Next Article in Journal
Metabolic Comparison of Mature and Immature Bovine Cumulus–Oocyte Complexes with Standardization of Bioenergetic Assessment
Previous Article in Journal
Exploring the Potential of Receptor Silencing in the Tumor Microenvironment by RNA Interference
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 16
Issue 2
10.3390/biom16020316
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Nintedanib on Orofacial Fibroblasts and Myoblasts

by
Zhihao Wang
1,2,
Frank A. D. T. G. Wagener
1,
Edwin M. Ongkosuwito
1 and
Johannes W. Von den Hoff
1,*
1
Department of Dentistry, Orthodontics and Craniofacial Biology, Research Institute for Medical Innovation, Radboud University Medical Centre, 6525EX Nijmegen, The Netherlands
2
Department of Implant Alveolar Surgery, Stomatological Center, Weifang People’s Hospital, Weifang 261000, China
*
Author to whom correspondence should be addressed.
Biomolecules 2026, 16(2), 316; https://doi.org/10.3390/biom16020316
Submission received: 13 December 2025 / Revised: 3 February 2026 / Accepted: 14 February 2026 / Published: 18 February 2026
(This article belongs to the Section Chemical Biology)
Browse Figures
Versions Notes

Abstract

Following surgical interventions or acquired trauma, fibrosis often inhibits muscle and skin regeneration. Nintedanib, an antifibrotic drug for lung fibrosis, may help prevent orofacial fibrosis. This study evaluates Nintedanib’s potential for inhibiting myofibroblast differentiation and affecting the fusion of orofacial myoblasts into myotubes. Rat gingival fibroblasts and satellite cells (SCs) were isolated and cultured with TGF-β1 to induce myofibroblast differentiation and prevent myotube formation. Adding 1 and 10 ng/mL TGF-β1 significantly increased the percentage of myofibroblasts. Although Nintedanib did not affect the percentage of myofibroblasts, it strongly decreased the total number of fibroblasts and myofibroblasts. Additionally, Nintedanib at a concentration of 2 μM markedly reduced the expression of Ki-67 in fibroblasts and myofibroblasts. In the SC cultures, 0.2 ng/mL TGF-β1 reduced the fusion index of SCs. Treatment with 2 μM Nintedanib significantly increased the fusion index of SCs. Furthermore, MyoD and MyoG gene expression in SCs was also significantly enhanced by Nintedanib at a concentration of 2 μM. Nintedanib promotes myotube formation while inhibiting (myo)fibroblast proliferation. This dual action stresses its potential as an anti-fibrotic therapy after orofacial surgery or traumatic injury affecting muscle tissue.

1. Introduction

Upon surgical interventions or acquired trauma, orofacial muscle injury can give rise to functional problems with speech, chewing, swallowing, and facial expression. For example, incomplete muscle regeneration and fibrosis in the soft palate after cleft palate surgery impair the function of the velopharyngeal muscles and, subsequently, speech development in 10 to 30% of the patients [1]. Orofacial muscles differ from trunk and limb muscles in development, function, and regeneration [1]. Orofacial muscles develop from the mesoderm of the pharyngeal arches and the occipital somites, while the muscles of the trunk and limbs develop from the thoracic and lumbar somites, respectively [2]. Satellite cells (SCs) are the stem cells of muscle tissue. SCs from orofacial muscles seem to regenerate less after injury, while the muscles derived from orofacial SCs develop more fibrosis than those from limb and trunk muscles [3]. However, fibrosis prevention and muscle regeneration within the orofacial complex have received far less attention than trunk and limb muscles [4].
The specific properties of orofacial myoblasts and fibroblasts appear to compromise the regeneration of orofacial muscles. Injury disrupts the connection between muscle fibers and the adjacent connective tissues, which induces muscle regeneration. This process starts with inflammation, followed by tissue formation and remodeling [1]. After injury, activated SCs proliferate, differentiate into myoblasts, and fuse to form new myofibers [5]. Thus, SCs play a pivotal role in regenerating muscle tissue and restoring its contractile function after injury. However, muscle regeneration is often compromised by fibrosis. Upon injury, transforming growth factor beta 1 (TGF-β1) triggers fibroblasts to differentiate into myofibroblasts, responsible for tissue contraction and the deposition of abundant extracellular matrix (ECM) components such as collagen [6]. TGF-β1 is well-known as a crucial driving mediator in tissue fibrosis, characterized by the accumulation of excessive ECM after injury, which can impair muscle function [7]. Fibrosis can impair muscle repair and lead to loss of muscle architecture and function [8]. Research indicates that SCs in orofacial muscles exhibit a diminished regenerative capacity compared to those in limb and trunk muscles [3]. Muscle injury is often accompanied by fibrosis, leading to compromised muscle regeneration and function [9]. By contrast, SCs in limb and trunk muscles demonstrate a more robust regenerative response, characterized by efficient activation, proliferation, and fusion into new myofibers [10]. Overall, orofacial muscle regeneration is highly hampered by fibrosis, requiring further study.
Numerous studies have been conducted on the challenge of fibrosis, yielding highly variable results. Many investigations have focused on cell reprogramming [11], stem cell implantation, or exosome application [4], which show promising prospects for addressing fibrosis and facilitating muscle regeneration. However, due to the critical importance of safety evaluation and long-term monitoring of potential adverse effects, significant benefits still need to be observed and require extensive validation over time. There is an urgent need to find antifibrotic therapeutics. The only FDA-approved medications for treating fibrosis are Nintedanib and Pirfenidone, but only for a limited number of diseases. These small molecules can target fibroblast differentiation processes, including the suppression of peroxisome proliferator-activated receptors (PPARs), the modulation of growth factor signaling, and the inhibition of alpha-smooth muscle actin (α-SMA) expression by Rho-associated protein kinase inhibitors and focal adhesion kinase inhibitors [7]. Given the intricate nature of fibrotic diseases and the direct targeting ability of small molecules, they can be a promising strategy to combat orofacial fibrosis.
Nintedanib, a tyrosine kinase inhibitor, is approved for treating idiopathic pulmonary fibrosis, other chronic fibrosing interstitial lung diseases (ILDs) with a progressive phenotype, and systemic sclerosis-associated ILD [12]. It targets various growth factor receptors, such as those for vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and platelet-derived growth factor (PDGF) [7]. Nintedanib may also indirectly target TGF-β signaling, thereby reducing fibrosis [13]. It was demonstrated that there was a significant decrease in α-SMA expression in human lung fibroblasts cultured with both TGF-β1 and Nintedanib for 72 h, compared to the control group with only TGF-β1. Furthermore, after fibroblast culture with TGF-β1 and Nintedanib for 1 h, Nintedanib exhibited a dose-dependent inhibition of phosphorylation of both Smad3 and p38 mitogen-activated protein kinase (MAPK). In a study on progressive muscular dystrophy, mice were subjected to a 10-week therapy with Nintedanib [14]. Following treatment, a notable reduction in the collagen/total protein ratio and expression levels of fibrosis-related genes was observed in the quadriceps and triceps muscles. Its potential for reducing muscle fibrosis is also being explored in other animal models for muscle diseases, such as dystrophinopathy [15], sarcoglycanopathies [14], myocardial fibrosis [16], and hereditary hemorrhagic telangiectasia [17]. Nintedanib demonstrates clear potential as an antifibrotic drug. Despite being recognized for its therapeutic potential in fibrosis, only limited information is available regarding its impact on myoblasts and myofiber formation, especially since no study has been conducted on orofacial muscle tissue regeneration.
Given Nintedanib’s potential to reduce fibrosis, its application for orofacial muscle tissue regeneration could be worthwhile to investigate. We hypothesize that Nintedanib promotes muscle regeneration by inhibiting fibrosis after muscle injury. This prompted us to study the effects of Nintedanib on both orofacial myoblasts and fibroblasts. Hence, we isolated SCs from the rat masseter muscle to investigate the impact of Nintedanib on myotube formation. In parallel, rat gingival fibroblasts, which have been shown to be able to differentiate into myofibroblasts in other studies [18,19,20], were used to validate Nintedanib’s ability to reduce myofibroblast differentiation. Fibrotic conditions were mimicked by adding TGF-β1. Nintedanib may be suitable for further study when it reduces myofibroblast differentiation but does not compromise myotube formation.

2. Materials and Methods

2.1. Rat Gingival Fibroblast Culture

Fibroblasts from rat gingiva (in Supplementary Materials) were seeded at a density of 1.5 × 103 cells in 200 μL culture medium/well in 96-well plates. The fibroblast culture medium (FCM) was Dulbecco’s modified Eagle’s medium (DMEM; 11,995,065, Gibco, Waltham, MA, USA) with 10% FBS and 1% penicillin/streptomycin. The following day, the culture medium in the 96-well plates was replaced with FCM containing different concentrations of human TGF-β1 (0, 0.2, 1, and 10 ng/mL; GF346, ImmunoTools, Friesoythe, Germany). The chosen TGF-β1 concentrations were based on previously published studies [21,22,23,24]. The FCM with TGF-β1 was replaced every other day. At day 4, the cells were washed with PBS and fixed in 4% formaldehyde in demineralized water for 10 min, and the plates were stored at 4 °C for immunofluorescence analysis. Once the optimal concentration of TGF-β1 was determined, Nintedanib at 0, 0.1, 0.2, 0.5, 1, 2, 5, and 10 µM was added to the FCM. The chosen range of Nintedanib concentrations (0.1 to 10 µM; HY-50904, MedChemTronica, Sollentuna, Sweden) is based on previous studies [15,25,26]. Nintedanib was dissolved in DMSO and then diluted in FCM, resulting in a final DMSO (D12345, Invitrogen, Waltham, MA, USA) concentration of 0.1%. The FCM with Nintedanib was replaced every other day. On day 4, the cells were fixed with 4% paraformaldehyde for 10 min before immunofluorescence staining.

2.2. LIVE/DEAD Cell Viability Assay

Live/dead staining was performed to assess cell viability after four days of culture with Nintedanib. A staining solution containing calcein-AM (500 nm (green); C3099, Invitrogen, Waltham, MA, USA) and ethidium homodimer-1 (EtD1, 1 μm (red); E1169, Invitrogen) was prepared at a 1:1000 dilution in culture medium and added to the cells for 40 min. Following incubation, the staining solution was removed, and the cells were washed with PBS. Cell death was quantified by determining the percentage of EtD-1-positive cells relative to the total cell population (EtD-1- and calcein-AM-positive cells) on 5 microscopic fields per culture.

2.3. Rat Satellite Cell Culture

SCs (6 × 103) in 200 μL of SCM were seeded into Matrigel-coated 96-well plates (CELLSTAR®, Greiner Bio-One, Alphen, The Netherlands). The SCs are from rat masseter muscle, described in the Supplementary Information. To prepare the Matrigel-coating solution, Matrigel (354,234, Corning, Tewksbury, MA, USA) was mixed (1:10) with DMEM. The coating solution had a final concentration of 1 mg/mL Matrigel. Each well of a 96-well plate was coated with 20 μL of coating solution and placed on ice for 10 min, after which the remaining solution was removed from the 96-well plate. After drying for 2 h at a 37 °C humidified tissue culture incubator, cells were seeded in the coated wells. From the next day, SCM with different concentrations of human TGF-β1 (0, 0.2, 1, and 10 ng/mL) was added and changed every other day. At day 4, the cells were fixed for immunofluorescence analysis. Once the optimal concentration of TGF-β1 was determined, Nintedanib was also added at 0, 0.1, 0.2, 0.5, 1, 2, 5, and 10 µM in SCM with a final concentration of 0.1% DMSO. The SCM with Nintedanib was replaced every other day. On day 4, the cells were fixed for immunofluorescence analysis (Figure S1).

2.4. Immunofluorescence Staining for Myotubes and A-Smooth Muscle Actin

Fixed fibroblast cultures in a 96-well plate were washed with PBS and permeabilized with 0.5% Triton X-100 in PBS for 10 min. Then, the cells were incubated in a blocking buffer containing 1% of normal goat serum, 10% w/v bovine serum albumin, 0.1% v/v Triton in PBS, and 0.5% v/v Tween-20 in PBS for 1 h at room temperature. After washing with PBS, cells were incubated with rabbit anti-alpha-smooth muscle actin (1:250; AB_5694, Sigma, St. Louis, MO, USA). The secondary antibody was Alexa Fluor 647 goat anti-rabbit IgG (1:200; AB_2338580, Invitrogen). For nuclear visualization, DAPI (4′,6-diamidino-2-phenylindole, 0.4 μg/mL; R37606, Invitrogen) in PBS was applied for 10 min, followed by rinsing with PBS and water. Lastly, 20 μL of mounting medium, 0.5% DABCO (1.4 Diazobicyclo-(2,2,2) octane) in PBS, pH 8.6, was added to each well.
For the Myosin Heavy Chain (MyHC) and Pax7 staining, fixed SCs were washed with PBS and incubated in 100 mM glycine in Tris-buffer saline (TBS, pH 7.4) for 30 min. The cells were permeabilized with 0.5% Triton X-100 in TBS for 30 min and then washed in 0.05% Tween-20 in TBS. Blocking buffer containing 5% NGS, 10% w/v BSA, 0.1% v/v Triton in PBS, and 0.5% v/v Tween-20 in TBS was added to each well and incubated overnight at 4 °C. Next, the cells were incubated with mouse monoclonal anti-MyHC (1:500; M4276, Sigma, SCR_000488) or mouse anti-Pax7 (1:100; AB_528428, Developmental Studies Hybridoma Bank, IA, USA) in blocking buffer overnight. The secondary antibody, Alexa Fluor 488 goat anti-mouse IgG (1:200; AB_2534069, Invitrogen), was applied for 1 h. Nuclear visualization and mounting medium were the same as above.

2.5. Quantification

Image analyses were conducted using ImageJ/FIJI (version 2.3.0, SCR_003070). Two custom macros were created for automated quantification: one to identify myofibroblasts and another for myotubes. The myofibroblast macro calculates the number of nuclei located within α-SMA-positive regions, yielding the myofibroblast count, alongside the total nucleus count per image. Validation against manual counts on 16 randomly selected images showed a strong Pearson correlation (r = 0.89). Similarly, the myotube macro quantifies MyHC-positive areas as a measure of myotube formation and also enumerates nuclei within myotubes versus total nuclei. Validation of this macro demonstrated a correlation of 0.84 with manual assessment. These high correlation coefficients confirm the reliability of both automated methods. All image sets were processed batchwise using these macros. Derived metrics included: myofibroblast percentage (α-SMA-positive nuclei/total nuclei), myoblast fusion index (nuclei within myotubes/total nuclei), and average myotube size (total myotube area/nuclei within myotubes).

2.6. RT-qPCR

Total RNA was extracted from cultured cells for gene expression analysis via RT-qPCR. Fibroblasts were plated at 4.5 × 104 cells per well in 3 mL FCM in uncoated 6-well plates, while satellite cells (SCs) were seeded at 1.8 × 105 cells per well in 3 mL SCM on Matrigel-coated plates. On day 4, cells were washed, lysed with Trizol (Invitrogen), and centrifuged (400× g, 5 min, 4 °C). Total RNA was purified from the pellet using the RNeasy Micro Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol. cDNA was synthesized from RNA using the iSCRIPT cDNA synthesis kit (BIO RAD, Hercules, CA, USA). RT-qPCR was performed with SYBR green supermix (BIO RAD) using gene-specific primers (Table 1), under the following cycling conditions: 95 °C for 3 min, followed by 39 cycles of 95 °C for 15 s and 60 °C for 30 s. The Ct values were used to calculate ΔCt [ΔCt = Ct(target gene) − Ct(GAPDH)], and relative gene expression was expressed as fold change relative to the reference gene (2–ΔCt).

2.7. Statistics

Statistical analyses were performed using GraphPad Prism (version 9.00, SCR_002798). Normality of data distribution was confirmed by the Shapiro–Wilk test. For comparisons across multiple groups, one-way ANOVA was applied, followed by Tukey’s post hoc test for pairwise comparisons. A p-value < 0.05 was considered statistically significant for all experiments.

3. Results

3.1. Myofibroblast Differentiation Increases with TGF-β1 but Proliferation Is Suppressed by Nintedanib

Fibroblasts were cultured with varying concentrations of TGF-β1 (0, 0.2, 1, and 10 ng/mL) for 4 days. Immunostaining indicated that the number of α-SMA-positive cells increased with higher concentrations of TGF-β1 (Figure 1A). Quantitative analysis demonstrated a significant increase in the percentage of myofibroblasts at TGF-β1 concentrations of 1 ng/mL and 10 ng/mL (Figure 1B). However, the total number of cells showed a strong decreasing trend with increasing TGF-β1 concentrations, with a significant decrease at 10 ng/mL TGF-β1.
Based on the above data, 10 ng/mL TGF-β1 was further used to induce myofibroblast differentiation in vitro. Fibroblasts were cultured with varying concentrations of Nintedanib (0, 0.1, 0.2, 0.5, 1, 2, 5, and 10 µM) in FCM containing 10 ng/mL TGF-β1 for 4 days. Immunostaining results indicated a decrease in the number of α-SMA-positive cells as the Nintedanib concentration increased (Figure 1C). However, the addition of Nintedanib did not decrease the percentage of myofibroblasts (Figure 1D). Despite this, the overall cell number decreased, also leading to a reduction in the myofibroblast population.

3.2. Nintedanib Reduces (Myo)fibroblast Numbers by Inhibiting the Proliferation

PCR experiments further showed the impact of Nintedanib on gene expression related to myofibroblast differentiation and proliferation. Fibroblast activation protein (FAP) is typically upregulated during fibroblast activation [27]. ACAT2 (α-SMA) and COL1a1 (collagen) genes are strongly associated with fibrosis [28]. Ki67 is a marker of cell proliferation [29], whereas increased DUSP5 expression is linked to inhibition of proliferation [30]. The reduced expression of FAP (Figure 2A) at high Nintedanib concentrations (5 and 10 μM) indicates that Nintedanib inhibits the fibroblast activation. Consistent with the α-SMA immunostaining results, α-SMA expression was similar for all concentrations of Nintedanib (Figure 2B). However, the expression of collagen (Figure 2C) and the proliferation marker Ki-67 (Figure 2D) was reduced with increasing Nintedanib concentrations, particularly at concentrations higher than 2 μM. Meanwhile, the proliferation inhibitor DUSP5 expression showed a slight increase with higher concentrations of Nintedanib (Figure 2E). These findings further show that higher concentrations of Nintedanib inhibit cell proliferation. The cell viability assay demonstrated a decrease in live cells as Nintedanib concentration increased (Figure 2F), consistent with the immunostaining. Quantification revealed that 10 µM Nintedanib significantly increased the percentage of dead cells; however, the highest percentage was still quite low (1.5 ± 0.3%) (Figure 2G).

3.3. Myotube Formation Is Inhibited by TGF-β1 but Promoted by Nintedanib

Primary SCs were cultured with varying concentrations of TGF-β1 (0, 0.2, 1, and 10 ng/mL) for 4 days on a Matrigel coating. Immunostaining results indicated that the number of MyHC-positive myotubes strongly decreased as the concentration of TGF-β1 increased (Figure 3A). Quantitative analysis demonstrated that the fusion index significantly decreased when the concentration of TGF-β1 was 0.2 ng/mL or higher (Figure 3B). Additionally, the MyHC-positive area relative to the number of cells inside myotubes showed no significant difference among groups.
A concentration of 0.2 ng/mL TGF-β1 already reduced myotube formation, indicating that SCs are highly sensitive to TGF-β1. Therefore, 0.2 ng/mL was selected to investigate myotube formation in fibrotic conditions. Primary SCs were cultured with varying concentrations of Nintedanib (0, 0.1, 0.2, 0.5, 1, 2, 5, and 10 µM) in SCM containing 0.2 ng/mL TGF-β1 for 4 days on Matrigel. Immunostaining indicated that the area of MyHC-positive myotubes slowly increased with Nintedanib concentrations up to 2 µM but decreased again at higher concentrations (Figure 3C). After quantification, the fusion index also showed an increasing trend, which was only significant at 2 µM (Figure 3D). The quantification of the myotube area relative to the number of cells within the myotubes showed no significant difference among the groups.

3.4. Nintedanib Promotes the Expression of Differentiation Markers in Myotubes

Expression analyses further demonstrated the effects of Nintedanib on the expression of myoblast differentiation markers. Pax7, myoblast determination protein 1 (MyoD), MyoG, and myogenin (MyHC) are important markers of muscle growth and repair. Pax7 maintains the stem cell properties, MyoD and MyoG drive early and late differentiation, and MyHC defines mature fibers [31,32]. MyoD and MyoG expression significantly increased at 1 and 2 μM (Figure 4B,C). However, there were no significant differences in MyHC expression across the different concentrations (Figure 4D). Pax7 expression showed a reduction with 5 μM and 10 μM Nintedanib treatment (Figure 4A).

4. Discussion

Orofacial scarring caused by trauma or surgical reconstructions, such as cleft palate surgery, presents a significant challenge in soft tissue regeneration. Fibrosis frequently impedes muscle and skin regeneration, leading to functional and aesthetic complications. Only very few antifibrotic drugs are available for treatment up to now [4]. However, Nintedanib, an FDA-approved drug for idiopathic pulmonary fibrosis (IPF) [33], has shown significant antifibrotic effects in in vitro and in vivo studies as well as clinically. It would therefore be worthwhile to investigate its impact on other fibrotic conditions, including orofacial soft tissue fibrosis.
To explore Nintedanib’s effect on orofacial muscle regeneration, we established two in vitro models: one for myofibroblast differentiation using rat gingival fibroblasts and another for myotube formation using rat masseter SCs. We mimicked some aspects of a fibrotic environment by adding TGF-β1 and studied the impact of Nintedanib on myofibroblast differentiation and myotube formation.
Our study demonstrated that TGF-β1 significantly increases α-SMA expression in oral fibroblasts, indicating myofibroblast differentiation, which is consistent with a previous study on gingival fibroblasts [34]. Numerous previous studies also show that TGF-β1 induces myofibroblast differentiation in various other types of fibroblasts, such as lung fibroblasts [35,36], cardiac fibroblasts [37], and dermal fibroblasts [38]. Furthermore, we found that the total number of both fibroblasts and myofibroblasts decreases when adding TGF-β1. Another study also found that TGF-β1 inhibits the proliferation of human oral mucosal fibroblasts [39]. In contrast, TGF-β1 stimulates the proliferation of human dermal fibroblasts [39]. This might be related to the origin of the fibroblasts. Human dermal fibroblasts produce higher levels of hyaluronan (HA) compared to oral mucosal fibroblasts [38]. Inhibition of HA production in dermal fibroblasts suppresses TGF-β1-driven proliferation by reducing Smad3 signaling [40]. Additionally, elevated HA levels enhance TGF-β1-induced proliferation in both human dermal and oral fibroblasts. This suggests that the differential effects of TGF-β1 on dermal and oral fibroblasts are related to their respective HA production levels. HA also promotes the interaction between epidermal growth factor receptor (EGFR) and CD44, intensifying signal transduction through the MAPK/ERK pathway to induce cellular proliferation. Conversely, CD44 knockdown suppresses the proliferation of human oral fibroblasts [39]. Thus, the TGF-β1/HA/CD44 axis, mediated via Smad3 and the MAPK pathway, is crucial in regulating fibroblast proliferation. The lower HA production by oral fibroblasts explains the different proliferative response to TGF-β1 as compared to dermal fibroblasts.
We then investigated how Nintedanib influences gingival myofibroblast differentiation within a simulated fibrotic context. We added TGF-β1 to the culture medium to mimic a fibrotic context, as in many other studies [26,41,42,43]. Our results demonstrate that Nintedanib decreased myofibroblast numbers in rat gingival fibroblasts exposed to TGF-β1. Many studies have also shown that Nintedanib reduces collagen and α-SMA expression by suppressing TGF-β1-induced myofibroblast differentiation in human lung and tenon fibroblasts [42,43,44,45]. In vivo, Nintedanib also inhibits collagen and α-SMA expression in the cardiac tissue of dystrophinopathy mice and heart failure mouse models [15,16]. Surprisingly, Nintedanib significantly reduced collagen mRNA expression, but did not affect α-SMA mRNA expression in our study. Collagen accumulation is a hallmark of the later stages of fibrosis and tissue remodeling. Both fibroblasts and myofibroblasts can produce collagen [46]. This suggests that Nintedanib specifically influences collagen production without affecting myofibroblast differentiation. Notably, our results show a persistent myofibroblast phenotype (α-SMA expression) alongside reduced overall proliferation. This aligns with emerging evidence that reduced proliferation may be associated with stabilized or even promoted myofibroblast differentiation [47,48,49]. This could explain why α-SMA expression remained stable while collagen production decreased in our study. In the future, co-staining for α-SMA and Ki67 could further clarify which cell subpopulation is affected by changes in proliferation [50]. Additionally, Nintedanib reduced the total number of (myo)fibroblasts. Therefore, the reduction in myofibroblast numbers was not due to suppressed differentiation, but rather due to reduced proliferation or induced apoptosis in the (myo)fibroblast population. The cell viability assay results show that 10 µM Nintedanib significantly increased the percentage of dead cells. However, the overall percentage remained low (1.5 ± 0.3%). A healthy cell culture typically maintains 80–95% viability during handling and passaging [51]. Therefore, this low percentage of dead cells suggests that Nintedanib did not induce apoptosis in fibroblasts. Our expression data further reveal that Nintedanib inhibits Ki-67 expression while promoting DUSP5 expression, which both support the reduced proliferation. Many previous studies also showed that Nintedanib inhibits human lung fibroblast proliferation [26,43,52]. Furthermore, it induces cell cycle arrest in human keloid fibroblasts at the G0/G1 phase, leading to a halt in the cell cycle and preventing cell proliferation [53]. Therefore, Nintedanib holds antifibrotic potential by inhibiting proliferation, thereby reducing the total (myo)fibroblast population. In future studies, RNA-seq analysis, along with direct adhesion and proliferation assays, will be incorporated to elucidate its exact mechanism of action.
To explore potential therapeutic applications for orofacial muscle fibrosis following cleft surgery, we next investigated the effects of Nintedanib on myotube formation from orofacial SCs, mimicking some aspects of fibrotic conditions. SCs isolated from the rat masseter muscle easily fused into myotubes in culture. We found that Nintedanib enhances myotube formation from SCs exposed to TGF-β1. The expression of early (MyoD) and late (MyoG) differentiation markers was elevated. However, there was no effect on the expression of the muscle fiber maturation marker MyHC. These findings suggest that Nintedanib stimulates the early differentiation of SCs but not the final fusion process. An earlier study applied Nintedanib to cultured human myoblasts but showed no effect on myotube formation in low concentrations, which is similar to our results [15].
The TGF-β superfamily of ligands includes TGF-β1, β2, and β3, bone morphogenetic proteins (BMPs), activins, and growth and differentiation factors (GDFs), including myostatin (GDF-8) [54]. They all inhibit myoblast proliferation, differentiation, and myotube formation mainly by targeting the canonical Smad signaling pathway [54,55]. The TGF-β/Smad signaling pathway, involving TGF-βR1 and TGF-βR2, plays a crucial role in promoting myofibroblast differentiation but also inhibits myoblast differentiation [56]. Inhibition of TGF-βR1 by SB 431542, a specific inhibitor of serine/threonine kinase activity, promotes both myosin expression and cell fusion in mouse C2C12 cells [57]. Additionally, Nintedanib has been reported to reduce phosphorylation of Smad2/3 [45,53]. Furthermore, Nintedanib was also reported to inhibit c-Abl tyrosine kinase to suppress the phosphorylation of Smad2/3 [42,43,44]. This explains the inhibition of the TGF-β-induced reduction in myotube formation by inhibiting the canonical TGF-β/Smad signaling pathway. Beyond its effects on this pathway, Nintedanib also regulates non-canonical signaling pathways, such as p38, JNK, and ERK1/2 [42,43,44,45,53]. Notably, Nintedanib is well known for inhibiting tyrosine kinase receptors, including platelet-derived growth factor receptor (PDGFR), fibroblast growth factor receptor (FGFR), and vascular endothelial growth factor receptor (VEGFR) [7]. Studies report that PDGF, FGF, and VEGF can potentially promote myotube formation [58,59,60]. This contrasts with our results, as inhibition of the tyrosine kinases by Nintedanib promotes myotube formation. However, PDGFR-α knockdown or inhibition can suppress Smad-dependent TGF-β signaling and α-SMA expression by modulating the p38 MAPK signaling pathway in human hepatic stellate cells or mouse mesenchymal stromal cells [61,62]. Similarly, FGFR inhibition has been shown to reduce TGF-β1-induced proliferation, α-SMA expression, and collagen production through the PI3K/Akt and Erk1/2 pathways in human lung and skin fibroblasts [63,64]. Nintedanib also exerts antifibrotic effects by impairing TBK1-mediated YAP/TAZ nuclear translocation [65]. Moreover, several studies have demonstrated that Erk, JNK, and YAP activation by receptor tyrosine kinases leads to the phosphorylation of endogenous Smad2/3, indicating crosstalk between canonical and non-canonical signaling [66,67,68]. Thus, Nintedanib may influence myotube formation by regulating p38, JNK, and ERK1/2 signaling. Notably, previous studies have shown that activating p38, MEK/ERK, and PI3K/Akt pathways with creatine enhances myotube formation. By contrast, inhibition of p38 with SB203580 or MEK with U0126 reduces myotube formation in C2C12 cells and SCs [69,70,71]. In conclusion, Nintedanib may promote myotube formation by suppressing TGF-β-induced canonical Smad signaling while modulating non-canonical pathways such as p38, JNK, ERK, PI3K/Akt and YAP/TAZ, as summarized in Figure 5. Further investigation, including RNA-seq analyses, is required to understand the exact mechanism of action in detail.

Clinical Future

Nintedanib is FDA-approved for treating idiopathic pulmonary fibrosis (IPF). This study is the first to demonstrate Nintedanib’s dual antifibrotic and pro-myogenic effects in orofacial muscle wounds. Our study suggests that Nintedanib suppresses (myo)fibroblast proliferation and promotes myotube formation from orofacial SCs, highlighting its potential for supporting orofacial muscle regeneration.
Further in vivo studies are needed to better understand Nintedanib’s effects on orofacial soft tissue regeneration. Although systemic administration of Nintedanib has been approved for clinical use and is commonly employed in preclinical studies on other organ fibrosis, its severe side effects raise concerns [72,73]. Given that topical drug delivery is possible in the oral cavity, it could potentially reduce the systemic side effects.

5. Conclusions

Nintedanib enhances myotube formation by promoting the differentiation of orofacial SCs and inhibiting gingival (myo)fibroblast proliferation, thus limiting myofibroblast accumulation. This dual effect justifies further research on nintedanib to improve orofacial muscle regeneration following surgery or traumatic injuries.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/biom16020316/s1, Figure S1: SC fusion after isolation from rat masseter. Details regarding the animal experiments, as well as the protocols for isolating and culturing primary gingival fibroblasts from rat gingiva and satellite cells from rat masseter muscle, are provided in the Supplementary Information.

Author Contributions

J.W.V.d.H., F.A.D.T.G.W. and Z.W. designed research; Z.W. analyzed data; Z.W. performed research; J.W.V.d.H., F.A.D.T.G.W. and Z.W. wrote the paper; J.W.V.d.H., F.A.D.T.G.W. and Z.W. contributed new reagents or analytic tools; J.W.V.d.H., F.A.D.T.G.W. and E.M.O. acquired funding and supervised the work; and J.W.V.d.H., F.A.D.T.G.W. and Z.W. recorded experiments. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Osteology Foundation (No. 19-054).

Institutional Review Board Statement

The experiments were approved by the Animal Experiment Committee of Radboud University and the Central Animal Testing Committee (AVD10300 2019 9084, approved on 13 February 2020) in accordance with Dutch laws and regulations.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

SCsSatellite cells
CLPCleft lip and/or palate
TGF-βTransforming growth factor beta
MyHCMyosin Heavy Chain
MyoDMyoblast determination protein 1
MyoGMyogenin
ECMExtracellular matrix
α-SMAAlpha smooth muscle actin
FGFFibroblast growth factor
PDGFPlatelet-derived growth factor
VEGFVascular endothelial growth factor
IPFIdiopathic pulmonary fibrosis
FAPFibroblasts activation protein

References

  1. Rosero Salazar, D.H.; Carvajal Monroy, P.L.; Wagener, F.; Von den Hoff, J.W. Orofacial Muscles: Embryonic Development and Regeneration after Injury. J. Dent. Res. 2020, 99, 125–132. [Google Scholar] [CrossRef] [Scilit]
  2. Sugii, H.; Grimaldi, A.; Li, J.; Parada, C.; Vu-Ho, T.; Feng, J.; Jing, J.; Yuan, Y.; Guo, Y.; Maeda, H. The Dlx5-FGF10 signaling cascade controls cranial neural crest and myoblast interaction during oropharyngeal patterning and development. Development 2017, 144, 4037–4045. [Google Scholar] [CrossRef] [Scilit]
  3. Carvajal Monroy, P.L.; Grefte, S.; Kuijpers-Jagtman, A.M.; Helmich, M.P.; Wagener, F.A.; Von den Hoff, J.W. Fibrosis impairs the formation of new myofibers in the soft palate after injury. Wound Repair. Regen. 2015, 23, 866–873. [Google Scholar] [CrossRef] [Scilit]
  4. Wang, Z.; Knight, R.; Stephens, P.; Ongkosuwito, E.M.; Wagener, F.; Von den Hoff, J.W. Stem cells and extracellular vesicles to improve preclinical orofacial soft tissue healing. Stem Cell Res. Ther. 2023, 14, 203. [Google Scholar] [CrossRef] [Scilit]
  5. Hernández-Hernández, J.M.; García-González, E.G.; Brun, C.E.; Rudnicki, M.A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin. Cell Dev. Biol. 2017, 72, 10–18. [Google Scholar] [CrossRef] [Scilit]
  6. Klingberg, F.; Hinz, B.; White, E.S. The myofibroblast matrix: Implications for tissue repair and fibrosis. J. Pathol. 2013, 229, 298–309. [Google Scholar] [CrossRef] [Scilit]
  7. Von den Hoff, J.W.; Carvajal Monroy, P.L.; Ongkosuwito, E.M.; van Kuppevelt, T.H.; Daamen, W.F. Muscle fibrosis in the soft palate: Delivery of cells, growth factors and anti-fibrotics. Adv. Drug Deliv. Rev. 2019, 146, 60–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Delaney, K.; Kasprzycka, P.; Ciemerych, M.A.; Zimowska, M. The role of TGF-β1 during skeletal muscle regeneration. Cell Biol. Int. 2017, 41, 706–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Cheng, X.; Shi, B.; Li, J. Distinct Embryonic Origin and Injury Response of Resident Stem Cells in Craniofacial Muscles. Front. Physiol. 2021, 12, 690248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Ahmad, K.; Shaikh, S.; Chun, H.J.; Ali, S.; Lim, J.H.; Ahmad, S.S.; Lee, E.J.; Choi, I. Extracellular matrix: The critical contributor to skeletal muscle regeneration—A comprehensive review. Inflamm. Regen. 2023, 43, 58. [Google Scholar] [CrossRef] [Scilit]
  11. Muniyandi, P.; Palaninathan, V.; Mizuki, T.; Maekawa, T.; Hanajiri, T.; Mohamed, M.S. Poly (lactic-co-glycolic acid)/polyethylenimine nanocarriers for direct genetic reprogramming of microRNA targeting cardiac fibroblasts. ACS Appl. Nano Mater. 2020, 3, 2491–2505. [Google Scholar] [CrossRef] [Scilit]
  12. Lamb, Y.N. Nintedanib: A Review in Fibrotic Interstitial Lung Diseases. Drugs 2021, 81, 575–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Rangarajan, S.; Kurundkar, A.; Kurundkar, D.; Bernard, K.; Sanders, Y.Y.; Ding, Q.; Antony, V.B.; Zhang, J.; Zmijewski, J.; Thannickal, V.J. Novel Mechanisms for the Antifibrotic Action of Nintedanib. Am. J. Respir. Cell Mol. Biol. 2016, 54, 51–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Alonso-Pérez, J.; Carrasco-Rozas, A.; Borrell-Pages, M.; Fernández-Simón, E.; Piñol-Jurado, P.; Badimon, L.; Wollin, L.; Lleixà, C.; Gallardo, E.; Olivé, M.; et al. Nintedanib Reduces Muscle Fibrosis and Improves Muscle Function of the Alpha-Sarcoglycan-Deficient Mice. Biomedicines 2022, 10, 2629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Piñol-Jurado, P.; Suárez-Calvet, X.; Fernández-Simón, E.; Gallardo, E.; de la Oliva, N.; Martínez-Muriana, A.; Gómez-Gálvez, P.; Escudero, L.M.; Pérez-Peiró, M.; Wollin, L.; et al. Nintedanib decreases muscle fibrosis and improves muscle function in a murine model of dystrophinopathy. Cell Death Dis. 2018, 9, 776. [Google Scholar] [CrossRef] [Scilit]
  16. Umbarkar, P.; Singh, A.P.; Tousif, S.; Zhang, Q.; Sethu, P.; Lal, H. Repurposing Nintedanib for pathological cardiac remodeling and dysfunction. Pharmacol. Res. 2021, 169, 105605. [Google Scholar] [CrossRef] [Scilit]
  17. Ruiz, S.; Zhao, H.; Chandakkar, P.; Papoin, J.; Choi, H.; Nomura-Kitabayashi, A.; Patel, R.; Gillen, M.; Diao, L.; Chatterjee, P.K.; et al. Correcting Smad1/5/8, mTOR, and VEGFR2 treats pathology in hereditary hemorrhagic telangiectasia models. J. Clin. Investig. 2020, 130, 942–957. [Google Scholar] [CrossRef] [Scilit]
  18. Marconi, G.D.; Fonticoli, L.; Rajan, T.S.; Lanuti, P.; Della Rocca, Y.; Pierdomenico, S.D.; Trubiani, O.; Pizzicannella, J.; Diomede, F. Transforming Growth Factor-Beta1 and Human Gingival Fibroblast-to-Myofibroblast Differentiation: Molecular and Morphological Modifications. Front. Physiol. 2021, 12, 676512. [Google Scholar] [CrossRef] [Scilit]
  19. Komatsu, Y.; Ibi, M.; Chosa, N.; Kyakumoto, S.; Kamo, M.; Shibata, T.; Sugiyama, Y.; Ishisaki, A. Zoledronic acid suppresses transforming growth factor-β-induced fibrogenesis by human gingival fibroblasts. Int. J. Mol. Med. 2016, 38, 139–147. [Google Scholar] [CrossRef] [Scilit]
  20. Su, J.Y.; Yu, C.C.; Peng, C.Y.; Liao, Y.W.; Hsieh, P.L.; Yang, L.C.; Yu, C.H.; Chou, M.Y. Silencing periostin inhibits myofibroblast transdifferentiation of fibrotic buccal mucosal fibroblasts. J. Formos. Med. Assoc. 2021, 120, 2010–2015. [Google Scholar] [CrossRef] [Scilit]
  21. Marty, P.; Chatelain, B.; Lihoreau, T.; Tissot, M.; Dirand, Z.; Humbert, P.; Senez, C.; Secomandi, E.; Isidoro, C.; Rolin, G. Halofuginone regulates keloid fibroblast fibrotic response to TGF-β induction. Biomed. Pharmacother. 2021, 135, 111182. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, L.; Zhang, J.; Xu, C.; Zhou, X.; Wang, W.; Zheng, R.; Hu, W.; Wu, P. Lefty-1 alleviates TGF-β1-induced fibroblast-myofibroblast transdifferentiation in NRK-49F cells. Drug Des. Devel Ther. 2015, 9, 4669–4678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zhang, Y.; Jiao, H.; Wu, Y.; Sun, X. P120-catenin regulates pulmonary fibrosis and TGF-β induced lung fibroblast differentiation. Life Sci. 2019, 230, 35–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Gardner, S.; Alzhanov, D.; Knollman, P.; Kuninger, D.; Rotwein, P. TGF-β inhibits muscle differentiation by blocking autocrine signaling pathways initiated by IGF-II. Mol. Endocrinol. 2011, 25, 128–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Lehmann, M.; Buhl, L.; Alsafadi, H.N.; Klee, S.; Hermann, S.; Mutze, K.; Ota, C.; Lindner, M.; Behr, J.; Hilgendorff, A.; et al. Differential effects of Nintedanib and Pirfenidone on lung alveolar epithelial cell function in ex vivo murine and human lung tissue cultures of pulmonary fibrosis. Respir. Res. 2018, 19, 175. [Google Scholar] [CrossRef] [Scilit]
  26. Huang, J.; Beyer, C.; Palumbo-Zerr, K.; Zhang, Y.; Ramming, A.; Distler, A.; Gelse, K.; Distler, O.; Schett, G.; Wollin, L.; et al. Nintedanib inhibits fibroblast activation and ameliorates fibrosis in preclinical models of systemic sclerosis. Ann. Rheum. Dis. 2016, 75, 883–890. [Google Scholar] [CrossRef] [Scilit]
  27. Basalova, N.; Alexandrushkina, N.; Grigorieva, O.; Kulebyakina, M.; Efimenko, A. Fibroblast Activation Protein Alpha (FAPα) in Fibrosis: Beyond a Perspective Marker for Activated Stromal Cells? Biomolecules 2023, 13, 1718. [Google Scholar] [CrossRef] [Scilit]
  28. Antar, S.A.; Ashour, N.A.; Marawan, M.E.; Al-Karmalawy, A.A. Fibrosis: Types, Effects, Markers, Mechanisms for Disease Progression, and Its Relation with Oxidative Stress, Immunity, and Inflammation. Int. J. Mol. Sci. 2023, 24, 4004. [Google Scholar] [CrossRef] [Scilit]
  29. Scholzen, T.; Gerdes, J. The Ki-67 protein: From the known and the unknown. J. Cell. Physiol. 2000, 182, 311–322. [Google Scholar] [CrossRef] [Scilit]
  30. Ferguson, B.S.; Wennersten, S.A.; Demos-Davies, K.M.; Rubino, M.; Robinson, E.L.; Cavasin, M.A.; Stratton, M.S.; Kidger, A.M.; Hu, T.; Keyse, S.M.; et al. DUSP5-mediated inhibition of smooth muscle cell proliferation suppresses pulmonary hypertension and right ventricular hypertrophy. Am. J. Physiol. Heart Circ. Physiol. 2021, 321, H382–H389. [Google Scholar] [CrossRef] [Scilit]
  31. Rudnicki, M.A.; Schnegelsberg, P.N.; Stead, R.H.; Braun, T.; Arnold, H.H.; Jaenisch, R. MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 1993, 75, 1351–1359. [Google Scholar] [CrossRef] [Scilit]
  32. Cosgrove, B.D.; Gilbert, P.M.; Porpiglia, E.; Mourkioti, F.; Lee, S.P.; Corbel, S.Y.; Llewellyn, M.E.; Delp, S.L.; Blau, H.M. Rejuvenation of the muscle stem cell population restores strength to injured aged muscles. Nat. Med. 2014, 20, 255–264. [Google Scholar] [CrossRef] [Scilit]
  33. Schreurs, M.; Suttorp, C.M.; Mutsaers, H.A.M.; Kuijpers-Jagtman, A.M.; Von den Hoff, J.W.; Ongkosuwito, E.M.; Carvajal Monroy, P.L.; Wagener, F. Tissue engineering strategies combining molecular targets against inflammation and fibrosis, and umbilical cord blood stem cells to improve hampered muscle and skin regeneration following cleft repair. Med. Res. Rev. 2020, 40, 9–26. [Google Scholar] [CrossRef] [Scilit]
  34. Sobral, L.M.; Montan, P.F.; Martelli-Junior, H.; Graner, E.; Coletta, R.D. Opposite effects of TGF-beta1 and IFN-gamma on transdifferentiation of myofibroblast in human gingival cell cultures. J. Clin. Periodontol. 2007, 34, 397–406. [Google Scholar] [CrossRef] [Scilit]
  35. Bell, T.J.; Nagel, D.J.; Woeller, C.F.; Kottmann, R.M. Ogerin mediated inhibition of TGF-β(1) induced myofibroblast differentiation is potentiated by acidic pH. PLoS ONE 2022, 17, e0271608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Kottmann, R.M.; Kulkarni, A.A.; Smolnycki, K.A.; Lyda, E.; Dahanayake, T.; Salibi, R.; Honnons, S.; Jones, C.; Isern, N.G.; Hu, J.Z.; et al. Lactic acid is elevated in idiopathic pulmonary fibrosis and induces myofibroblast differentiation via pH-dependent activation of transforming growth factor-β. Am. J. Respir. Crit. Care Med. 2012, 186, 740–751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Qu, C.; Liu, X.; Ye, T.; Wang, L.; Liu, S.; Zhou, X.; Wu, G.; Lin, J.; Shi, S.; Yang, B. miR-216a exacerbates TGF-β-induced myofibroblast transdifferentiation via PTEN/AKT signaling. Mol. Med. Rep. 2019, 19, 5345–5352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Meran, S.; Thomas, D.; Stephens, P.; Martin, J.; Bowen, T.; Phillips, A.; Steadman, R. Involvement of hyaluronan in regulation of fibroblast phenotype. J. Biol. Chem. 2007, 282, 25687–25697. [Google Scholar] [CrossRef] [Scilit]
  39. Meran, S.; Luo, D.D.; Simpson, R.; Martin, J.; Wells, A.; Steadman, R.; Phillips, A.O. Hyaluronan facilitates transforming growth factor-β1-dependent proliferation via CD44 and epidermal growth factor receptor interaction. J. Biol. Chem. 2011, 286, 17618–17630. [Google Scholar] [CrossRef] [Scilit]
  40. Meran, S.; Thomas, D.W.; Stephens, P.; Enoch, S.; Martin, J.; Steadman, R.; Phillips, A.O. Hyaluronan facilitates transforming growth factor-beta1-mediated fibroblast proliferation. J. Biol. Chem. 2008, 283, 6530–6545. [Google Scholar] [CrossRef] [Scilit]
  41. Cheng, W.S.; Chen, C.L.; Chen, J.T.; Lin, L.T.; Pao, S.I.; Chen, Y.H.; Lu, D.W. AR12286 Alleviates TGF-β-Related Myofibroblast Transdifferentiation and Reduces Fibrosis after Glaucoma Filtration Surgery. Molecules 2020, 25, 4422. [Google Scholar] [CrossRef] [Scilit]
  42. Joannes, A.; Voisin, T.; Morzadec, C.; Letellier, A.; Gutierrez, F.L.; Chiforeanu, D.C.; Le Naoures, C.; Guillot, S.; De Latour, B.R.; Rouze, S.; et al. Anti-fibrotic effects of nintedanib on lung fibroblasts derived from patients with Progressive Fibrosing Interstitial Lung Diseases (PF-ILDs). Pulm. Pharmacol. Ther. 2023, 83, 102267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Yang, W.; Pan, L.; Cheng, Y.; Wu, X.; Tang, B.; Zhu, H.; Zhang, M.; Zhang, Y. Nintedanib alleviates pulmonary fibrosis in vitro and in vivo by inhibiting the FAK/ERK/S100A4 signalling pathway. Int. Immunopharmacol. 2022, 113, 109409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Hostettler, K.E.; Zhong, J.; Papakonstantinou, E.; Karakiulakis, G.; Tamm, M.; Seidel, P.; Sun, Q.; Mandal, J.; Lardinois, D.; Lambers, C.; et al. Anti-fibrotic effects of nintedanib in lung fibroblasts derived from patients with idiopathic pulmonary fibrosis. Respir. Res. 2014, 15, 157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Lin, X.; Wen, J.; Liu, R.; Gao, W.; Qu, B.; Yu, M. Nintedanib inhibits TGF-β-induced myofibroblast transdifferentiation in human Tenon’s fibroblasts. Mol. Vis. 2018, 24, 789–800. [Google Scholar]
  46. Younesi, F.S.; Miller, A.E.; Barker, T.H.; Rossi, F.M.V.; Hinz, B. Fibroblast and myofibroblast activation in normal tissue repair and fibrosis. Nat. Rev. Mol. Cell Biol. 2024, 25, 617–638. [Google Scholar] [CrossRef] [Scilit]
  47. Meyer, K.; Hodwin, B.; Ramanujam, D.; Engelhardt, S.; Sarikas, A. Essential Role for Premature Senescence of Myofibroblasts in Myocardial Fibrosis. J. Am. Coll. Cardiol. 2016, 67, 2018–2028. [Google Scholar] [CrossRef] [Scilit]
  48. Roche, P.L.; Nagalingam, R.S.; Bagchi, R.A.; Aroutiounova, N.; Belisle, B.M.; Wigle, J.T.; Czubryt, M.P. Role of scleraxis in mechanical stretch-mediated regulation of cardiac myofibroblast phenotype. Am. J. Physiol. Cell Physiol. 2016, 311, C297–C307. [Google Scholar] [CrossRef] [Scilit]
  49. Rahimi, A.M.; Cai, M.; Hoyer-Fender, S. Heterogeneity of the NIH3T3 Fibroblast Cell Line. Cells 2022, 11, 2677. [Google Scholar] [CrossRef] [Scilit]
  50. Vaughan, M.B.; Odejimi, T.D.; Morris, T.L.; Sawalha, D.; Spencer, C.L. A new bioassay identifies proliferation ratios of fibroblasts and myofibroblasts. Cell Biol. Int. 2014, 38, 981–986. [Google Scholar] [CrossRef] [Scilit]
  51. Segeritz, C.-P.; Vallier, L. Chapter 9—Cell Culture: Growing Cells as Model Systems In Vitro. In Basic Science Methods for Clinical Researchers; Jalali, M., Saldanha, F.Y.L., Jalali, M., Eds.; Academic Press: Boston, MA, USA, 2017; pp. 151–172. [Google Scholar]
  52. Lehtonen, S.T.; Veijola, A.; Karvonen, H.; Lappi-Blanco, E.; Sormunen, R.; Korpela, S.; Zagai, U.; Sköld, M.C.; Kaarteenaho, R. Pirfenidone and nintedanib modulate properties of fibroblasts and myofibroblasts in idiopathic pulmonary fibrosis. Respir. Res. 2016, 17, 14. [Google Scholar] [CrossRef] [Scilit]
  53. Zhou, B.Y.; Wang, W.B.; Wu, X.L.; Zhang, W.J.; Zhou, G.D.; Gao, Z.; Liu, W. Nintedanib inhibits keloid fibroblast functions by blocking the phosphorylation of multiple kinases and enhancing receptor internalization. Acta Pharmacol. Sin. 2020, 41, 1234–1245. [Google Scholar] [CrossRef] [Scilit]
  54. Grafe, I.; Alexander, S.; Peterson, J.R.; Snider, T.N.; Levi, B.; Lee, B.; Mishina, Y. TGF-β Family Signaling in Mesenchymal Differentiation. Cold Spring Harb. Perspect. Biol. 2018, 10, a022202. [Google Scholar] [CrossRef] [Scilit]
  55. Guo, Q.; Luo, Q.; Song, G. Control of muscle satellite cell function by specific exercise-induced cytokines and their applications in muscle maintenance. J. Cachexia Sarcopenia Muscle 2024, 15, 466–476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Massagué, J. TGFβ signalling in context. Nat. Rev. Mol. Cell Biol. 2012, 13, 616–630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Droguett, R.; Cabello-Verrugio, C.; Santander, C.; Brandan, E. TGF-beta receptors, in a Smad-independent manner, are required for terminal skeletal muscle differentiation. Exp. Cell Res. 2010, 316, 2487–2503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Hamaguchi, H.; Dohi, K.; Sakai, T.; Taoka, M.; Isobe, T.; Matsui, T.S.; Deguchi, S.; Furuichi, Y.; Fujii, N.L.; Manabe, Y. PDGF-B secreted from skeletal muscle enhances myoblast proliferation and myotube maturation via activation of the PDGFR signaling cascade. Biochem. Biophys. Res. Commun. 2023, 639, 169–175. [Google Scholar] [CrossRef] [Scilit]
  59. Otsuka, T.; Kan, H.M.; Mengsteab, P.Y.; Tyson, B.; Laurencin, C.T. Fibroblast growth factor 8b (FGF-8b) enhances myogenesis and inhibits adipogenesis in rotator cuff muscle cell populations in vitro. Proc. Natl. Acad. Sci. USA 2024, 121, e2314585121. [Google Scholar] [CrossRef] [Scilit]
  60. Scully, D.; Sfyri, P.; Verpoorten, S.; Papadopoulos, P.; Muñoz-Turrillas, M.C.; Mitchell, R.; Aburima, A.; Patel, K.; Gutiérrez, L.; Naseem, K.M.; et al. Platelet releasate promotes skeletal myogenesis by increasing muscle stem cell commitment to differentiation and accelerates muscle regeneration following acute injury. Acta Physiol. 2019, 225, e13207. [Google Scholar] [CrossRef] [Scilit]
  61. Liu, C.; Li, J.; Xiang, X.; Guo, L.; Tu, K.; Liu, Q.; Shah, V.H.; Kang, N. PDGF receptor-α promotes TGF-β signaling in hepatic stellate cells via transcriptional and posttranscriptional regulation of TGF-β receptors. Am. J. Physiol. Gastrointest. Liver Physiol. 2014, 307, G749–G759. [Google Scholar] [CrossRef] [Scilit]
  62. Contreras, O.; Cruz-Soca, M.; Theret, M.; Soliman, H.; Tung, L.W.; Groppa, E.; Rossi, F.M.; Brandan, E. Cross-talk between TGF-β and PDGFRα signaling pathways regulates the fate of stromal fibro-adipogenic progenitors. J. Cell Sci. 2019, 132, jcs232157. [Google Scholar] [CrossRef] [Scilit]
  63. Kim, M.H.; Jung, S.Y.; Song, K.H.; Park, J.I.; Ahn, J.; Kim, E.H.; Park, J.K.; Hwang, S.G.; Woo, H.J.; Song, J.Y. A new FGFR inhibitor disrupts the TGF-β1-induced fibrotic process. J. Cell Mol. Med. 2020, 24, 830–840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Giannouli, C.C.; Kletsas, D. TGF-beta regulates differentially the proliferation of fetal and adult human skin fibroblasts via the activation of PKA and the autocrine action of FGF-2. Cell. Signal. 2006, 18, 1417–1429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Li, M.; Zhou, Y.; Wang, T.; Li, M.; Chen, X.; Zhang, T.; Wang, D.; Zhang, J. Nintedanib exerts anti-pulmonary fibrosis activity via inhibiting TANK-binding kinase 1 (TBK1) phosphorylation. Chem. Commun. 2022, 58, 1199–1202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. de Caestecker, M.P.; Parks, W.T.; Frank, C.J.; Castagnino, P.; Bottaro, D.P.; Roberts, A.B.; Lechleider, R.J. Smad2 transduces common signals from receptor serine-threonine and tyrosine kinases. Genes. Dev. 1998, 12, 1587–1592. [Google Scholar] [CrossRef] [Scilit]
  67. Mori, S.; Matsuzaki, K.; Yoshida, K.; Furukawa, F.; Tahashi, Y.; Yamagata, H.; Sekimoto, G.; Seki, T.; Matsui, H.; Nishizawa, M.; et al. TGF-beta and HGF transmit the signals through JNK-dependent Smad2/3 phosphorylation at the linker regions. Oncogene 2004, 23, 7416–7429. [Google Scholar] [CrossRef] [Scilit]
  68. Han, J.; Zhang, J.; Zhang, X.; Luo, W.; Liu, L.; Zhu, Y.; Liu, Q.; Zhang, X.A. Emerging role and function of Hippo-YAP/TAZ signaling pathway in musculoskeletal disorders. Stem Cell Res. Ther. 2024, 15, 386. [Google Scholar] [CrossRef] [Scilit]
  69. Kim, K.M.; Yoo, G.D.; Heo, W.; Oh, H.T.; Park, J.; Shin, S.; Do, Y.; Jeong, M.G.; Hwang, E.S.; Hong, J.H. TAZ stimulates exercise-induced muscle satellite cell activation via Pard3-p38 MAPK-TAZ signalling axis. J. Cachexia Sarcopenia Muscle 2023, 14, 2733–2746. [Google Scholar] [CrossRef] [Scilit]
  70. Deldicque, L.; Theisen, D.; Bertrand, L.; Hespel, P.; Hue, L.; Francaux, M. Creatine enhances differentiation of myogenic C2C12 cells by activating both p38 and Akt/PKB pathways. Am. J. Physiol. Cell Physiol. 2007, 293, C1263–C1271. [Google Scholar] [CrossRef] [Scilit]
  71. Ohno, Y.; Oyama, A.; Kaneko, H.; Egawa, T.; Yokoyama, S.; Sugiura, T.; Ohira, Y.; Yoshioka, T.; Goto, K. Lactate increases myotube diameter via activation of MEK/ERK pathway in C2C12 cells. Acta Physiol. 2018, 223, e13042. [Google Scholar] [CrossRef] [Scilit]
  72. Cottin, V.; Martinez, F.J.; Jenkins, R.G.; Belperio, J.A.; Kitamura, H.; Molina-Molina, M.; Tschoepe, I.; Coeck, C.; Lievens, D.; Costabel, U. Safety and tolerability of nintedanib in patients with progressive fibrosing interstitial lung diseases: Data from the randomized controlled INBUILD trial. Respir. Res. 2022, 23, 85. [Google Scholar] [CrossRef] [Scilit]
  73. Bendstrup, E.; Wuyts, W.; Alfaro, T.; Chaudhuri, N.; Cornelissen, R.; Kreuter, M.; Melgaard Nielsen, K.; Münster, A.-M.B.; Myllärniemi, M.; Ravaglia, C.; et al. Nintedanib in Idiopathic Pulmonary Fibrosis: Practical Management Recommendations for Potential Adverse Events. Respiration 2018, 97, 173–184. [Google Scholar] [CrossRef] [Scilit]
Biomolecules 16 00316 g001
Figure 1. Rat gingival fibroblasts cultured with different concentrations of TGF-β1 and Nintedanib. (A) Representative immunofluorescence images with α-SMA (red) and DAPI (blue) staining of the effect of TGF-β1 on fibroblast differentiation after 4 days. (B) Quantification of the effect of TGF-β1 on myofibroblast formation after 4 days. (C) Representative immunofluorescence images with α-SMA (red) and DAPI (blue) staining of the effect of Nintedanib (in culture medium with 0.1%DMSO and 10 ng/mL TGF-β1) on fibroblasts after 4 days. (D) Quantifying the effect of increasing concentrations of Nintedanib (with 0.1%DMSO and 10 ng/mL TGF-β1) on fibroblast differentiation after 4 days. Scale bar: 200 µm or 20 µm. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Figure 1. Rat gingival fibroblasts cultured with different concentrations of TGF-β1 and Nintedanib. (A) Representative immunofluorescence images with α-SMA (red) and DAPI (blue) staining of the effect of TGF-β1 on fibroblast differentiation after 4 days. (B) Quantification of the effect of TGF-β1 on myofibroblast formation after 4 days. (C) Representative immunofluorescence images with α-SMA (red) and DAPI (blue) staining of the effect of Nintedanib (in culture medium with 0.1%DMSO and 10 ng/mL TGF-β1) on fibroblasts after 4 days. (D) Quantifying the effect of increasing concentrations of Nintedanib (with 0.1%DMSO and 10 ng/mL TGF-β1) on fibroblast differentiation after 4 days. Scale bar: 200 µm or 20 µm. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Biomolecules 16 00316 g001
Biomolecules 16 00316 g002
Figure 2. Effects of Nintedanib on (myo)fibroblast and proliferation marker gene expression and cell viability assay. (A–E) Gene expression analyses of fibroblast activation ((A), FAP) and myofibroblast differentiation ((B), ACTA2 and (C), COL1a1) and proliferation ((D), Ki-67 and (E), DUSP5) markers, after fibroblasts were cultured with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 10 ng/mL TGF-β1) for 2 days. The reference gene was GAPDH. (F) Representative images of the LIVE/DEAD cell viability assay after fibroblasts were cultured with increasing concentrations of Nintedanib (with 0.1% DMSO and 10 ng/mL TGF-β1) for 4 days. (G) Quantification of the LIVE/DEAD cell viability assay after fibroblasts were cultured with increasing concentrations of Nintedanib (with 0.1% DMSO and 10 ng/mL TGF-β1) for 4 days. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Figure 2. Effects of Nintedanib on (myo)fibroblast and proliferation marker gene expression and cell viability assay. (A–E) Gene expression analyses of fibroblast activation ((A), FAP) and myofibroblast differentiation ((B), ACTA2 and (C), COL1a1) and proliferation ((D), Ki-67 and (E), DUSP5) markers, after fibroblasts were cultured with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 10 ng/mL TGF-β1) for 2 days. The reference gene was GAPDH. (F) Representative images of the LIVE/DEAD cell viability assay after fibroblasts were cultured with increasing concentrations of Nintedanib (with 0.1% DMSO and 10 ng/mL TGF-β1) for 4 days. (G) Quantification of the LIVE/DEAD cell viability assay after fibroblasts were cultured with increasing concentrations of Nintedanib (with 0.1% DMSO and 10 ng/mL TGF-β1) for 4 days. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Biomolecules 16 00316 g002
Biomolecules 16 00316 g003
Figure 3. Rat satellite cells cultured with different concentrations of TGF-β1 and Nintedanib. (A) Representative immunofluorescence images of myotubes stained for MyHC (green) and DAPI (blue) after culture with different concentrations of TGF-β1 for 4 days. (B) Quantification analysis of the effect of TGF-β1 on satellite cells after 4 days. (C) Representative immunofluorescence images of myotubes stained for MyHC (green) and DAPI (blue) staining after culture with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 0.2 ng/mL TGF-β1) for 4 days. (D) Quantification analysis of the effect of Nintedanib (with 0.1% DMSO and 0.2 ng/mL TGF-β1) on SCs after 4 days. Scale bar: 200 µm or 20 µm. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Figure 3. Rat satellite cells cultured with different concentrations of TGF-β1 and Nintedanib. (A) Representative immunofluorescence images of myotubes stained for MyHC (green) and DAPI (blue) after culture with different concentrations of TGF-β1 for 4 days. (B) Quantification analysis of the effect of TGF-β1 on satellite cells after 4 days. (C) Representative immunofluorescence images of myotubes stained for MyHC (green) and DAPI (blue) staining after culture with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 0.2 ng/mL TGF-β1) for 4 days. (D) Quantification analysis of the effect of Nintedanib (with 0.1% DMSO and 0.2 ng/mL TGF-β1) on SCs after 4 days. Scale bar: 200 µm or 20 µm. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Biomolecules 16 00316 g003
Biomolecules 16 00316 g004
Figure 4. Effects of Nintedanib on myoblast differentiation marker expression. Gene expression analyses of myoblast differentiation markers, pax7 (A), MyoD (B), MyoG (C), and MyHC (D) after SCs were cultured with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 0.2 ng/mL TGF-β1) for 2 days. The reference gene for PCR was GAPDH. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Figure 4. Effects of Nintedanib on myoblast differentiation marker expression. Gene expression analyses of myoblast differentiation markers, pax7 (A), MyoD (B), MyoG (C), and MyHC (D) after SCs were cultured with increasing concentrations of Nintedanib (in culture medium with 0.1% DMSO and 0.2 ng/mL TGF-β1) for 2 days. The reference gene for PCR was GAPDH. Statistical analysis was conducted with one-way ANOVA; * indicates p < 0.05.
Biomolecules 16 00316 g004
Biomolecules 16 00316 g005
Figure 5. Proposed mechanism of Nintedanib on myofibroblast differentiation and myotube formation. Nintedanib interacts with multiple receptors and signaling pathways to inhibit fibroblast-to-myofibroblast differentiation while promoting myotube formation from satellite cells. As a broad-spectrum tyrosine kinase inhibitor, it primarily targets PDGFR, FGFR, and VEGFR. The downstream mechanisms involve both the canonical TGF-β/Smad signaling pathway and several non-canonical pathways, including ERK, JNK, p38, PI3K/Akt, and YAP/TAZ signaling (created with BioRender.com).
Figure 5. Proposed mechanism of Nintedanib on myofibroblast differentiation and myotube formation. Nintedanib interacts with multiple receptors and signaling pathways to inhibit fibroblast-to-myofibroblast differentiation while promoting myotube formation from satellite cells. As a broad-spectrum tyrosine kinase inhibitor, it primarily targets PDGFR, FGFR, and VEGFR. The downstream mechanisms involve both the canonical TGF-β/Smad signaling pathway and several non-canonical pathways, including ERK, JNK, p38, PI3K/Akt, and YAP/TAZ signaling (created with BioRender.com).
Biomolecules 16 00316 g005
Table 1. Primer sequences for real-time PCR.
Table 1. Primer sequences for real-time PCR.
GeneForward PrimerReverse Primer
GAPDHGTGCCAGCCTCGTCTCATAGAGAGAAGGCAGCCCTGGTAA
MyHCACTTCAAGCAGAGATACAAGGGTGTGACCAAACTTATACTGAG
MyoDCGACTGCCTGTCCAGCATAGGGACACTGAGGGGTGGAGTC
MyoGAACCCAGGAGATCATTTGCTGGTGACAGACATATCCTCCA
Pax7AGCCGAGTGCTCAGAATCAATCCTCTCGAAAGCCTTCTCC
FAPACACGGAGAGATTCATGGGCCCTGGAAATCCACTTGTGCG
ACTA2CTATTCCTTCGTGACTACTATGCTGTTATAGGTGGTT
COL1a1TCACCTACAGCACGCTTGGGTCTGTTTCCAGGGTTG
Ki-67TTCAGTGAAGATCTGTCAGCAGGACTAAGGAGCACTTTTTCTCCCAAA
DUSP5CTCACCTCGCTGCTGGCCTGTCTGGCCTCTTTCACCTTCGAGCTTCTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Wagener, F.A.D.T.G.; Ongkosuwito, E.M.; Von den Hoff, J.W. Effects of Nintedanib on Orofacial Fibroblasts and Myoblasts. Biomolecules 2026, 16, 316. https://doi.org/10.3390/biom16020316

AMA Style

Wang Z, Wagener FADTG, Ongkosuwito EM, Von den Hoff JW. Effects of Nintedanib on Orofacial Fibroblasts and Myoblasts. Biomolecules. 2026; 16(2):316. https://doi.org/10.3390/biom16020316

Chicago/Turabian Style

Wang, Zhihao, Frank A. D. T. G. Wagener, Edwin M. Ongkosuwito, and Johannes W. Von den Hoff. 2026. "Effects of Nintedanib on Orofacial Fibroblasts and Myoblasts" Biomolecules 16, no. 2: 316. https://doi.org/10.3390/biom16020316

APA Style

Wang, Z., Wagener, F. A. D. T. G., Ongkosuwito, E. M., & Von den Hoff, J. W. (2026). Effects of Nintedanib on Orofacial Fibroblasts and Myoblasts. Biomolecules, 16(2), 316. https://doi.org/10.3390/biom16020316

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop