Next Article in Journal
CSF-Exosomal miRNAs and Delayed Cerebral Ischemia: Insights into Pathophysiology but No Definitive Biomarkers
Next Article in Special Issue
Unraveling GDAP1: Bridging Mitochondrial Biology and Peripheral Neuropathy
Previous Article in Journal
Transcriptomic Analysis Corroborates the New Radial Model of the Mouse Pallial Amygdala
Previous Article in Special Issue
Targeted Overexpression of Mitochondrial ALDH2 in Coronary Endothelial Cells Mitigates HFpEF in a Diabetic Mouse Model
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Systemic Lonp1 Haploinsufficiency Mitigates Cardiac Mitochondrial Dysfunction Induced by Cardiomyocyte-Specific Lonp1 Haploinsufficiency via Potential Inter-Organ Crosstalk

by
Sakthijothi Muthu
,
Zinnia Tran
,
Ramasamy Saminathan
,
Pratikshya Shrestha
and
Sundararajan Venkatesh
*
Department of Physiology, Pharmacology and Toxicology, School of Medicine, West Virginia University, Morgantown, WV 26506, USA
*
Author to whom correspondence should be addressed.
Biomolecules 2025, 15(8), 1159; https://doi.org/10.3390/biom15081159
Submission received: 17 July 2025 / Revised: 4 August 2025 / Accepted: 8 August 2025 / Published: 13 August 2025

Abstract

Efficient mitochondrial matrix protein quality control (mPQC), regulated by the mitochondrial matrix protease LONP1, is essential for preserving cardiac bioenergetics, particularly in post-mitotic cardiomyocytes, which are highly susceptible to mitochondrial dysfunction. While cardiac mPQC defects could impair heart function, it remains unclear whether such defects can be mitigated through inter-organ crosstalk by modulating mPQC in extra-cardiac tissues, a potentially valuable strategy given the challenges of directly targeting the heart. To investigate this, we examined two mouse models of Lonp1 haploinsufficiency at young adulthood: a cardiomyocyte-specific heterozygous knockout (Lonp1CKO-HET) and a whole-body heterozygous knockout (Lonp1GKO-HET). Despite similar reductions in Lonp1 mRNA expression in the hearts, Lonp1GKO-HET mice exhibited no cardiac dysfunction, whereas Lonp1CKO-HET mice showed mild cardiac dysfunction accompanied by activation of the mitochondrial stress response, including induction of genes such as Clpx, Spg7, Hspa9, and Hspd1, increased mitochondrial dynamics (Pink1, Dnm1l), reduced mitochondrial biogenesis, and compensatory upregulation of the mtDNA transcriptional regulator Tfam, all occurring without overt structural remodeling. These alterations were absent in Lonp1GKO-HET hearts. Our findings reveal a novel adaptive mechanism in which systemic mPQC deficiency can buffer mitochondrial dysfunction in the heart through inter-organ communication that is lost with cardiomyocyte-specific mPQC disruption. This study identifies systemic modulation of Lonp1-mediated mitochondrial stress pathways as a promising strategy to promote cardiac resilience through protective inter-organ signaling.

Graphical Abstract

1. Introduction

Mitochondrial dysfunction contributes to heart failure, which remains one of the leading causes of heart disease [1,2,3]. Because mitochondria supply approximately 95% of ATP through oxidative phosphorylation (OXPHOS), even subtle mitochondrial dysfunction can disrupt the balance from adaptive to maladaptive remodeling [4]. Beyond ATP production, mitochondria also regulate calcium handling, redox signaling, apoptosis, and innate immunity, all of which demand functional mitochondria [5,6,7]. Such functional mitochondria are governed by various quality control processes, including proteostasis, fusion–fission dynamics, mitophagy, and apoptosis, which act as first responders to cardiac stress [7,8,9,10]. Hence, disturbances in mitochondrial function can lead to chronic compromised cardiac function over time, affecting ATP production.
Cardiomyocytes are uniquely vulnerable to intrinsic mitochondrial stress due to their terminally differentiated nature and limited regenerative capacity. At the same time, targeting these cells therapeutically is particularly challenging. In contrast, many extra-cardiac tissues possess robust regenerative and adaptive capabilities and may serve as potential reservoirs for initiating systemic protective responses [11,12]. Mounting evidence from metabolic and aging research suggests that mitochondrial perturbations in peripheral organs, such as skeletal muscle, liver, or adipose tissue, can trigger systemic stress responses, most notably mitochondrial stress that affects whole-body homeostasis and impacts distant organs [13,14,15]. This raises the intriguing therapeutic possibility of targeting other organs as an alternative to correcting mitochondrial defects within the diseased heart.
Mitochondrial matrix protein quality control (mPQC) is crucial for maintaining cardiac bioenergetics and cellular integrity, particularly in the post-mitotic myocardium. The heart, being a high-demand organ, relies heavily on well-orchestrated mitochondrial proteostasis mechanisms, which are primarily regulated by matrix proteases such as LONP1, along with other counterparts, including CLPXP, m-AAA, and iAAA proteases, to prevent the accumulation of damaged proteins and maintain oxidative phosphorylation [8]. Loss of mPQC function in cardiomyocytes could compromise mitochondrial efficiency, elevate oxidative stress, and lead to maladaptive remodeling and heart failure. However, emerging studies suggest that mitochondrial stress responses are not strictly cell-autonomous and may involve compensatory signaling across tissues [14]. While cardiac mPQC defects could impair heart function, it remains unclear whether such defects can be mitigated through inter-organ crosstalk, a process by which distant organs communicate via circulating metabolites, cytokines, or hormones to trigger adaptive or maladaptive responses. For example, mitochondrial stress in skeletal muscle or liver can release signaling molecules that influence cardiac mitochondrial function, offering a potentially valuable strategy given the challenges of directly targeting the heart. This raises the question: can the heart, when mPQC is impaired, benefit from mitochondrial stress responses initiated in distant tissues?
In this context, LONP1 which is a highly conserved ATP-dependent mitochondrial matrix protease, emerges as a critical regulator of systemic mitochondrial health. Beyond its role in degrading misfolded proteins, LONP1 modulates mitochondrial transcription, redox homeostasis, and stress signaling [8]. A growing body of evidence has implicated Lonp1 haploinsufficiency as a critical contributor to mitochondrial and cardiac dysfunction. For instance, Venkatesh et al. (2019) demonstrated that reduced Lonp1 expression sensitizes cardiomyocytes to ischemia–reperfusion injury, suggesting a key protective role for LONP1 in cardiac stress adaptation [16]. Similarly, De Gaetano et al. (2020) reported that Lonp1 deficiency compromises mitochondrial ultrastructure and bioenergetics in embryonic fibroblasts, while Zhao et al. (2022) demonstrated that deletion of Lonp1 in embryonic cardiac tissues leads to embryonic lethality due to arrested cardiac development [17,18]. Despite these significant advances, the consequences of Lonp1 haploinsufficiency, specifically partial reductions in LONP1 activity, remain poorly understood, especially in young adult cardiomyocytes. Most studies to date have focused on either complete gene deletion or overexpression models, leaving a critical gap in understanding the physiological and pathophysiological relevance of more subtle, chronic deficits in Lonp1 expression, which may better reflect disease or aging contexts. We hypothesized that moderate impairment of LONP1 in peripheral tissues might prime the organism to better tolerate mitochondrial dysfunction elsewhere, including in the heart. Such an adaptive preconditioning or “mitochondrial hormesis” model has been proposed in the context of aging and neurodegeneration, but its relevance to cardiac disease remains poorly defined [19,20].
To test this hypothesis, we employed two mouse models of Lonp1 haploinsufficiency, a cardiomyocyte-specific heterozygous knockout (Lonp1CKO-HET) and a global heterozygous knockout (Lonp1GKO-HET), as homozygous global Lonp1 deletion is embryonic lethal. Our study aimed to determine whether systemic modulation of mitochondrial proteostasis by partial deletion of Lonp1 could indirectly protect the heart in settings of cardiac mPQC dysfunction. By comparing the mitochondrial stress signatures, cardiac function, and compensatory responses in these models, we reveal that systemic mPQC deficiency, but not cardiac-specific deficiency, shows adaptive mechanisms that safeguard the heart. These findings suggest a novel therapeutic paradigm in which targeting mitochondrial proteostasis in extra-cardiac tissues may offer cardioprotection in conditions of heart disease.

2. Materials and Methods

2.1. Reagents and Chemicals

All TaqMan assay probes were purchased from Bio-Rad, CA, USA, except for the 18S probe (Cat. # 4333760F, Applied Biosystems, Life Technologies, CA, USA) and the Tert probe (Cat. # 4458368, Applied Biosystems, Thermo Fisher, CA, USA) (Table S1). Chemicals were purchased from BioRad, Sigma, Applied Biosystem, Southern Biotech, Electron Microscopy Sciences, and GenScript unless otherwise mentioned.

2.2. Animal Models

All animal procedures were approved in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of West Virginia University, USA (approval code 2203051893 on 6 April 2022). The C57BL/6 background whole-body heterozygous knockout Lonp1GKO-HET mice were obtained from Dr. Carlos López-Otín (Universidad de Oviedo, Spain), and described previously in Quiros et al., 2014 [21]. Cardiac-specific Lonp1 heterozygous knock out (Lonp1CKO-HET) mice were generated using homozygous Lonp1-floxed mice (Lonp1flfl) (Obtained from Dr. Bin Lu, University of South China) crossed with mice expressing Cre recombinase under the endogenous α myosin heavy chain (α-MHC) promoter procured from Jackson Laboratory (Strain: 005657). Littermates of WT and Cre-WT mice (referred to Cre-Control) were used as control mice in all experiments, respectively. The young adult mice (~12-week-old) from both sexes were included in the study. Twelve-week-old mice were chosen to evaluate early mitochondrial and cardiac phenotypes before the onset of age-related changes, allowing for the detection of primary effects due to Lonp1 haploinsufficiency without secondary influences. All the mice were housed (minimum 3 to maximum 5 per cage) and were fed with standard laboratory chow in a temperature- and light/dark cycle-controlled animal facility room with free access to food and water.

2.3. Genotype

Tail and Ear biopsies were collected from the litter to determine the genotype of the mice. DNA was extracted from the samples by lysing them at 75 °C for 10 min, followed by 5 min of incubation at 95 °C for enzyme activation using the kappa hot start mouse genotyping kit (Cat. # 07961804001, Roche Diagnostics, IN, USA). End-point polymerase chain reaction (PCR) was performed using the following primers synthesized by Eton Bioscience Inc., CA, USA. For Lonp1GKO-HET, we employed Forward (5′CCCTGACTGCAGAGATTGTGAA3′), (5′CAGGACATAGCGTTGGCTACC3′), and a common reverse primer (5′TTCAGTGCCAGTGCCTTAGAGT3′), whereas for the Lonp1CKO-HET we employed both flox; forward (5′GGATCACCCTGAGTTCCCAGTT3′) and reverse (5′CACCACCTATAGCAGGTGCGAA3′), and Cre; forward (5′GCCTGCATTACCGGTCGATGC3′), and reverse (5′CAGGGTGTTATAAGCAATCCC3′) primers. PCR products were amplified using a recommended protocol, and 2% agarose gel electrophoresis was used to separate the PCR products and determine the genotype. The WT genotype is indicated by the presence of a band at 200 bp, Lonp1GKO-HET bands at 200 bp plus 300 bp, αMHC Cre band at 501 bp, and Lonp1flfl bands at 473 bp plus 573 bp.

2.4. Transthoracic Echocardiographic Functional Assessment

Echocardiography on mice was performed by a single trained individual in a blindfolded approach in the WVU Animal Models and Imaging Facility. The mice were sedated with 1.5–2% isoflurane anesthesia via nose cone to ensure consistent and precise measurements of heart rate and function of left ventricle (LV). The echocardiogram images were acquired in parasternal long (PSLAX) and short axis (SAX) using a linear array transducer UHF57x (57 MHz) on the VevoF2 Micro-Ultrasound Imaging System (Visual Sonics, Toronto, ON, Canada). Both Brightness mode (B-mode) and Motion mode (M-mode) images of the heart were acquired at the level of papillary muscles to measure the ejection fraction (EF), fractional shortening (FS), stroke volume (SV), cardiac output (CO), left ventricular systolic, diastolic volume and diameter, anterior and posterior wall thickness. The echocardiographic analysis was performed utilizing a speckle tracking algorithm in VisualSonics Vevo Strain software 2.0 (Vevo F2, Visual Sonics, Toronto, ON, Canada) by an individual blindfolded to the mouse identifier. The endocardium and epicardium were tracked and marked up via speckle tracking and these segments were analyzed for at least three to five consecutive cardiac cycles to define the highest value achieved per parameter and averaged to give a comprehensive perspective of the heart. Raw values are provided in Table S2.

2.5. Histological Analysis of Cardiac Morphology

Mice were weighed and euthanized by cervical dislocation. The hearts were excised, weighed, rinsed in 1× ice-cold PBS, and dry blotted. The excised heart tissue was sliced horizontally using a Zivic Mouse Heart Slicer Matrix (Cat. # HSMS001-1, Zivic Instruments, PA, USA), enabling precise tissue region, and then fixed in a 10% Formalin solution (Sigma Aldrich). Subsequently, the tissues were hydrated and dehydrated in graded alcohol solutions, cleared with xylene, and embedded in paraffin wax. The paraffin blocks of the hearts were cut at 5 µm, deparaffinized in descending graded alcohol, and stained with hematoxylin and eosin (HE), and Masson’s Trichrome. Collagen volume fraction (CVF) was quantified by analyzing Masson’s Trichrome-stained heart sections using FIJI (ImageJ 1.54f, Fiji distribution version 2.15.0, National Institute of Health, USA) software. For each sample, multiple fields were randomly selected across the left ventricular myocardium. The collagen-stained area (blue) and total tissue area were quantified by applying a standardized color thresholding algorithm that selectively isolates blue pixels corresponding to collagen matrix, as distinct from the red-stained muscle fibers. CVF was then calculated as the ratio of collagen-stained area to total tissue area, and the mean CVF value from multiple fields was averaged per sample. These per-sample averages were used for statistical comparison across groups and expressed as a percentage of total tissue area. This method enables objective and reproducible quantification of myocardial fibrosis. Images were acquired at 10× and 40× magnification using the MIF Olympus slide scanner (Both Brightfield and fluorescence modes). Raw values are provided in Table S2.

2.6. Gene Expression Assay by RT-PCR

The experimental mice heart tissues were snap frozen in liquid nitrogen, ground to a fine powder employing pre-chilled mortar, followed by homogenization, and total RNA was extracted using the Qiagen RNeasy mini kit for fibrous tissue (Cat# 74704, Qiagen Inc.). The concentration of RNA (ng/µL) in each sample was measured using a Denovix 11 series Spectrophotometer. The RNA (100–500 ng) was utilized to synthesize cDNA by employing an iScriptTM cDNA synthesis kit from BioRad (Cat #170 8891), followed by cDNA quantification. qRT-PCR was performed employing TaqMan-based gene expression assays for each gene target as listed in Table S1. The relative fold expression was normalized against 18S and quantified using the ΔΔCt method. The list of TaqMan gene expression assays used in this study is provided in Table S1, and the corresponding raw Ct and ΔΔCt values used for calculating relative expression are provided in Table S2.

2.7. Determination of Mitochondrial DNA Content

Relative levels of mitochondrial DNA copy number (mtDNA-CN) from the heart tissues were measured using a real-time qPCR assay. Genomic DNA was isolated from mouse heart tissue following the modified simple DNA isolation method described in Muthu et al., 2025 [22]. 100 ng of the isolated genomic DNA was employed to quantify relative mtDNA content by amplifying both the mt-Co1 gene and the nuclear Tert gene (Table S1). Amplification was performed using BioRad Universal PCR Master Mix (Cat#1725134, BioRad, CA, USA). The qPCR conditions included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. All reactions were carried out in triplicate. The relative fold quantitation of the mtDNA copy number was calculated using the ΔΔCt method. Raw values are provided in Table S2.

2.8. Mitochondria Isolation from the Whole Heart

Hearts were harvested, squeezed to remove blood, and rinsed in ice-cold PBS. Then, mitochondrial isolation was performed at 4 °C using buffer 1 [100 KCL mmol/L, 50 MOPS mmol/L, 5 MgSO4·7H2O mmol/L, 1 EGTA mmol/L, and 1 ATP mmol/L (PH 7.4)] at a 1:10 (weight: volume) ratio to homogenize the heart tissue. The samples were centrifuged at 700× g for 10 min, followed by the collection of the supernatant and subsequent centrifugation at 10,000× g. The pellet was washed in buffer 1 and centrifuged twice at 10,000× g. The precipitated pellet from 700 g was further processed in buffer 2 [100 KCL mmol/L, 50 MOPS mmol/L, and 0.5 EGTA mmol/L (PH 7.4)], and digested in trypsin (5 mg/g) for 10 min, then the digestion was stopped by adding protease inhibitor cocktail and centrifuged at 700× g for 10 min, the supernatant was collected and recentrifuged at 10,000× g for 10 min. Mitochondria from the initial supernatant and digested pellets were combined in a sucrose buffer that contains 220 sucrose mmol/L, 70 mannitol mmol/L, 10 Tris-HCL mmol/L, and 1 EDTA mmol/L (PH 7.4). The further purification of total mitochondria was performed using a sucrose gradient of 23%, 15%, 10%, and 3% Percoll solution and centrifuging in a Beckman Optima MAX-XP Ultracentrifuge (Beckman Coulter, Fullerton, CA, USA) at 32,000× g for 8 min and then the final mitochondrial isolation was stored in KME buffer [KCL 100 mM, MOPS 50 mM, and EGTA 0.5 mM (PH 7.4)]. The final pellet of mitochondria was used for mitochondrial ETC complex activity analysis.

2.9. Enzyme Activity of Electron Transport Complexes I–V

The total protein concentration was determined by the BCA method from isolated mitochondria. The ETC complexes I, II, III, and IV, activities were measured using protein homogenates as described in Kunovac et al. 2021 [23]. Briefly, the activities of ETC complexes I to IV were determined by measuring the oxidation of NADH at 340 nm in the presence of decyl ubiquinone and rotenone (I), 2,6-dichlorophenolindophenol (DCPIP) reduction at 600 nm (II), cytochrome C reduction at 550 nm (III), and oxidation of reduced cytochrome c at 550 nm (IV), respectively. The complex V activity was determined by measuring oligomycin-sensitive ATPase activity through the pyruvate kinase and phosphoenolpyruvate pathway. The final values were represented as unit/nanogram or milligram of protein (I–V), where unit = nanomoles of oxidized substrate (minute−1). Raw values are provided in Table S2.

2.10. Statistical Analysis

The significant differences between control and Lonp1 haploinsufficiency groups of both Lonp1GKO-HET and Lonp1CKO-HET models were individually compared using the unpaired Student’s t-test using GraphPad Prism software version 10.4.2, and p < 0.05 was considered statistically significant. Data are expressed as mean ± standard error of the mean.

3. Results

3.1. Cardiac-Specific but Not Global Lonp1 Haploinsufficiency Increases Heart Weight

At 12 weeks of age, global Lonp1GKO-HET and cardiomyocyte-specific Lonp1CKO-HET mice were phenotypically indistinguishable from their respective control groups regarding overall body weight. A significant ~50% reduction in Lonp1 mRNA expression is observed in both heterozygous models compared to their respective controls, confirming the efficiency of the partial knock-out in these groups (Figure 1A). As expected, male mice weighed more than their female littermates (Figure S1); however, no significant differences in body weight were observed compared to controls in either group (Figure 1B,C). However, the Lonp1CKO-HET mice displayed a significantly increased heart weight comparable to Cre-Control hearts, while the Lonp1GKO-HET mice exhibited a modest but not significant increase in heart weight relative to their wild-type control hearts (Figure 1D,E). These findings suggest that the cardiac-specific partial loss of Lonp1 within cardiomyocytes may be more vulnerable to the loss of Lonp1, while systemic loss of Lonp1 may be compensatory.

3.2. Cardiomyocyte-Specific Lonp1 but Not Global Lonp1 Haploinsufficiency Show Mild Cardiac Dysfunction

High-resolution transthoracic echocardiography performed at 12 weeks (Figure 2A,B) showed that Lonp1CKO-HET mice showed a significant reduction in left-ventricular ejection fraction (EF), fractional shortening (FS), stroke volume (SV), cardiac output (CO), and left-ventricular mass (LV mass) when compared to their Cre-Control littermates (Figure 2C). In addition, the left ventricular systolic volume and diameter showed a significant increase, accompanied by a significant reduction in left ventricular systolic and diastolic anterior and posterior wall thickness (Figure 2D). Conversely, global heterozygous (Lonp1GKO-HET) hearts exhibited modest downward trends in ejection fraction (EF) and fractional shortening (FS), with little change in systolic and diastolic posterior wall thickness compared to wild-type animals (Figure 2C,D). The heart rate remained comparable in both groups (Figure 2C). Collectively, these data indicate that partial reduction of Lonp1 in a cardiomyocyte-specific manner impairs baseline systolic function in young adult mice, whereas systemic heterozygosity does not measurably compromise baseline systolic function in young adult mice.

3.3. Assessment of Cardiac Remodeling in Lonp1-Haploinsufficient Mice

To evaluate whether partial loss of Lonp1 affects myocardial structure, we performed histological analyses of transverse heart sections from 12-week-old male and female mice across four genotypes: WT, Lonp1GKO-HET, Cre-Control, and Lonp1CKO-HET. Haematoxylin and eosin (HE) staining revealed preserved global myocardial architecture in WT, and Lonp1GKO-HET hearts across sexes, with compact and uniformly aligned cardiomyocytes and no signs of inflammatory infiltration or cellular degeneration. In contrast, Lonp1CKO-HET hearts, particularly those from male mice, exhibited a trend toward mild myocardial remodeling, characterized by subtle myocyte irregularity, increased variability in nuclear alignment, and a slightly more heterogeneous tissue appearance. In Lonp1CKO-HET hearts, a trend toward localized, mild perivascular and interstitial collagen accumulation was observed in males. Collectively, these results suggest that cardiac-specific haploinsufficiency of Lonp1 may initiate early signs of structural remodeling. However, these changes are more of trends rather than definitive pathological alterations. These trends were less prominent in female Lonp1CKO-HET hearts, suggesting a potential sex-dependent difference in the structural response to cardiac-specific Lonp1 haploinsufficiency (Figure 3A and Figure S2). To assess fibrotic remodeling, we performed Masson’s trichrome staining on matched heart sections. Lonp1GKO-HET hearts exhibited minimal collagen deposition, consistent with normal myocardial homeostasis, compared to their wild-type (WT) littermates. In Lonp1CKO-HET hearts, trichrome staining revealed localized, mild perivascular and interstitial collagen accumulation in males, while female hearts showed no significant fibrosis compared to their Cre-Control littermates (Figure 3B and Figure S2). Despite these observations, overall collagen deposition remained low, and quantitative collagen fraction analysis did not reveal statistically significant differences across groups. Collectively, these results indicate that cardiac-specific haploinsufficiency of Lonp1 is sufficient to initiate early structural remodeling without triggering widespread fibrosis at 12 weeks of age. The absence of overt fibrotic changes suggests that these alterations may represent an adaptive response to early mitochondrial stress rather than irreversible pathological remodeling, with potential modulation by sex-specific factors.

3.4. Cardiac-Specific Lonp1 Haploinsufficiency Induced Mitochondrial Stress Response in the Heart, in Contrast to Global Lonp1 Haploinsufficient Mice

As transcript levels are often more reliable indicators than proteins under stress induction conditions because transcriptional responses occur rapidly and directly reflect gene activation before translational or post-translational modifications influence protein abundance, we investigated the transcript levels of key mitochondrial proteases, chaperones, and stress markers such as Clpp, Clpx, Spg7, Afg3l2, Hspa9, Hspd1, Atf3 and Atf4 in heart tissue from 12-week-old WT, Lonp1GKO-HET, Cre-Control and Lonp1CKO-HET mice hearts.
Among the investigated transcripts, Clpp expression remained unchanged across all groups, while Clpx expression was significantly upregulated in Lonp1CKO-HET hearts compared to their Cre-Control littermates (Figure 4). Similarly, Spg7 mRNA levels were significantly elevated in Lonp1CKO-HET hearts, whereas Afg3l2 levels showed no significant difference among the genotypes (Figure 4). The mitochondrial chaperones Hspa9 and Hspd1 were both significantly increased in Lonp1CKO-HET mice compared to Cre-Controls, with no change in the expression of Atf4 and Atf3, two transcription factors involved in integrated stress response signaling (Figure 4). In contrast, Lonp1GKO-HET hearts exhibit no measurable differences in the expression of Hspa9, Hspd1, Atf4, and Atf3 compared to their WT littermates (Figure 4). Together, these findings suggest that the partial loss of Lonp1, specifically in cardiomyocytes but not in global tissues, activates a tissue-specific stress response characterized by the selective upregulation of stress-responsive proteases and chaperones, without affecting global integrated stress response markers.

3.5. Cardiac-Specific Partial Loss of Lonp1 Alters the Expression of Mitochondrial Biogenesis but Not in Global Lonp1 Haploinsufficiency Hearts

The heart is highly dependent on mitochondrial metabolism, and sustaining a healthy mitochondrial population is of utmost importance for cardiac homeostasis [24]. To investigate whether Lonp1 haploinsufficiency affects mitochondrial DNA (mtDNA) content and the transcription of mitochondrial genes, we analyzed the relative mtDNA content, expression of mitochondrial transcription factor A (Tfam), and selected nuclear- and mtDNA-encoded genes involved in oxidative phosphorylation (OXPHOS). Relative mtDNA content remained unchanged in both Lonp1GKO-HET and Lonp1CKO-HET hearts, compared to their respective littermate controls (Figure 5A). In contrast, expression of Tfam was significantly upregulated in Lonp1CKO-HET hearts compared to Cre-Controls (Figure 5A). The expression of mt-Nd4 and mt-Nd6, encoding subunits of Complex I, was significantly reduced in Lonp1CKO-HET hearts (Figure 5B). Similarly, the expression of nuclear-encoded Complex I subunit Ndufs4 was also significantly lower in Lonp1CKO-HET compared to Cre-Control (Figure 5B). We also examined genes encoding subunits of Complex IV and Complex V; mt-Co1 and mt-Co2, which encode cytochrome c oxidase subunits I and II, were significantly downregulated in Lonp1CKO-HET hearts (Figure 5B). Expression of mt-Atp6, a subunit of ATP synthase, showed no significant changes across genotypes (Figure 5B). Together, these findings suggest that cardiac-specific Lonp1 haploinsufficiency disrupts the transcriptional regulation of key mitochondrial genes involved in biogenesis and oxidative phosphorylation, without altering overall mtDNA content, which is not observed in Lonp1GKO-HET hearts.

3.6. Assessment of Mitochondrial Respiratory Chain Complex Activities in Lonp1 Haploinsufficient Hearts

To determine whether Lonp1 haploinsufficiency affects the activities of electron transport chain (ETC) Complexes I–V in heart lysates from 12-week-old mice of different genotypes (Figure 6). The activities of Complexes I, II, III, and IV were not significantly different among the groups compared with their respective controls. However, Complex V (ATP synthase) activity was significantly increased in Lonp1GKO-HET hearts compared to their WT littermates, while Complex V activity in Lonp1CKO-HET remained comparable to Cre-Control, suggesting a differential compensatory adaptation in systemic versus cardiac-restricted Lonp1 haploinsufficiency.

3.7. Cardiomyocyte-Specific Lonp1 Haploinsufficiency Disrupts Mitochondrial Dynamics

A key regulator of mitochondrial dynamics and quality control genes, like Pink1, Dnm1l, Fis1, and Mfn1 transcripts, was analyzed in both mouse models to evaluate whether Lonp1 deficiency impacts mitochondrial dynamics and quality control pathways. Expression of the mitophagy regulator Pink1 was significantly elevated in Lonp1CKO-HET hearts compared to controls (Figure 7). Among fission-related genes, Dnm1l was induced considerably in Lonp1CKO-HET hearts, while Fis1 expression remained unchanged across all genotypes (Figure 7). The mitochondrial fusion gene Mfn1 was significantly downregulated in Lonp1CKO-HET compared to their Cre-Control littermates, suggesting a shift in the balance between fission and fusion. In contrast, no significant changes in the expression of these mitochondrial dynamic markers were noted in the global Lonp1 haploinsufficiency hearts.

4. Discussion

Our findings demonstrate that cardiomyocyte-specific haploinsufficiency of Lonp1 leads to early signs of cardiac and mitochondrial stress, whereas global haploinsufficiency does not elicit comparable changes. A multifunctional mitochondrial LONP1 is crucial for cellular proteostasis, whereas homozygous deletion of Lonp1 in mice results in embryonic lethality [8,21]. Therefore, we have employed global heterozygous mice, which are born normal and live similarly to wild-type mice, and compared them with cardiac-specific heterozygous mice [16]. Our results highlight the unique vulnerability of post-mitotic cardiomyocytes to impaired mitochondrial proteostasis and suggest that systemic, extra-cardiac mitochondrial stress resulting from Lonp1 haploinsufficiency may buffer against such localized stress, possibly through compensatory inter-organ signaling.
The differential mitochondrial stress response between the two models further underscores this tissue-specific sensitivity. Lonp1CKO-HET hearts exhibited robust transcriptional upregulation of mitochondrial stress markers, including Clpx, Spg7, Hspa9, and Hspd1, without alterations in integrated stress response factors like Atf4 and Atf3. A similar stress response, serving as an adaptive mechanism, has been observed in other models of Lonp1 inhibition [25]. The activation of the mitochondrial unfolded protein response (UPRmt) mitigates mitochondrial dysfunction and preserves cellular viability in the absence of a broader integrated stress response, suggesting a conserved protective role for LONP1-regulated proteostasis across tissues [25]. Conversely, Lonp1GKO-HET hearts did not show similar transcriptional alterations, suggesting that systemic Lonp1 reduction may activate compensatory mechanisms in extra-cardiac tissues that mitigate mitochondrial stress specifically in the heart. This lack of stress response in the global model implies a potential inter-organ communication axis that buffers cardiac mitochondria against proteostasis imbalance, possibly through circulating factors or metabolic adaptations [26]. These findings underscore the concept that localized mitochondrial stress, such as in post-mitotic cardiomyocytes, cannot always be recapitulated by global gene dosage reduction, highlighting the heart’s unique susceptibility and limited capacity to compensate for intrinsic mitochondrial dysfunction.
Mitochondrial biogenesis and OXPHOS gene expression were also differentially affected between the two models of Lonp1 haploinsufficiency. Interestingly, although mtDNA content remained unchanged, the significant upregulation of Tfam in Lonp1CKO-HET hearts may reflect a pre-emptive compensatory mechanism aimed at enhancing mitochondrial biogenesis and transcriptional capacity in response to early mitochondrial stress, consistent with an adaptive attempt to preserve mitochondrial function. This was accompanied by a notable downregulation of mitochondrial-encoded subunits of Complex I (mt-Nd4, mt-Nd6) and Complex IV (mt-Co1, mt-Co2), suggesting impaired mitochondrial respiratory capacity in cardiomyocytes under proteostatic stress. These findings are consistent with previous reports indicating that LONP1 is required for maintaining mtDNA integrity and mitochondrial transcription, and its loss can lead to defective respiratory chain complex assembly [21]. It has been demonstrated that LONP1 reduction in different cell types, such as fibroblasts and neonatal rat ventricular myocytes, led to decreased levels of respiratory chain function and mitochondrial membrane potential, implicating LONP1 as a key regulator of mitochondrial protein homeostasis and energetic function, consistent with the observation in Lonp1CKO-HET hearts [27].
In contrast, Lonp1GKO-HET hearts did not exhibit similar transcriptional changes in OXPHOS genes. Surprisingly, they showed an increase in Complex V activity, suggesting a systemic adaptation that enhances mitochondrial ATP production. This finding aligns with evidence that moderate mitochondrial stress can trigger adaptive responses via mitochondrial hormesis (mitohormesis), where mild impairment leads to compensatory upregulation of mitochondrial function in distant tissues [19,20]. Although we did not directly assess the origin of systemic compensation in this study, our findings support the concept that Lonp1 haploinsufficiency in extra-cardiac tissues can trigger adaptive responses that mitigate cardiac mitochondrial dysfunction. Previous studies have shown that mitochondrial perturbations in metabolically active organs such as skeletal muscle, liver, and adipose tissue can initiate the release of mitokines, a hormone-like signals such as FGF21 and GDF15, which exert systemic effects on mitochondrial biogenesis, oxidative stress, and cellular metabolism in distant organs, including the heart [13,14,15,26,28]. In particular, FGF21, which is secreted by the liver and skeletal muscle in response to mitochondrial stress, has been shown to improve mitochondrial function and reduce inflammation in cardiac tissues [28]. Likewise, GDF15 is another stress-responsive cytokine that mediates metabolic adaptation in response to mitochondrial dysfunction and has been implicated in protective cardiac signaling [26]. Therefore, it is possible that Lonp1GKO-HET mice, which exhibit moderate mitochondrial proteostatic imbalance in multiple organs, activate such mitokine signaling pathways that confer endocrine-mediated cardio protection.
Moreover, it has been demonstrated that mitochondrial stress in skeletal muscle can upregulate antioxidant defense and reduce cardiac oxidative stress, potentially through altered nutrient flux or humoral signaling [26]. The lack of mitochondrial stress response activation in Lonp1GKO-HET hearts, combined with increased Complex V activity, supports the concept of a systemic metabolic preconditioning effect, a phenomenon consistent with mitohormesis, where mild stress induces adaptive resilience [19,29,30]. While the specific organ responsible for initiating the compensatory response remains to be determined, skeletal muscle and liver are strong candidates due to their high mitochondrial density, secretory profile, and established roles in mitokine production. Notably, the lack of such a compensatory response in Lonp1CKO-HET hearts underscores the tissue-autonomous vulnerability of cardiomyocytes to mitochondrial proteostasis imbalance and further supports the notion that systemic mitochondrial stress may paradoxically buffer local dysfunction through endocrine or metabolic crosstalk.
Furthermore, alterations in mitochondrial dynamics were evident only in Lonp1CKO-HET hearts, which displayed significant upregulation of Pink1 and Dnm1l, markers of mitophagy and mitochondrial fission, respectively, alongside downregulation of the fusion regulator Mfn1. These changes reflect an adaptive mitochondrial quality control (QC) mechanism that promotes organelle turnover and remodeling in response to proteostatic stress. This pattern is consistent with prior reports that Lonp1 deficiency leads to the activation of mitophagy via the Pink1/Parkin signaling pathway [28,31]. The downregulation of Mfn1, which is the major driver of mitochondrial fusion, is also in line with the observed suppression of fusion machinery, which facilitates mitochondrial fragmentation in its absence; however, whether that helps in the removal of damaged mitochondria via mitophagy is unclear [32,33]. In contrast, these mitochondrial dynamic regulators remained unchanged in Lonp1GKO-HET hearts, suggesting that systemic reduction of Lonp1 does not elicit the same local mitochondrial stress activation in the heart. This reinforces the concept that systemic mitochondrial proteostasis disruption is buffered by extra-cardiac tissues, preventing maladaptive mitochondrial remodeling within the myocardium. Such buffering may be mediated through systemic metabolic adaptations or mitokine signaling, as proposed in models of mild mitochondrial dysfunction, where whole-body adaptations preserve organ-specific mitochondrial integrity [28,34].
In summary, our study reveals that the heart’s reliance on efficient mitochondrial proteostasis makes it uniquely sensitive to Lonp1 loss when not supported by systemic compensatory mechanisms. While systemic Lonp1 haploinsufficiency appears to maintain cardiac function through unidentified protective inter-organ mechanisms, as targeted cardiac loss results in early functional decline and mitochondrial stress. These findings underscore the importance of tissue context in mitochondrial matrix protein quality control, suggesting that enhancing systemic mitochondrial proteostasis could be a novel therapeutic strategy for protecting the heart in mitochondrial disorders. Our study offers important translational insights into mitochondrial-targeted therapies for cardiac disease. We show that systemic Lonp1 haploinsufficiency triggers mild mitochondrial stress and adaptive responses (mitohormesis), potentially preconditioning the heart against dysfunction. In contrast, cardiomyocyte-specific Lonp1 reduction leads to a trend towards cardiac dysfunction without systemic compensation, highlighting the heart’s reliance on intrinsic LONP1 activity. These findings suggest that systemic modulation of LONP1 may be a safer and more flexible therapeutic approach than direct cardiac targeting, offering a novel strategy to enhance cardiac resilience through inter-organ mitochondrial signaling.
Our study focused on 12-week-old mice to assess early mitochondrial stress responses and cardiac function before potential age-associated compensatory changes. While this time point provides insights into early pathophysiological events, it remains unknown whether Lonp1 haploinsufficiency leads to progressive deterioration over time. Previous studies suggest that mitochondrial proteostasis deficits can accumulate with age [8,22,25], raising the possibility that older Lonp1CKO-HET mice may exhibit more severe cardiac remodeling or dysfunction. However, longitudinal or age-cohort studies are underway in these specific models.

4.1. Limitations

Our study has several limitations. Firstly, while our findings suggest protective inter-organ communication in systemic Lonp1 haploinsufficiency, we did not directly identify the source organs or molecular mediators (e.g., mitokines or metabolic hormones) responsible for this compensation. However, based on existing literature, we predict that skeletal muscle and liver could be the primary contributors through the secretion of FGF21 and GDF15 in response to mitochondrial stress. Secondly, the analyses were limited to young adult mice under baseline conditions, and it remains unclear how these models respond to aging or cardiac stress. Lastly, potential sex-specific effects were noted but not fully explored due to limited sample size, warranting further investigation in future studies.

4.2. Future Direction

Future studies should focus on identifying the specific extra-cardiac tissues and signaling pathways involved in this systemic compensation. Additionally, exploring whether enhancing mitochondrial proteostasis in peripheral organs can confer cardioprotection under pathological conditions may open new avenues for treating mitochondrial cardiomyopathies. Furthermore, evaluating the plasma levels of mitokines such as FGF21 and GDF15 and determining their expression profiles in skeletal muscle and liver in Lonp1GKO-HET mice could offer insights into the inter-organ crosstalk mechanism. Incorporating ultrastructural analyses using transmission electron microscopy (TEM) in the future will be valuable for directly visualizing mitochondrial morphology (e.g., swelling, fragmentation, cristae structure) and validating the transcriptional and functional findings observed in Lonp1 haploinsufficient hearts. Future studies incorporating omics-based approaches, including proteomics, metabolomics, and transcriptomics, will be essential to identify circulating factors and molecular networks that mediate inter-organ crosstalk in response to Lonp1 haploinsufficiency.

5. Conclusions

In conclusion, our study demonstrates that cardiomyocyte-specific haploinsufficiency of Lonp1 leads to mitochondrial stress and a trend towards cardiac dysfunction. In contrast, systemic Lonp1 haploinsufficiency elicits no such pathology, suggesting a protective role of inter-organ compensatory mechanisms. The heart’s unique vulnerability to mitochondrial proteostasis disruption, especially in post-mitotic cardiomyocytes, underscores the critical importance of tissue context in maintaining mitochondrial function. The absence of mitochondrial stress responses and maladaptive remodeling in globally haploinsufficient mice highlights the potential for systemic buffering, possibly via mitokine signaling or metabolic adaptations. These findings not only emphasize the indispensable role of LONP1 in sustaining cardiac mitochondrial homeostasis but also reveal a novel paradigm in which enhancing systemic mitochondrial quality control may offer therapeutic benefits in cardiac disease settings characterized by mitochondrial dysfunction.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom15081159/s1, Figure S1: Gross morphology assessment of Lonp1GKO-HET and Lonp1CKO-HET female mice; Figure S2: Histological evaluation of cardiac remodeling in Lonp1GKO-HET and Lonp1CKO-HET mice; Table S1: List of TaqMan gene expression assays; Table S2: Raw values for qPCR, echocardiography, histology, and complex activity assays.

Author Contributions

Conceptualization, S.M. and S.V.; methodology, S.M., Z.T., R.S., P.S., and S.V.; software, S.M.; formal analysis, S.M.; investigation, S.M., Z.T., R.S., P.S., and S.V.; resources, S.V.; data curation, S.M.; writing—original draft preparation, S.M., and S.V.; writing—review and editing, S.M., Z.T., R.S., P.S., and S.V.; supervision, S.V.; project administration, S.V.; funding acquisition, S.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Institutes of Health (grant number R01HL157335) and the American Heart Association grants 20CDA35260096, 20TPA3542000, to S.V. and 24POST1196987 to S.M.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of West Virginia University, USA (approval code 2203051893 on 06 April 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

Raw data for the original contributions presented in this study are included in the Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to acknowledge the Mitochondrial Phenotyping Core, supported by the Community Foundation for the Ohio Valley Whipkey Trust, the WVU Health Sciences Center, and NIH grant P20GM103434. Animal models and Imaging facility for using VisualSonics Vevo F2: are supported by NIH grant # P20GM144230 and Workstation by NIH grant # P30GM103488. Microscopic imaging experiments were performed using the Olympus VS120 Slide Scanner (supported by the NIH grant # P20GM103434) in the West Virginia University Microscope Imaging Facility, which is supported by the WVU Cancer Institute and NIH grants P20GM121322 and P20GM144230. We thank Sarah L. McLaughlin for her assistance with Vevo F2 echocardiography and Ethan Meadows from the Mitochondrial Phenotyping Core for his support in performing mitochondria isolation and Complex I–V activity assays. During the preparation of this manuscript, the authors utilized ChatGPT (OpenAI, GPT-4, July 2024 version) to refine and edit the text. The authors have reviewed and edited the output and take full responsibility for the content of this publication.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

ATPAdenosine Triphosphate
Atf3Activating Transcription Factor 3
Atf4Activating Transcription Factor 4
CKOConditional Knockout
ClppCaseinolytic Mitochondrial Matrix Peptidase Proteolytic Subunit
ClpxCaseinolytic Mitochondrial Matrix Peptidase Chaperone Subunit
COCardiac Output
CreCre Recombinase
DCPIP2,6-Dichlorophenolindophenol
Dnm1lDynamin-1-like Protein (Drp1)
EFEjection Fraction
ETCElectron Transport Chain
Fis1Mitochondrial Fission 1 Protein
FSFractional Shortening
GDF15Growth Differentiation Factor 15
GKOGlobal Knockout
HEHematoxylin and Eosin
Hspa9Heat Shock Protein Family A Member 9 (Mortalin)
Hspd1Heat Shock Protein Family D Member 1 (HSP60)
HW/TLHeart Weight to Tibia Length
LVLeft Ventricle
LV massLeft Ventricular Mass
LVsDLeft Ventricular Systolic Diameter
LVdDLeft Ventricular Diastolic Diameter
LVAWLeft Ventricular Anterior Wall
LVPWLeft Ventricular Posterior Wall
LONP1Lon Protease 1
mPQCMitochondrial Protein Quality Control
Mfn1Mitofusin 1
MitohormesisMitochondrial Hormesis
mt-Co1Mitochondrial Cytochrome c Oxidase Subunit 1
mt-Co2Mitochondrial Cytochrome c Oxidase Subunit 2
mt-Nd4Mitochondrial NADH Dehydrogenase 4
mt-Nd6Mitochondrial NADH Dehydrogenase 6
mtDNAMitochondrial DNA
NADHNicotinamide Adenine Dinucleotide (reduced form)
Ndufs4NADH Dehydrogenase [Ubiquinone] Iron-Sulfur Protein 4
OXPHOSOxidative Phosphorylation
PCRPolymerase Chain Reaction
Pink1PTEN-Induced Kinase 1
qRT-PCRQuantitative Real-Time PCR
RT-PCRReverse Transcription PCR
Spg7Paraplegin
SVStroke Volume
TfamTranscription Factor A, Mitochondrial
TertTelomerase Reverse Transcriptase
UPRmtMitochondrial Unfolded Protein Response

References

  1. Hinton, A., Jr.; Claypool, S.M.; Neikirk, K.; Senoo, N.; Wanjalla, C.N.; Kirabo, A.; Williams, C.R. Mitochondrial Structure and Function in Human Heart Failure. Circ. Res. 2024, 135, 372–396. [Google Scholar] [CrossRef]
  2. Sebastiani, M.; Giordano, C.; Nediani, C.; Travaglini, C.; Borchi, E.; Zani, M.; Feccia, M.; Mancini, M.; Petrozza, V.; Cossarizza, A.; et al. Induction of Mitochondrial Biogenesis Is a Maladaptive Mechanism in Mitochondrial Cardiomyopathies. J. Am. Coll. Cardiol. 2007, 50, 1362–1369. [Google Scholar] [CrossRef] [PubMed]
  3. Karamanlidis, G.; Nascimben, L.; Couper, G.S.; Shekar, P.S.; del Monte, F.; Tian, R. Defective DNA Replication Impairs Mitochondrial Biogenesis In Human Failing Hearts. Circ. Res. 2010, 106, 1541–1548. [Google Scholar] [CrossRef] [PubMed]
  4. Zhou, B.; Tian, R. Mitochondrial dysfunction in pathophysiology of heart failure. J. Clin. Investig. 2018, 128, 3716–3726. [Google Scholar] [CrossRef] [PubMed]
  5. Zaglia, T.; Campo, A.; Moro, N.; Di Mauro, V.; Borile, G.; Menabò, R.; Antonucci, S.; Poli, L.; Campesan, M.; Carullo, P.; et al. Enhancement of mitochondrial calcium uptake is cardioprotective against maladaptive hypertrophy by retrograde signaling uptuning Akt. Proc. Natl. Acad. Sci. USA 2025, 122, e2402639122. [Google Scholar] [CrossRef]
  6. Chen, Q.; Zheng, A.; Xu, X.; Shi, Z.; Yang, M.; Sun, S.; Wang, L.; Wang, Y.; Zhao, H.; Xiao, Q.; et al. Nrf3-Mediated Mitochondrial Superoxide Promotes Cardiomyocyte Apoptosis and Impairs Cardiac Functions by Suppressing Pitx2. Circulation 2025, 151, 1024–1046. [Google Scholar] [CrossRef]
  7. Saller, B.S.; Wöhrle, S.; Fischer, L.; Dufossez, C.; Ingerl, I.L.; Kessler, S.; Mateo-Tortola, M.; Gorka, O.; Lange, F.; Cheng, Y.; et al. Acute suppression of mitochondrial ATP production prevents apoptosis and provides an essential signal for NLRP3 inflammasome activation. Immunity 2024, 58, 90–107.e11. [Google Scholar] [CrossRef]
  8. Venkatesh, S.; Suzuki, C.K. Cell stress management by the mitochondrial LonP1 protease—Insights into mitigating developmental, oncogenic and cardiac stress. Mitochondrion 2020, 51, 46–61. [Google Scholar] [CrossRef]
  9. Shirakabe, A.; Zhai, P.; Ikeda, Y.; Saito, T.; Maejima, Y.; Hsu, C.-P.; Nomura, M.; Egashira, K.; Levine, B.; Sadoshima, J. Drp1-Dependent Mitochondrial Autophagy Plays a Protective Role Against Pressure Overload–Induced Mitochondrial Dysfunction and Heart Failure. Circulation 2016, 133, 1249–1263. [Google Scholar] [CrossRef]
  10. Franco, A.; Li, J.; Kelly, D.P.; Hershberger, R.E.; Marian, A.J.; Lewis, R.M.; Song, M.; Dang, X.; Schmidt, A.D.; Mathyer, M.E.; et al. A human mitofusin 2 mutation can cause mitophagic cardiomyopathy. eLife 2023, 12, e84235. [Google Scholar] [CrossRef]
  11. Lin, Z.; Pu, W.T. Strategies for Cardiac Regeneration and Repair. Sci. Transl. Med. 2014, 6, 239rv1. [Google Scholar] [CrossRef]
  12. Simões, F.C.; Riley, P.R.; Ginhoux, F.; Martin, P. Immune cells in cardiac repair and regeneration. Development 2022, 149, dev199906. [Google Scholar] [CrossRef]
  13. Bar-Ziv, R.; Bolas, T.; Dillin, A. Systemic effects of mitochondrial stress. EMBO Rep. 2020, 21, e50094. [Google Scholar] [CrossRef]
  14. Walker, E.M.; Pearson, G.L.; Lawlor, N.; Stendahl, A.M.; Lietzke, A.; Sidarala, V.; Zhu, J.; Stromer, T.; Reck, E.C.; Li, J.; et al. Retrograde mitochondrial signaling governs the identity and maturity of metabolic tissues. Science 2025, 388, eadf2034. [Google Scholar] [CrossRef] [PubMed]
  15. Li, J.; Cui, J.; Tian, Y. Neuron-periphery mitochondrial stress communication in aging and diseases. Life Med. 2022, 1, 168–178. [Google Scholar] [CrossRef] [PubMed]
  16. Venkatesh, S.; Li, M.; Saito, T.; Tong, M.; Rashed, E.; Mareedu, S.; Zhai, P.; Bárcena, C.; López-Otín, C.; Yehia, G.; et al. Mitochondrial LonP1 protects cardiomyocytes from ischemia/reperfusion injury in vivo. J. Mol. Cell. Cardiol. 2019, 128, 38–50. [Google Scholar] [CrossRef] [PubMed]
  17. De Gaetano, A.; Gibellini, L.; Bianchini, E.; Borella, R.; De Biasi, S.; Nasi, M.; Boraldi, F.; Cossarizza, A.; Pinti, M. Impaired Mitochondrial Morphology and Functionality in Lonp1wt/− Mice. J. Clin. Med. 2020, 9, 1783. [Google Scholar] [CrossRef]
  18. Zhao, K.; Huang, X.; Zhao, W.; Lu, B.; Yang, Z. LONP1-mediated mitochondrial quality control safeguards metabolic shifts in heart development. Development 2022, 149, dev200458. [Google Scholar] [CrossRef]
  19. Gohel, D.; Singh, R. Mitohormesis; Potential implications in neurodegenerative diseases. Mitochondrion 2021, 56, 40–46. [Google Scholar] [CrossRef]
  20. Cheng, Y.; Hou, B.-H.; Xie, G.-L.; Shao, Y.-T.; Yang, J.; Xu, C. Transient inhibition of mitochondrial function by chrysin and apigenin prolong longevity via mitohormesis in C. elegans. Free. Radic. Biol. Med. 2023, 203, 24–33. [Google Scholar] [CrossRef]
  21. Quirós, P.M.; Español, Y.; Acín-Pérez, R.; Rodríguez, F.; Bárcena, C.; Watanabe, K.; Calvo, E.; Loureiro, M.; Fernández-García, M.S.; Fueyo, A.; et al. ATP-Dependent Lon Protease Controls Tumor Bioenergetics by Reprogramming Mitochondrial Activity. Cell Rep. 2014, 8, 542–556. [Google Scholar] [CrossRef]
  22. Muthu, S.; Tran, Z.; Thilagavathi, J.; Bolarum, T.; Azzam, E.I.; Suzuki, C.K.; Sundararajan, V. Aging triggers mitochondrial, endoplasmic reticulum, and metabolic stress responses in the heart. J. Cardiovasc. Aging 2025, 5, 4. [Google Scholar] [CrossRef] [PubMed]
  23. Kunovac, A.; Hathaway, Q.A.; Pinti, M.V.; Durr, A.J.; Taylor, A.D.; Goldsmith, W.T.; Garner, K.L.; Nurkiewicz, T.R.; Hollander, J.M. Enhanced antioxidant capacity prevents epitranscriptomic and cardiac alterations in adult offspring gestationally-exposed to ENM. Nanotoxicology 2021, 15, 812–831. [Google Scholar] [CrossRef] [PubMed]
  24. Pires Da Silva, J.; Casa de Vito, M.; Miyano, C.; Sucharov, C.C. Mitochondrial Dysfunction in Congenital Heart Disease. J. Cardiovasc. Dev. Dis. 2025, 12, 42. [Google Scholar] [CrossRef] [PubMed]
  25. Taouktsi, E.; Kyriakou, E.; Smyrniotis, S.; Borbolis, F.; Bondi, L.; Avgeris, S.; Trigazis, E.; Rigas, S.; Voutsinas, G.E.; Syntichaki, P. Organismal and Cellular Stress Responses upon Disruption of Mitochondrial Lonp1 Protease. Cells 2022, 11, 1363. [Google Scholar] [CrossRef]
  26. Guo, Q.; Xu, Z.; Zhou, D.; Fu, T.; Wang, W.; Sun, W.; Xiao, L.; Liu, L.; Ding, C.; Yin, Y.; et al. Mitochondrial proteostasis stress in muscle drives a long-range protective response to alleviate dietary obesity independently of ATF4. Sci. Adv. 2022, 8, eabo0340. [Google Scholar] [CrossRef]
  27. Bota, D.A.; Ngo, J.K.; Davies, K.J. Downregulation of the human Lon protease impairs mitochondrial structure and function and causes cell death. Free. Radic. Biol. Med. 2005, 38, 665–677. [Google Scholar] [CrossRef]
  28. Kim, K.H.; Lee, M.-S. FGF21 as a Stress Hormone: The Roles of FGF21 in Stress Adaptation and the Treatment of Metabolic Diseases. Diabetes Metab. J. 2014, 38, 245–251. [Google Scholar] [CrossRef]
  29. Leak, R.K.; Calabrese, E.J.; Kozumbo, W.J.; Gidday, J.M.; Johnson, T.E.; Mitchell, J.R.; Ozaki, C.K.; Wetzker, R.; Bast, A.; Belz, R.G.; et al. Enhancing and Extending Biological Performance and Resilience. Dose-Response 2018, 16, 1559325818784501. [Google Scholar] [CrossRef]
  30. Liesa, M.; Shirihai, O.S. Mitochondrial Dynamics in the Regulation of Nutrient Utilization and Energy Expenditure. Cell Metab. 2013, 17, 491–506. [Google Scholar] [CrossRef]
  31. Rendón, O.Z.; Shoubridge, E.A. LONP1 Is Required for Maturation of a Subset of Mitochondrial Proteins, and Its Loss Elicits an Integrated Stress Response. Mol. Cell. Biol. 2018, 38, e00412-17. [Google Scholar] [CrossRef]
  32. Ishihara, N.; Eura, Y.; Mihara, K. Mitofusin 1 and 2 play distinct roles in mitochondrial fusion reactions via GTPase activity. J. Cell Sci. 2004, 117, 6535–6546. [Google Scholar] [CrossRef]
  33. Papanicolaou, K.N.; Ngoh, G.A.; Dabkowski, E.R.; O’COnnell, K.A.; Ribeiro, R.F.; Stanley, W.C.; Walsh, K. Cardiomyocyte deletion of mitofusin-1 leads to mitochondrial fragmentation and improves tolerance to ROS-induced mitochondrial dysfunction and cell death. Am. J. Physiol. Circ. Physiol. 2012, 302, H167–H179. [Google Scholar] [CrossRef]
  34. Durieux, J.; Wolff, S.; Dillin, A. The Cell-Non-Autonomous Nature of Electron Transport Chain-Mediated Longevity. Cell 2011, 144, 79–91. [Google Scholar] [CrossRef]
Figure 1. Effect of both systemic and cardiac-specific Lonp1 haploinsufficiency on body and heart morphology. (A) A significant reduction in Lonp1 expression is observed in both heterozygous models compared to their respective controls, confirming the efficiency of the partial knock-out in the groups as determined by RT-PCR analysis of Lonp1 mRNA levels. (B) Representative dorsal views of male global heterozygous mice (Lonp1GKO-HET) and their wild-type (WT) littermates, and cardiomyocyte-restricted heterozygous mice (Lonp1CKO-HET) and their Cre-Control littermates and (C) corresponding scattered dot plots of their body weight. (D) Representative excised whole heart images of Lonp1GKO-HET and their wild-type (WT) littermates, and Lonp1CKO-HET and their Cre-Control littermates and (E) corresponding scattered dot plots of their heart-weight-to-tibia-length ratio (HW/TL). Values are represented as mean ± S.E.M. ns represents non-significant, **** p < 0.0001, *** p < 0.001 is considered significant by Student’s t-test.
Figure 1. Effect of both systemic and cardiac-specific Lonp1 haploinsufficiency on body and heart morphology. (A) A significant reduction in Lonp1 expression is observed in both heterozygous models compared to their respective controls, confirming the efficiency of the partial knock-out in the groups as determined by RT-PCR analysis of Lonp1 mRNA levels. (B) Representative dorsal views of male global heterozygous mice (Lonp1GKO-HET) and their wild-type (WT) littermates, and cardiomyocyte-restricted heterozygous mice (Lonp1CKO-HET) and their Cre-Control littermates and (C) corresponding scattered dot plots of their body weight. (D) Representative excised whole heart images of Lonp1GKO-HET and their wild-type (WT) littermates, and Lonp1CKO-HET and their Cre-Control littermates and (E) corresponding scattered dot plots of their heart-weight-to-tibia-length ratio (HW/TL). Values are represented as mean ± S.E.M. ns represents non-significant, **** p < 0.0001, *** p < 0.001 is considered significant by Student’s t-test.
Biomolecules 15 01159 g001
Figure 2. Echocardiographic assessment of cardiac function in both Lonp1 haploinsufficiency groups. Representative M-mode (parasternal short-axis) from male (A) and female (B) Lonp1GKO-HET, Lonp1CKO-HET, and their respective control littermates. Green and red cursors delineate systolic (s) and diastolic (d) phases of the left ventricle. (C,D) Quantitative analysis of key functional parameters, including ejection fraction (EF), fractional shortening (FS), stroke volume (SV), cardiac output (CO), left-ventricular mass (LV mass), systolic volume and diameter, and anterior and posterior wall thickness obtained from VevoF2 Micro-Ultrasound Imaging System. LVsD; Left Ventricular systolic Diameter, LVdD; Left Ventricular diastolic Diameter, LVAW; Left Ventricular Anterior Wall, LVPW; Left Ventricular Posterior Wall, LV; Left Ventricular chamber. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Figure 2. Echocardiographic assessment of cardiac function in both Lonp1 haploinsufficiency groups. Representative M-mode (parasternal short-axis) from male (A) and female (B) Lonp1GKO-HET, Lonp1CKO-HET, and their respective control littermates. Green and red cursors delineate systolic (s) and diastolic (d) phases of the left ventricle. (C,D) Quantitative analysis of key functional parameters, including ejection fraction (EF), fractional shortening (FS), stroke volume (SV), cardiac output (CO), left-ventricular mass (LV mass), systolic volume and diameter, and anterior and posterior wall thickness obtained from VevoF2 Micro-Ultrasound Imaging System. LVsD; Left Ventricular systolic Diameter, LVdD; Left Ventricular diastolic Diameter, LVAW; Left Ventricular Anterior Wall, LVPW; Left Ventricular Posterior Wall, LV; Left Ventricular chamber. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Biomolecules 15 01159 g002
Figure 3. Histological evaluation of cardiac remodeling in both global and cardiomyocyte-specific Lonp1-haploinsufficient mice. (A) Representative HE-stained heart sections from male and female global heterozygous (Lonp1GKO-HET), wild-type (WT), Cre-Control, and cardiomyocyte-specific heterozygous (Lonp1CKO-HET) mice. The right panel shows the number of nuclei per high-power field. (B) Representative Masson’s trichrome-stained heart sections from male and female Lonp1GKO-HET, WT, Cre-Control, and Lonp1CKO-HET mice. The right panel shows Collagen Volume fraction (MT): collagen-positive area (% of total tissue). Images are shown at 40× (scale bar = 200 µm). Data represent a mean ± S.E.M. Statistical analysis by unpaired Student’s t-test showed no significant differences between control and corresponding Lonp1 haploinsufficient mice.
Figure 3. Histological evaluation of cardiac remodeling in both global and cardiomyocyte-specific Lonp1-haploinsufficient mice. (A) Representative HE-stained heart sections from male and female global heterozygous (Lonp1GKO-HET), wild-type (WT), Cre-Control, and cardiomyocyte-specific heterozygous (Lonp1CKO-HET) mice. The right panel shows the number of nuclei per high-power field. (B) Representative Masson’s trichrome-stained heart sections from male and female Lonp1GKO-HET, WT, Cre-Control, and Lonp1CKO-HET mice. The right panel shows Collagen Volume fraction (MT): collagen-positive area (% of total tissue). Images are shown at 40× (scale bar = 200 µm). Data represent a mean ± S.E.M. Statistical analysis by unpaired Student’s t-test showed no significant differences between control and corresponding Lonp1 haploinsufficient mice.
Biomolecules 15 01159 g003
Figure 4. Evaluation of mitochondrial stress response in cardiomyocyte-specific and global Lonp1 haploinsufficient hearts. Relative mRNA-level fold change in components of mitochondrial ATP dependent proteases like Clpp, Clpx, Spg7, and Afg3l2 and chaperones like Hspa9, Hspd1, and integrated stress response markers, Atf4 and Atf3 were analyzed in systemic (Lonp1GKO-HET) (n = 8, 4 male and 4 female) and cardiomyocyte-specific (Lonp1CKO-HET) (n = 6, 3 male and 3 female) haploinsufficient along with their respective control mice hearts. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Figure 4. Evaluation of mitochondrial stress response in cardiomyocyte-specific and global Lonp1 haploinsufficient hearts. Relative mRNA-level fold change in components of mitochondrial ATP dependent proteases like Clpp, Clpx, Spg7, and Afg3l2 and chaperones like Hspa9, Hspd1, and integrated stress response markers, Atf4 and Atf3 were analyzed in systemic (Lonp1GKO-HET) (n = 8, 4 male and 4 female) and cardiomyocyte-specific (Lonp1CKO-HET) (n = 6, 3 male and 3 female) haploinsufficient along with their respective control mice hearts. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Biomolecules 15 01159 g004
Figure 5. Mitochondrial biogenesis in cardiac-specific and global Lonp1 haploinsufficient hearts. (A) Relative mtDNA content normalized to nDNA (Tert) and relative fold change in the mRNA level expressions of mitochondrial transcription factor A (Tfam) in the systemic and cardiomyocyte-specific Lonp1 haploinsufficient mice hearts and their control littermates. (B) Relative fold change in the mRNA level expressions of mitochondrial encoded respiratory complex genes like mt-Nd4, mt-Nd6, mt-Co1, mt-Co2, mt-Atp6 and nuclear encoded Ndufs4 were analyzed in systemic (Lonp1GKO-HET) (n = 8, 4 male and 4 female) and cardiomyocyte-specific (Lonp1CKO-HET) (n = 6, 3 male and 3 female) heterozygous mice hearts compared with their respective controls. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Figure 5. Mitochondrial biogenesis in cardiac-specific and global Lonp1 haploinsufficient hearts. (A) Relative mtDNA content normalized to nDNA (Tert) and relative fold change in the mRNA level expressions of mitochondrial transcription factor A (Tfam) in the systemic and cardiomyocyte-specific Lonp1 haploinsufficient mice hearts and their control littermates. (B) Relative fold change in the mRNA level expressions of mitochondrial encoded respiratory complex genes like mt-Nd4, mt-Nd6, mt-Co1, mt-Co2, mt-Atp6 and nuclear encoded Ndufs4 were analyzed in systemic (Lonp1GKO-HET) (n = 8, 4 male and 4 female) and cardiomyocyte-specific (Lonp1CKO-HET) (n = 6, 3 male and 3 female) heterozygous mice hearts compared with their respective controls. Values are represented as mean ± S.E.M. * p < 0.05, ** p < 0.01 is considered significant by Student’s t-test.
Biomolecules 15 01159 g005
Figure 6. Mitochondrial respiratory chain complex activities in cardiac-specific and global Lonp1 haploinsufficiency mice hearts. Complex activities were measured spectrophotometrically and expressed as nmol/min per mg of mitochondrial lysate. All the complex activities were averaged from 2 assays from the pooled samples. Complex I activity, measured by NADH oxidation, Complex II activity, assessed by dichlorophenolindophenol reduction, Complex III activity measured by cytochrome c reduction, Complex IV activity, measured by cytochrome c oxidation, and Complex V activity measured by NADH oxidation. Values are represented as mean ± S.E.M. ** p < 0.01 is considered significant by Student’s t-test.
Figure 6. Mitochondrial respiratory chain complex activities in cardiac-specific and global Lonp1 haploinsufficiency mice hearts. Complex activities were measured spectrophotometrically and expressed as nmol/min per mg of mitochondrial lysate. All the complex activities were averaged from 2 assays from the pooled samples. Complex I activity, measured by NADH oxidation, Complex II activity, assessed by dichlorophenolindophenol reduction, Complex III activity measured by cytochrome c reduction, Complex IV activity, measured by cytochrome c oxidation, and Complex V activity measured by NADH oxidation. Values are represented as mean ± S.E.M. ** p < 0.01 is considered significant by Student’s t-test.
Biomolecules 15 01159 g006
Figure 7. Lonp1 haploinsufficiency alters mitochondrial dynamics in a cardiac-specific manner. The relative mRNA expression levels of mitophagy-associated transcripts, such as Pink1, Dnm1l, Mfn1, and Fis1 in Lonp1CKO-HET, Lonp1GKO-HET, and their respective control mice. Values are represented as mean ± S.E.M. * p < 0.05, *** p < 0.001 is considered significant by Student’s t-test.
Figure 7. Lonp1 haploinsufficiency alters mitochondrial dynamics in a cardiac-specific manner. The relative mRNA expression levels of mitophagy-associated transcripts, such as Pink1, Dnm1l, Mfn1, and Fis1 in Lonp1CKO-HET, Lonp1GKO-HET, and their respective control mice. Values are represented as mean ± S.E.M. * p < 0.05, *** p < 0.001 is considered significant by Student’s t-test.
Biomolecules 15 01159 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Muthu, S.; Tran, Z.; Saminathan, R.; Shrestha, P.; Venkatesh, S. Systemic Lonp1 Haploinsufficiency Mitigates Cardiac Mitochondrial Dysfunction Induced by Cardiomyocyte-Specific Lonp1 Haploinsufficiency via Potential Inter-Organ Crosstalk. Biomolecules 2025, 15, 1159. https://doi.org/10.3390/biom15081159

AMA Style

Muthu S, Tran Z, Saminathan R, Shrestha P, Venkatesh S. Systemic Lonp1 Haploinsufficiency Mitigates Cardiac Mitochondrial Dysfunction Induced by Cardiomyocyte-Specific Lonp1 Haploinsufficiency via Potential Inter-Organ Crosstalk. Biomolecules. 2025; 15(8):1159. https://doi.org/10.3390/biom15081159

Chicago/Turabian Style

Muthu, Sakthijothi, Zinnia Tran, Ramasamy Saminathan, Pratikshya Shrestha, and Sundararajan Venkatesh. 2025. "Systemic Lonp1 Haploinsufficiency Mitigates Cardiac Mitochondrial Dysfunction Induced by Cardiomyocyte-Specific Lonp1 Haploinsufficiency via Potential Inter-Organ Crosstalk" Biomolecules 15, no. 8: 1159. https://doi.org/10.3390/biom15081159

APA Style

Muthu, S., Tran, Z., Saminathan, R., Shrestha, P., & Venkatesh, S. (2025). Systemic Lonp1 Haploinsufficiency Mitigates Cardiac Mitochondrial Dysfunction Induced by Cardiomyocyte-Specific Lonp1 Haploinsufficiency via Potential Inter-Organ Crosstalk. Biomolecules, 15(8), 1159. https://doi.org/10.3390/biom15081159

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop