Activated Microglia-Derived Extracellular Vesicles Elicit a Pro-Inflammatory Astrocytic Response via Cargo-Dependent Mechanisms
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.1.1. Microglial Culture and Primary Astrocyte Isolation
2.1.2. Treatment of Microglial Cells and Primary Astrocytes
2.1.3. Extracellular Vesicle Isolation
2.2. Nanoparticle Tracking Analysis (NTA)
2.3. IncuCyte Tracking Analysis and Confocal Microscopy
2.4. Gene Expression Analysis
2.5. Western Blot Analysis
2.6. Mass Spectrometry
2.7. Proteomics Analysis
2.8. Statistical Analysis
3. Results
3.1. BV-2-Derived Extracellular Vesicle Characterization and Uptake by Astrocytes
3.2. Activated BV-2-Derived Exosomes Induce an Astrocyte Phenotype Shift
3.3. Astrocytes Express Inflammatory Mediators in Response to Activated BV-2-Derived Exosome Stimulation
3.4. Different Extracellular Vesicles Have Distinct Protein Cargo
3.5. Proteomic Signatures Depleted in Activated Microglia-Derived Extracellular Vesicles
3.6. Proteomic Signatures Enriched in Activated Microglia-Derived Extracellular Vesicles
4. Discussion
5. Study Limitations
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kwon, H.S.; Koh, S.H. Neuroinflammation in neurodegenerative disorders: The roles of microglia and astrocytes. Transl. Neurodegener. 2020, 9, 42. [Google Scholar] [CrossRef] [Scilit]
- Kempuraj, D.; Thangavel, R.; Natteru, P.A.; Selvakumar, G.P.; Saeed, D.; Zahoor, H.; Zaheer, S.; Iyer, S.S.; Zaheer, A. Neuroinflammation induces neurodegeneration. J. Neurol. Neurosurg. Spine 2016, 1, 1003. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28127589 (accessed on 12 August 2025).
- Liddelow, S.A.; Barres, B.A. Reactive astrocytes: Production, function, and therapeutic potential. Immunity 2017, 46, 957–967. [Google Scholar] [CrossRef] [Scilit]
- Javanmehr, N.; Saleki, K.; Alijanizadeh, P.; Rezaei, N. Microglia dynamics in aging-related neurobehavioral and neuroinflammatory diseases. J. Neuroinflamm. 2022, 19, 273. [Google Scholar] [CrossRef] [Scilit]
- Estes, M.L.; McAllister, A.K. Alterations in immune cells and mediators in the brain: It’s not always neuroinflammation! Brain Pathol. 2014, 24, 623–630. [Google Scholar] [CrossRef] [Scilit]
- Mracsko, E.; Veltkamp, R. Neuroinflammation after intracerebral hemorrhage. Front. Cell. Neurosci. 2014, 8, 388. [Google Scholar] [CrossRef] [Scilit]
- Woodburn, S.C.; Bollinger, J.L.; Wohleb, E.S. The semantics of microglia activation: Neuroinflammation, homeostasis, and stress. J. Neuroinflamm. 2021, 18, 258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nayak, D.; Roth, T.L.; McGavern, D.B. Microglia development and function. Annu. Rev. Immunol. 2014, 32, 367–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Pan, W.; Xu, Y.; Zhang, J.; Wan, J.; Jiang, H. Microglia-mediated neuroinflammation: A potential target for the treatment of cardiovascular diseases. J. Inflamm. Res. 2022, 15, 3083–3094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Colonna, M.; Butovsky, O. Microglia function in the central nervous system during health and neurodegeneration. Annu. Rev. Immunol. 2017, 35, 441–468. [Google Scholar] [CrossRef] [Scilit]
- Guo, S.; Wang, H.; Yin, Y. Microglia polarization from m1 to m2 in neurodegenerative diseases. Front. Aging Neurosci. 2022, 14, 815347. [Google Scholar] [CrossRef] [Scilit]
- Song, G.J.; Suk, K. Pharmacological modulation of functional phenotypes of microglia in neurodegenerative diseases. Front. Aging Neurosci. 2017, 9, 139. [Google Scholar] [CrossRef] [Scilit]
- Subhramanyam, C.S.; Wang, C.; Hu, Q.; Dheen, S.T. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin. Cell Dev. Biol. 2019, 94, 112–120. [Google Scholar] [CrossRef] [Scilit]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, eaau6977. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skrzypczak-Wiercioch, A.; Salat, K. Lipopolysaccharide-induced model of neuroinflammation: Mechanisms of action, research application and future directions for its use. Molecules 2022, 27, 5481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diaz-Castro, B.; Bernstein, A.M.; Coppola, G.; Sofroniew, M.V.; Khakh, B.S. Molecular and functional properties of cortical astrocytes during peripherally induced neuroinflammation. Cell Rep. 2021, 36, 109508. [Google Scholar] [CrossRef] [Scilit]
- Giovannoni, F.; Quintana, F.J. The role of astrocytes in cns inflammation. Trends Immunol. 2020, 41, 805–819. [Google Scholar] [CrossRef] [Scilit]
- Miller, S.J. Astrocyte heterogeneity in the adult central nervous system. Front. Cell. Neurosci. 2018, 12, 401. [Google Scholar] [CrossRef] [Scilit]
- Tran, V.T.A.; Lee, L.P.; Cho, H. Neuroinflammation in neurodegeneration via microbial infections. Front. Immunol. 2022, 13, 907804. [Google Scholar] [CrossRef] [Scilit]
- Tsai, H.H.; Li, H.; Fuentealba, L.C.; Molofsky, A.V.; Taveira-Marques, R.; Zhuang, H.; Tenney, A.; Murnen, A.T.; Fancy, S.P.; Merkle, F.; et al. Regional astrocyte allocation regulates cns synaptogenesis and repair. Science 2012, 337, 358–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sofroniew, M.V. Astrogliosis. Cold Spring Harb. Perspect. Biol. 2014, 7, a020420. [Google Scholar] [CrossRef] [Scilit]
- Escartin, C.; Galea, E.; Lakatos, A.; O’Callaghan, J.P.; Petzold, G.C.; Serrano-Pozo, A.; Steinhauser, C.; Volterra, A.; Carmignoto, G.; Agarwal, A.; et al. Reactive astrocyte nomenclature, definitions, and future directions. Nat. Neurosci. 2021, 24, 312–325. [Google Scholar] [CrossRef] [Scilit]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Munch, A.E.; Chung, W.S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef] [Scilit]
- Zamanian, J.L.; Xu, L.; Foo, L.C.; Nouri, N.; Zhou, L.; Giffard, R.G.; Barres, B.A. Genomic analysis of reactive astrogliosis. J. Neurosci. 2012, 32, 6391–6410. [Google Scholar] [CrossRef] [Scilit]
- Taylor, X.; Cisternas, P.; Jury, N.; Martinez, P.; Huang, X.; You, Y.; Redding-Ochoa, J.; Vidal, R.; Zhang, J.; Troncoso, J.; et al. Activated endothelial cells induce a distinct type of astrocytic reactivity. Commun. Biol. 2022, 5, 282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruan, J.; Miao, X.; Schluter, D.; Lin, L.; Wang, X. Extracellular vesicles in neuroinflammation: Pathogenesis, diagnosis, and therapy. Mol. Ther. 2021, 29, 1946–1957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dar, G.H.; Badierah, R.; Nathan, E.G.; Bhat, M.A.; Dar, A.H.; Redwan, E.M. Extracellular vesicles: A new paradigm in understanding, diagnosing and treating neurodegenerative disease. Front. Aging Neurosci. 2022, 14, 967231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fruhbeis, C.; Frohlich, D.; Kuo, W.P.; Kramer-Albers, E.M. Extracellular vesicles as mediators of neuron-glia communication. Front. Cell. Neurosci. 2013, 7, 182. [Google Scholar] [CrossRef] [Scilit]
- Paolicelli, R.C.; Bergamini, G.; Rajendran, L. Cell-to-cell communication by extracellular vesicles: Focus on microglia. Neuroscience 2019, 405, 148–157. [Google Scholar] [CrossRef] [Scilit]
- Ceccarelli, L.; Giacomelli, C.; Marchetti, L.; Martini, C. Microglia extracellular vesicles: Focus on molecular composition and biological function. Biochem. Soc. Trans. 2021, 49, 1779–1790. [Google Scholar] [CrossRef] [Scilit]
- Potolicchio, I.; Carven, G.J.; Xu, X.; Stipp, C.; Riese, R.J.; Stern, L.J.; Santambrogio, L. Proteomic analysis of microglia-derived exosomes: Metabolic role of the aminopeptidase cd13 in neuropeptide catabolism. J. Immunol. 2005, 175, 2237–2243. [Google Scholar] [CrossRef] [Scilit]
- Kumar, A.; Stoica, B.A.; Loane, D.J.; Yang, M.; Abulwerdi, G.; Khan, N.; Kumar, A.; Thom, S.R.; Faden, A.I. Microglial-derived microparticles mediate neuroinflammation after traumatic brain injury. J. Neuroinflamm. 2017, 14, 47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spiers, J.G.; Vassileff, N.; Hill, A.F. Neuroinflammatory modulation of extracellular vesicle biogenesis and cargo loading. Neuromol. Med. 2022, 24, 385–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verderio, C.; Muzio, L.; Turola, E.; Bergami, A.; Novellino, L.; Ruffini, F.; Riganti, L.; Corradini, I.; Francolini, M.; Garzetti, L.; et al. Myeloid microvesicles are a marker and therapeutic target for neuroinflammation. Ann. Neurol. 2012, 72, 610–624. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Boza-Serrano, A.; Dunning, C.J.R.; Clausen, B.H.; Lambertsen, K.L.; Deierborg, T. Inflammation leads to distinct populations of extracellular vesicles from microglia. J. Neuroinflamm. 2018, 15, 168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuang, X.; Xiang, X.; Grizzle, W.; Sun, D.; Zhang, S.; Axtell, R.C.; Ju, S.; Mu, J.; Zhang, L.; Steinman, L.; et al. Treatment of brain inflammatory diseases by delivering exosome encapsulated anti-inflammatory drugs from the nasal region to the brain. Mol. Ther. 2011, 19, 1769–1779. [Google Scholar] [CrossRef] [Scilit]
- Abels, E.R.; Breakefield, X.O. Introduction to extracellular vesicles: Biogenesis, rna cargo selection, content, release, and uptake. Cell. Mol. Neurobiol. 2016, 36, 301–312. [Google Scholar] [CrossRef] [Scilit]
- Crescitelli, R.; Lasser, C.; Szabo, T.G.; Kittel, A.; Eldh, M.; Dianzani, I.; Buzas, E.I.; Lotvall, J. Distinct rna profiles in subpopulations of extracellular vesicles: Apoptotic bodies, microvesicles and exosomes. J. Extracell. Vesicles 2013, 2, 20677. [Google Scholar] [CrossRef] [Scilit]
- Tang, D.; Cao, F.; Yan, C.; Fang, K.; Ma, J.; Gao, L.; Sun, B.; Wang, G. Extracellular vesicle/macrophage axis: Potential targets for inflammatory disease intervention. Front. Immunol. 2022, 13, 705472. [Google Scholar] [CrossRef] [Scilit]
- Younas, N.; Flores, L.C.F.; Hopfner, F.; Hoglinger, G.U.; Zerr, I. A new paradigm for diagnosis of neurodegenerative diseases: Peripheral exosomes of brain origin. Transl. Neurodegener. 2022, 11, 28. [Google Scholar] [CrossRef] [Scilit]
- Marostica, G.; Gelibter, S.; Gironi, M.; Nigro, A.; Furlan, R. Extracellular vesicles in neuroinflammation. Front. Cell Dev. Biol. 2020, 8, 623039. [Google Scholar] [CrossRef] [Scilit]
- Lischnig, A.; Bergqvist, M.; Ochiya, T.; Lasser, C. Quantitative proteomics identifies proteins enriched in large and small extracellular vesicles. Mol. Cell. Proteom. 2022, 21, 100273. [Google Scholar] [CrossRef] [Scilit]
- Zaborowski, M.P.; Balaj, L.; Breakefield, X.O.; Lai, C.P. Extracellular vesicles: Composition, biological relevance, and methods of study. Bioscience 2015, 65, 783–797. [Google Scholar] [CrossRef] [Scilit]
- Gurunathan, S.; Kang, M.H.; Jeyaraj, M.; Qasim, M.; Kim, J.H. Review of the isolation, characterization, biological function, and multifarious therapeutic approaches of exosomes. Cells 2019, 8, 307. [Google Scholar] [CrossRef] [Scilit]
- Isaac, R.; Reis, F.C.G.; Ying, W.; Olefsky, J.M. Exosomes as mediators of intercellular crosstalk in metabolism. Cell Metab. 2021, 33, 1744–1762. [Google Scholar] [CrossRef] [Scilit]
- Raposo, G.; Stoorvogel, W. Extracellular vesicles: Exosomes, microvesicles, and friends. J. Cell Biol. 2013, 200, 373–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blasi, E.; Barluzzi, R.; Bocchini, V.; Mazzolla, R.; Bistoni, F. Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. J. Neuroimmunol. 1990, 27, 229–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarner, T.; Janssen, K.; Nellessen, L.; Stangel, M.; Skripuletz, T.; Krauspe, B.; Hess, F.M.; Denecke, B.; Beutner, C.; Linnartz-Gerlach, B.; et al. Cxcl10 triggers early microglial activation in the cuprizone model. J. Immunol. 2015, 194, 3400–3413. [Google Scholar] [CrossRef] [Scilit]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarner, T.; Diederichs, F.; Berger, K.; Denecke, B.; Gan, L.; van der Valk, P.; Beyer, C.; Amor, S.; Kipp, M. Myelin debris regulates inflammatory responses in an experimental demyelination animal model and multiple sclerosis lesions. Glia 2012, 60, 1468–1480. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time rt-pcr. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. Nih image to imagej: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit]
- Kohler, D.; Staniak, M.; Tsai, T.H.; Huang, T.; Shulman, N.; Bernhardt, O.M.; MacLean, B.X.; Nesvizhskii, A.I.; Reiter, L.; Sabido, E.; et al. Msstats version 4.0: Statistical analyses of quantitative mass spectrometry-based proteomic experiments with chromatography-based quantification at scale. J. Proteome Res. 2023, 22, 1466–1482. [Google Scholar] [CrossRef] [Scilit]
- Xie, Z.; Bailey, A.; Kuleshov, M.V.; Clarke, D.J.B.; Evangelista, J.E.; Jenkins, S.L.; Lachmann, A.; Wojciechowicz, M.L.; Kropiwnicki, E.; Jagodnik, K.M.; et al. Gene set knowledge discovery with enrichr. Curr. Protoc. 2021, 1, e90. [Google Scholar] [CrossRef] [Scilit]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. String v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [Scilit]
- Ceccarelli, L.; Marchetti, L.; Rizzo, M.; Moscardini, A.; Cappello, V.; Da Pozzo, E.; Romano, M.; Giacomelli, C.; Bergese, P.; Martini, C. Human microglia extracellular vesicles derived from different microglia cell lines: Similarities and differences. ACS Omega 2022, 7, 23127–23137. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.; Jia, S.; Bai, L.; Li, D.; Meng, C. Transcriptome analysis unveils that exosomes derived from m1-polarized microglia induce ferroptosis of neuronal cells. Cells 2022, 11, 3956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, L.E.; Liddelow, S.A.; Chakraborty, C.; Munch, A.E.; Heiman, M.; Barres, B.A. Normal aging induces a1-like astrocyte reactivity. Proc. Natl. Acad. Sci. USA 2018, 115, E1896–E1905. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Wang, X.; Cui, Z.; Luo, Q.; Jiang, Z.; Huang, Y.; Jiang, J.; Qiu, J.; Li, Y.; Yu, K.; et al. M1 microglia-derived exosomes promote activation of resting microglia and amplifies proangiogenic effects through irf1/mir-155-5p/socs1 axis in the retina. Int. J. Biol. Sci. 2023, 19, 1791–1812. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, K.C.; Kim, K.; Smith, M.D.; Aston, S.A.; Fioravante, N.; Rothman, A.M.; Krieger, S.; Cofield, S.S.; Kimbrough, D.J.; Bhargava, P.; et al. Early complement genes are associated with visual system degeneration in multiple sclerosis. Brain 2019, 142, 2722–2736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevens, B.; Allen, N.J.; Vazquez, L.E.; Howell, G.R.; Christopherson, K.S.; Nouri, N.; Micheva, K.D.; Mehalow, A.K.; Huberman, A.D.; Stafford, B.; et al. The classical complement cascade mediates cns synapse elimination. Cell 2007, 131, 1164–1178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabrera-Pastor, A. Extracellular vesicles as mediators of neuroinflammation in intercellular and inter-organ crosstalk. Int. J. Mol. Sci. 2024, 25, 7041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pascual, M.; Ibanez, F.; Guerri, C. Exosomes as mediators of neuron-glia communication in neuroinflammation. Neural Regen. Res. 2020, 15, 796–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer | Sense | Anti-Sense | Annealing Temperature [°C] |
|---|---|---|---|
| 18S | CGGCTACCACATCCAAGGAA | GCTGGAATTACCGCGGCT | 60 °C |
| Arg1 | CTCCAAGCCAAAGTCCTTAGAG | AGGAGCTGTCATTAGGGACATC | 61 °C |
| C3 | TCCCAATGTCCTACGGCTG | ACGTACTTGTGCCCCTCCTT | 60 °C |
| Ccl2 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT | 65 °C |
| Ccl5 | GCTGCTTTGCCTACCTCTCC | TCGAGTGACAAACACGACTGC | 65 °C |
| Cxcl10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA | 65 °C |
| Hprt | TCAGTCAACGGGGGACATAAA | GGGGCTGTACTGCTTAACCAG | 65 °C |
| Iba-1 | ATCAACAAGCAATTCCTCGATGA | CAGCATTCGCTTCAAGGACATA | 64 °C |
| Il-1β | GCCCATCCTCTGTGACTCAT | AGGCCACAGGTATTTTGTCG | 61 °C |
| Il-4 | GGTCTCAACCCCCAGCTAGT | GCCGATGATCTCTCTCAAGTGAT | 65 °C |
| iNos/Nos2 | ACATCGACCCGTCCACAGTAT | CAGAGGGGTAGGCTTGTCTC | 64 °C |
| Lcn2 | GCAGGTGGTACGTTGTGGG | CTCTTGTAGCTCATAGATGGTGC | 65 °C |
| Mrc1 | GTGGTCCTCCTGATTGTGATAG | CACTTGTTCCTGGACTCAGATTA | 65 °C |
| S100a10 | ACCACTTGACAAAGGAGGACC | AAAGCTCTGGAAGCCCACTTT | 60 °C |
| Serpina3n | AACCAGAGACCCTGAGGAAGT | AGTTTCGCAGACATTGGGACAA | 60 °C |
| Sphk1 | TATGCTGGGTACGAGCAGGT | CCCACTGTGAAACGAATCTCC | 65 °C |
| Tnf-α | GCCATAGAACTGATGAGAGGGAG | GGTGCCTATGTCTCAGCCTCTT | 62 °C |
| Antibody | Manufacturer | Host, Clonality | Concentration |
|---|---|---|---|
| Anti-CD9 | Invitrogen, SA-35-08 | Rb (m) | 1:1000 |
| Anti-CD81 | Santa Cruz, Dallas, TX, USA, sc18877 | AH (m) | 1:500 |
| Anti-GM130 | Bioscience, San Diego, CA, USA, 610822 | M (m) | 1:1500 |
| Anti-IL-1β | Abcam, ab9722 | Rb (p) | 1:500 |
| Anti-LCN2/NGAL | Cloud clone, Katy, TX, USA, AB388Mu01 | Rb (p) | 1:500 |
| Anti-β-Actin | Santa Cruz, sc47778 | M (m) | 1:5000 |
| Anti-ALDH1L1 | Abcam, ab87117 | Rb (p) | 1:600 |
| Goat Anti-Rabbit IgG (H + L) Alexa Fluor 488 | Invitrogen, A-11008 | Gt (p) | 1:500 |
| Goat Anti-Mouse IgG | Sigma, A4416 | Gt (p) | 1:4000 |
| Goat Anti-Rabbit IgG (H + L)-HRP | BIO-RAD, Hercules, CA, USA, 170-6515 | Gt (p) | 1:5000 |
| Mouse Anti-arm-hamster IgG-HRP | Santa Cruz, sc2789 | M (m) | 1:5000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Scheld, M.; Jülich, N.; Vöhringer, K.; Zendedel, A.; Beyer, C.; Kant, S.; Tillmann, N.; Sanadgol, N. Activated Microglia-Derived Extracellular Vesicles Elicit a Pro-Inflammatory Astrocytic Response via Cargo-Dependent Mechanisms. Biomolecules 2026, 16, 224. https://doi.org/10.3390/biom16020224
Scheld M, Jülich N, Vöhringer K, Zendedel A, Beyer C, Kant S, Tillmann N, Sanadgol N. Activated Microglia-Derived Extracellular Vesicles Elicit a Pro-Inflammatory Astrocytic Response via Cargo-Dependent Mechanisms. Biomolecules. 2026; 16(2):224. https://doi.org/10.3390/biom16020224
Chicago/Turabian StyleScheld, Miriam, Nadine Jülich, Katharina Vöhringer, Adib Zendedel, Cordian Beyer, Sebastian Kant, Natalie Tillmann, and Nima Sanadgol. 2026. "Activated Microglia-Derived Extracellular Vesicles Elicit a Pro-Inflammatory Astrocytic Response via Cargo-Dependent Mechanisms" Biomolecules 16, no. 2: 224. https://doi.org/10.3390/biom16020224
APA StyleScheld, M., Jülich, N., Vöhringer, K., Zendedel, A., Beyer, C., Kant, S., Tillmann, N., & Sanadgol, N. (2026). Activated Microglia-Derived Extracellular Vesicles Elicit a Pro-Inflammatory Astrocytic Response via Cargo-Dependent Mechanisms. Biomolecules, 16(2), 224. https://doi.org/10.3390/biom16020224

