DNA barcoding as a unique technology for food authentication and quality control. Food Control 2015, 56, 71–76. [Google Scholar] [CrossRef]
  33. GenBank [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. 2013. Available online: https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 7 July 2021).
  34. Taifour, H.; El-Oqlah, A.; Ghazanfar, S. The Plants of Jordan: An Annotated Checklist; Kew Publishing: London, UK, 2017. [Google Scholar]
  35. Oran, S.; Al-Eisawi, D. Check-list of medicinal plants in Jordan. Dirasat 1998, 25, 84–112. [Google Scholar]
  36. Oran, S.A. The status of medicinal plants in Jordan. J. Agric. Sci. Technol. A 2014, 4, 461–467. [Google Scholar]
  37. Zohary, M. Flora Palaestina; Israel Academy of Sciences and Humanities: Jerusalem, Israel, 1966. [Google Scholar]
  38. Taifour, H.; El-Oqlah, A. Jordan Plant Red List; Royal Botanic Garden: Amman, Jordan, 2015; Volume 1. [Google Scholar]
  39. NCBI. 2021. Available online: https://www.ncbi.nlm.nih.gov/nuccore/?term=Thymelaea+hirsuta (accessed on 7 July 2021).
  40. Kress, W.J.; Erickson, D.L. DNA barcodes: Genes, genomics, and bioinformatics. Proc. Natl. Acad. Sci. USA 2008, 105, 2761–2762. [Google Scholar] [CrossRef]
  41. Van der Bank, M.; Fay, M.F.; Chase, M.W. Molecular phylogenetics of Thymelaeaceae with particular reference to African and Australian genera. Taxon 2002, 51, 329–339. [Google Scholar] [CrossRef]
  42. Fay, M.F.; Bayer, C.; Alverson, W.S.; de Bruijn, A.Y.; Chase, M.W. Plastid rbcL sequence data indicate a close affinity between Diegodendron and Bixa. Taxon 1998, 47, 43–50. [Google Scholar] [CrossRef]
  43. Beaumont, A.J.; Edwards, T.J.; Manning, J.; Maurin, O.; Rautenbach, M.; Motsi, M.C.; Fay, M.F.; Chase, M.W.; Van Der Bank, M. Gnidia (Thymelaeaceae) is not monophyletic: Taxonomic implications for Thymelaeoideae and a partial new generic taxonomy for Gnidia. Bot. J. Linn. Soc. 2009, 160, 402–417. [Google Scholar] [CrossRef]
  44. Kolter, A.; Gemeinholzer, B. Plant DNA barcoding necessitates marker-specific efforts to establish more comprehensive reference databases. Genome 2021, 64, 265–298. [Google Scholar] [CrossRef]
  45. Yu, J.; Xue, J.H.; Zhou, S.L. New universal matK primers for DNA barcoding angiosperms. J. Syst. Evol. 2011, 49, 176–181. [Google Scholar] [CrossRef]
  46. Fay, M.F.; Swensen, S.M.; Chase, M.W. Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew Bull. 1997, 52, 111–120. [Google Scholar] [CrossRef]
  47. Sass, C.; Little, D.P.; Stevenson, D.W.; Specht, C.D. DNA barcoding in the cycadales: Testing the potential of proposed barcoding markers for species identification of cycads. PLoS ONE 2007, 2, e1154. [Google Scholar] [CrossRef]
  48. FinchTV 1.4.0; Geospiza, Inc.: Seattle, WA, USA, 2006; Available online: http://www.geospiza.com (accessed on 7 July 2021).
  49. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  50. Awad, M.; Fahmy, R.M.; Mosa, K.A.; Helmy, M.; El-Feky, F.A. Identification of effective DNA barcodes for Triticum plants through chloroplast genome-wide analysis. Comput. Biol. Chem. 2017, 71, 20–31. [Google Scholar] [CrossRef] [PubMed]
  51. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
Plants 10 02199 g001
Figure 1. Pairwise alignment of Daphne mucronata and Thymelaea hirsuta using dots method (BLAST): (A) matK of Daphne mucronata (Query) and Thymelaea hirsuta (subject); (B) rbcL of Daphne mucronata (Query) and Thymelaea hirsuta (subject).
Figure 1. Pairwise alignment of Daphne mucronata and Thymelaea hirsuta using dots method (BLAST): (A) matK of Daphne mucronata (Query) and Thymelaea hirsuta (subject); (B) rbcL of Daphne mucronata (Query) and Thymelaea hirsuta (subject).
Plants 10 02199 g001
Plants 10 02199 g002
Figure 2. The phylogenetic trees (Neighbor-Joining method) of the top five related species and obtained barcode sequences of Thymelaea hirsuta and Daphne mucronata. (A) Daphne mucronata matK, the sum of branch length is 0.02958153; (B) Daphne mucronata rbcL, the sum of branch length is 0.02199074; (C) Thymelaea hirsuta matK, the sum of branch length is 0.05720029; (D) Thymelaea hirsuta rbcL, the sum of branch length is 0.01331361; (E) Thymelaea hirsuta rpoC1, the sum of branch length is 0.50635593.
Figure 2. The phylogenetic trees (Neighbor-Joining method) of the top five related species and obtained barcode sequences of Thymelaea hirsuta and Daphne mucronata. (A) Daphne mucronata matK, the sum of branch length is 0.02958153; (B) Daphne mucronata rbcL, the sum of branch length is 0.02199074; (C) Thymelaea hirsuta matK, the sum of branch length is 0.05720029; (D) Thymelaea hirsuta rbcL, the sum of branch length is 0.01331361; (E) Thymelaea hirsuta rpoC1, the sum of branch length is 0.50635593.
Plants 10 02199 g002
Table 1. The length of matK, rbcL, and rpoC1 barcode sequences in Daphne mucronata and Thymelaea hirsute, along with the list of available sequences of Daphne mucronata and Thymelaea hirsuta that were retrieved from the GenBank database and our deposited sequences at GenBank [33].
Table 1. The length of matK, rbcL, and rpoC1 barcode sequences in Daphne mucronata and Thymelaea hirsute, along with the list of available sequences of Daphne mucronata and Thymelaea hirsuta that were retrieved from the GenBank database and our deposited sequences at GenBank [33].
Plant SpeciesSequences Length (bp)
matKrbcLrpoC1
Daphne mucronata724540-*
Available GenBank accession numberN/A **N/AN/A
Deposited accession number at GenBankMZ851783OK188786-
Thymelaea hirsuta685682479
Available GenBank accession numberEU002191.1KY656740.1N/A
Deposited accession number at GenBankOK040774OK040775OK040776
* Unspecific amplification was obtained; ** N/A Unavailable at GenBank database.
Table 2. The NCBI-BLAST results retrieved sequences of different species related to Daphne mucronata, sequence coverage (QC), E value, identity percentage, and retrieved accessions.
Table 2. The NCBI-BLAST results retrieved sequences of different species related to Daphne mucronata, sequence coverage (QC), E value, identity percentage, and retrieved accessions.
Plant SpeciesGeneRelated SpeciesQCE-ValueIdentityAccession
Daphne mucronatamatkDaphne longilobata98%099.16%MF786979.1
matkDaphne tangutica98%099.16%MH659257.1
matkDaphne laureola99%098.33%JN894978.1
matkDaphne retusa95%098.85%MH116619.1
matkDaphne giraldii98%098.04%MH659842.1
Daphne mucronatarbcLDaphne mezereum100%099.44%KM360750.1
rbcLDaphne laureola100%099.44%HM849946.1
rbcLThymelaea hirsuta100%099.07%Y15151.1
rbcLWikstroemia pampaninii100%099.07%MN722329.1
rbcLDirca occidentalis100%098.52%MF963193.1
Thymelaea hirsutamatkThymelaea hirsuta100%097.96%EU002191.1
matkDaphne laureola100%096.21%JN894952.1
matkDaphne tangutica100%096.36%MH659257.1
matkDaphne longilobata100%096.36%MF786979.1
matkDaphne mezereum100%095.77%JN894977.1
Thymelaea hirsutarbcLThymelaea hirsuta99%0100.00%KY656740.1
rbcLDaphne laureola99%099.41%HM849946.1
rbcLDaphne mezereum99%099.62%KM360750.1
rbcLStellera chamaejasme99%099.62%AJ295262.1
rbcLWikstroemia monnula99%099.62%KX527076.1
Thymelaea hirsutarpoC1 *Daphne giraldii97%099.15%NC_044085.1
rpoC1 *Daphne tangutica97%099.15%NC_042950.1
rpoC1 *Stellera chamaejasme97%099.15%NC_042714.1
rpoC1 *Daphne kiusiana97%099.15%KY991380.1
rpoC1 *Daphne depauperate97%099.15%MW245833.1
* Complete genome of chloroplast was found with an accession number then genes extracted by Python code.
Table 3. NCBI taxonomy Entrez results; running obtained sequences via blastn and retrieving the lineage hits and number of aligned sequences related to Thymelaeaceae family.
Table 3. NCBI taxonomy Entrez results; running obtained sequences via blastn and retrieving the lineage hits and number of aligned sequences related to Thymelaeaceae family.
Sequence (Organism)TaxonomyNumber of HitsNumber of Organisms
matK (Daphne Mucronata)Thymelaeaceae10432
rbcL (Daphne Mucronata)Thymelaeaceae11966
matK (Thymelaea hirsuta)Thymelaeaceae10532
rbcL (Thymelaea hirsuta)Thymelaeaceae11866
rpoC1 (Thymelaea hirsuta)Thymelaeaceae10143
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Alkaraki, A.K.; Aldmoor, M.A.; Lahham, J.N.; Awad, M. DNA Barcoding of Two Thymelaeaceae Species: Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl. Plants 2021, 10, 2199. https://doi.org/10.3390/plants10102199

AMA Style

Alkaraki AK, Aldmoor MA, Lahham JN, Awad M. DNA Barcoding of Two Thymelaeaceae Species: Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl. Plants. 2021; 10(10):2199. https://doi.org/10.3390/plants10102199

Chicago/Turabian Style

Alkaraki, Almuthanna K., Maisam A. Aldmoor, Jamil N. Lahham, and Mohammed Awad. 2021. "DNA Barcoding of Two Thymelaeaceae Species: Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl" Plants 10, no. 10: 2199. https://doi.org/10.3390/plants10102199

APA Style

Alkaraki, A. K., Aldmoor, M. A., Lahham, J. N., & Awad, M. (2021). DNA Barcoding of Two Thymelaeaceae Species: Daphne mucronata Royle and Thymelaea hirsuta (L.) Endl. Plants, 10(10), 2199. https://doi.org/10.3390/plants10102199

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop