The Inhibitory Effects of Alpha 1 Antitrypsin on Endosomal TLR Signaling Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Cytokine Assays
2.3. cDC Preparation and Cell Cultures
2.4. Flow Cytometry
2.5. Detection of mRNA Levels
2.6. Protein Analyses and Western Blot Analyses
2.7. Statistics
3. Results
3.1. Human AAT Dose Dependently Inhibits TLR9 Pathway
3.2. The Effect of hAAT on Downstream Gene Expressions of TLR9
3.3. The Effect of hAAT on the Activation of TLR9
3.4. The Effect of AAT on TLR7 and TLR8 Pathways
3.5. The Effect of hAAT on Downstream Gene Expressions of TLR7/8
3.6. AAT-tg Mice Are Resistant to R848 Treatment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zucchi, D.; Silvagni, E.; Elefante, E.; Signorini, V.; Cardelli, C.; Trentin, F.; Schilirò, D.; Cascarano, G.; Valevich, A.; Bortoluzzi, A.; et al. Systemic lupus erythematosus: One year in review 2023. Clin. Exp. Rheumatol. 2023, 41, 997–1008. [Google Scholar] [CrossRef] [PubMed]
- Vincent, F.B.; Morand, E.F.; Schneider, P.; Mackay, F. The BAFF/APRIL system in SLE pathogenesis. Nat. Rev. Rheumatol. 2014, 10, 365–373. [Google Scholar] [CrossRef] [PubMed]
- Iwamoto, T.; Dorschner, J.M.; Selvaraj, S.; Mezzano, V.; Jensen, M.A.; Vsetecka, D.; Amin, S.; Makol, A.; Osborn, T.; Moder, K.; et al. High Systemic Type I Interferon Activity Is Associated With Active Class III/IV Lupus Nephritis. J. Rheumatol. 2022, 49, 388–397. [Google Scholar] [CrossRef]
- Wan, S.; Zhou, Z.; Duan, B.; Morel, L. Direct B cell stimulation by dendritic cells in a mouse model of lupus. Arthritis Rheum. 2008, 58, 1741–1750. [Google Scholar] [CrossRef] [PubMed]
- Wan, S.; Xia, C.; Morel, L. IL-6 produced by dendritic cells from lupus-prone mice inhibits CD4+CD25+ T cell regulatory functions. J. Immunol. 2007, 178, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Asami, J.; Shimizu, T. Structural and functional understanding of the toll-like receptors. Protein Sci. 2021, 30, 761–772. [Google Scholar] [CrossRef]
- Park, B.; Brinkmann, M.M.; Spooner, E.; Lee, C.C.; Kim, Y.M.; Ploegh, H.L. Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9. Nat. Immunol. 2008, 9, 1407–1414. [Google Scholar] [CrossRef]
- Sepulveda, F.E.; Maschalidi, S.; Colisson, R.; Heslop, L.; Ghirelli, C.; Sakka, E.; Lennon-Duménil, A.M.; Amigorena, S.; Cabanie, L.; Manoury, B. Critical role for asparagine endopeptidase in endocytic Toll-like receptor signaling in dendritic cells. Immunity 2009, 31, 737–748. [Google Scholar] [CrossRef]
- Ewald, S.E.; Engel, A.; Lee, J.; Wang, M.; Bogyo, M.; Barton, G.M. Nucleic acid recognition by Toll-like receptors is coupled to stepwise processing by cathepsins and asparagine endopeptidase. J. Exp. Med. 2011, 208, 643–651. [Google Scholar] [CrossRef]
- Hipp, M.M.; Shepherd, D.; Gileadi, U.; Aichinger, M.C.; Kessler, B.M.; Edelmann, M.J.; Essalmani, R.; Seidah, N.G.; Reis e Sousa, C.; Cerundolo, V. Processing of human toll-like receptor 7 by furin-like proprotein convertases is required for its accumulation and activity in endosomes. Immunity 2013, 39, 711–721. [Google Scholar] [CrossRef]
- Ishii, N.; Funami, K.; Tatematsu, M.; Seya, T.; Matsumoto, M. Endosomal localization of TLR8 confers distinctive proteolytic processing on human myeloid cells. J. Immunol. 2014, 193, 5118–5128. [Google Scholar] [CrossRef] [PubMed]
- Elshikha, A.S.; Lu, Y.; Chen, M.J.; Akbar, M.; Zeumer, L.; Ritter, A.; Elghamry, H.; Mahdi, M.A.; Morel, L.; Song, S. Alpha 1 Antitrypsin Inhibits Dendritic Cell Activation and Attenuates Nephritis in a Mouse Model of Lupus. PLoS ONE 2016, 11, e0156583. [Google Scholar] [CrossRef]
- Song, S. Alpha-1 Antitrypsin Therapy for Autoimmune Disorders. Chronic Obstr. Pulm. Dis. 2018, 5, 289–301. [Google Scholar] [CrossRef]
- Zhang, B.; Lu, Y.; Campbell-Thompson, M.; Spencer, T.; Wasserfall, C.; Atkinson, M.; Song, S. Alpha1-antitrypsin protects beta-cells from apoptosis. Diabetes 2007, 56, 1316–1323. [Google Scholar] [CrossRef]
- Akbar, M.A.; Nardo, D.; Chen, M.J.; Elshikha, A.S.; Ahamed, R.; Elsayed, E.M.; Bigot, C.; Holliday, L.S.; Song, S. Alpha-1 antitrypsin inhibits RANKL-induced osteoclast formation and functions. Mol. Med. 2017, 23, 57–69. [Google Scholar] [CrossRef]
- Bergin, D.A.; Reeves, E.P.; Hurley, K.; Wolfe, R.; Jameel, R.; Fitzgerald, S.; McElvaney, N.G. The circulating proteinase inhibitor alpha-1 antitrypsin regulates neutrophil degranulation and autoimmunity. Sci. Transl. Med. 2014, 6, 217ra211. [Google Scholar] [CrossRef]
- Bergin, D.A.; Reeves, E.P.; Meleady, P.; Henry, M.; McElvaney, O.J.; Carroll, T.P.; Condron, C.; Chotirmall, S.H.; Clynes, M.; O’Neill, S.J.; et al. alpha-1 Antitrypsin regulates human neutrophil chemotaxis induced by soluble immune complexes and IL-8. J. Clin. Investig. 2010, 120, 4236–4250. [Google Scholar] [CrossRef]
- O’Dwyer, C.A.; O’Brien, M.E.; Wormald, M.R.; White, M.M.; Banville, N.; Hurley, K.; McCarthy, C.; McElvaney, N.G.; Reeves, E.P. The BLT1 Inhibitory Function of α-1 Antitrypsin Augmentation Therapy Disrupts Leukotriene B4 Neutrophil Signaling. J. Immunol. 2015, 195, 3628–3641. [Google Scholar] [CrossRef]
- Song, S.; Goudy, K.; Campbell-Thompson, M.; Wasserfall, C.; Scott-Jorgensen, M.; Wang, J.; Tang, Q.; Crawford, J.M.; Ellis, T.M.; Atkinson, M.A.; et al. Recombinant adeno-associated virus-mediated alpha-1 antitrypsin gene therapy prevents type I diabetes in NOD mice. Gene Ther. 2004, 11, 181–186. [Google Scholar] [CrossRef]
- Lu, Y.; Tang, M.; Wasserfall, C.; Kou, Z.; Campbell-Thompson, M.; Gardemann, T.; Crawford, J.; Atkinson, M.; Song, S. Alpha1-antitrypsin gene therapy modulates cellular immunity and efficiently prevents type 1 diabetes in nonobese diabetic mice. Hum. Gene Ther. 2006, 17, 625–634. [Google Scholar] [CrossRef]
- Ma, H.; Lu, Y.; Li, H.; Campbell-Thompson, M.; Parker, M.; Wasserfall, C.; Haller, M.; Brantly, M.; Schatz, D.; Atkinson, M.; et al. Intradermal alpha1-antitrypsin therapy avoids fatal anaphylaxis, prevents type 1 diabetes and reverses hyperglycaemia in the NOD mouse model of the disease. Diabetologia 2010, 53, 2198–2204. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Lu, Y.; Lowe, K.; van der Meijden-Erkelens, L.; Wasserfall, C.; Atkinson, M.A.; Song, S. Regulated hAAT Expression from a Novel rAAV Vector and Its Application in the Prevention of Type 1 Diabetes. J. Clin. Med. 2019, 8, 1321. [Google Scholar] [CrossRef] [PubMed]
- Grimstein, C.; Choi, Y.K.; Satoh, M.; Lu, Y.; Wang, X.; Campbell-Thompson, M.; Song, S. Combination of alpha-1 antitrypsin and doxycycline suppresses collagen-induced arthritis. J. Gene Med. 2010, 12, 35–44. [Google Scholar] [CrossRef] [PubMed]
- Grimstein, C.; Choi, Y.K.; Wasserfall, C.H.; Satoh, M.; Atkinson, M.A.; Brantly, M.L.; Campbell-Thompson, M.; Song, S. Alpha-1 antitrypsin protein and gene therapies decrease autoimmunity and delay arthritis development in mouse model. J. Transl. Med. 2011, 9, 21. [Google Scholar] [CrossRef]
- Elshikha, A.S.; Yuan, Y.; Lu, Y.; Chen, M.J.; Abboud, G.; Akbar, M.A.; Plate, H.; Wolney, H.; Hoffmann, T.; Tagari, E.; et al. Alpha 1 Antitrypsin Gene Therapy Extends the Lifespan of Lupus-Prone Mice. Mol. Ther. Methods Clin. Dev. 2018, 11, 131–142. [Google Scholar] [CrossRef]
- Elshikha, A.S.; Abboud, G.; van der Meijden-Erkelens, L.; Lu, Y.; Chen, M.J.; Yuan, Y.; Ponjee, G.; Zeumer, L.; Satoh, M.; Morel, L.; et al. Alpha-1-Antitrypsin Ameliorates Pristane Induced Diffuse Alveolar Hemorrhage in Mice. J. Clin. Med. 2019, 8, 1341. [Google Scholar] [CrossRef]
- Cao, J.J.; Gregoire, B.R.; Sun, L.; Song, S. Alpha-1 antitrypsin reduces ovariectomy-induced bone loss in mice. Ann. N. Y. Acad. Sci. 2011, 1240, E31–E35. [Google Scholar] [CrossRef]
- Akbar, M.A.; Cao, J.J.; Lu, Y.; Nardo, D.; Chen, M.J.; Elshikha, A.S.; Ahamed, R.; Brantly, M.; Holliday, L.S.; Song, S. Alpha-1 Antitrypsin Gene Therapy Ameliorates Bone Loss in Ovariectomy-Induced Osteoporosis Mouse Model. Hum. Gene Ther. 2016, 27, 679–686. [Google Scholar] [CrossRef]
- Akbar, M.A.; Lu, Y.; Elshikha, A.S.; Chen, M.J.; Yuan, Y.; Whitley, E.M.; Holliday, L.S.; Chang, L.J.; Song, S. Transplantation of Adipose Tissue-Derived Mesenchymal Stem Cell (ATMSC) Expressing Alpha-1 Antitrypsin Reduces Bone Loss in Ovariectomized Osteoporosis Mice. Hum. Gene Ther. 2017, 28, 179–189. [Google Scholar] [CrossRef]
- Moldthan, H.L.; Hirko, A.C.; Thinschmidt, J.S.; Grant, M.B.; Li, Z.; Peris, J.; Lu, Y.; Elshikha, A.S.; King, M.A.; Hughes, J.A.; et al. Alpha 1-Antitrypsin Therapy Mitigated Ischemic Stroke Damage in Rats. J. Stroke Cerebrovasc. Dis. 2014, 23, e355–e363. [Google Scholar] [CrossRef]
- Magenau, J.M.; Goldstein, S.C.; Peltier, D.; Soiffer, R.J.; Braun, T.; Pawarode, A.; Riwes, M.M.; Kennel, M.; Antin, J.H.; Cutler, C.S.; et al. α1-Antitrypsin infusion for treatment of steroid-resistant acute graft-versus-host disease. Blood 2018, 131, 1372–1379. [Google Scholar] [CrossRef] [PubMed]
- Wettstein, L.; Weil, T.; Conzelmann, C.; Müller, J.A.; Groß, R.; Hirschenberger, M.; Seidel, A.; Klute, S.; Zech, F.; Prelli Bozzo, C.; et al. Alpha-1 antitrypsin inhibits TMPRSS2 protease activity and SARS-CoV-2 infection. Nat. Commun. 2021, 12, 1726. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Schountz, T.; Buckle, A.M.; Talbert, J.L.; Sandhaus, R.A.; Chan, E.D. Alpha-1-antitrypsin antagonizes COVID-19: A review of the epidemiology, molecular mechanisms, and clinical evidence. Biochem. Soc. Trans. 2023, 51, 1361–1375. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; DiCiaccio, B.; Li, Y.; Elshikha, A.S.; Titov, D.; Brenner, B.; Seifer, L.; Pan, H.; Karic, N.; Akbar, M.A.; et al. Anti-inflammaging effects of human alpha-1 antitrypsin. Aging Cell 2018, 17, e12694. [Google Scholar] [CrossRef]
- Yuan, Y.; Van Belkum, M.; O’Brien, A.; Garcia, A.; Troncoso, K.; Elshikha, A.S.; Zhou, L.; Song, S. Human Alpha 1 Antitrypsin Suppresses NF-κB Activity and Extends Lifespan in Adult. Biomolecules 2022, 12, 1347. [Google Scholar] [CrossRef]
- Wang, J.; Sun, Z.; Gou, W.; Adams, D.B.; Cui, W.; Morgan, K.A.; Strange, C.; Wang, H. alpha-1 Antitrypsin Enhances Islet Engraftment by Suppression of Instant Blood-Mediated Inflammatory Reaction. Diabetes 2017, 66, 970–980. [Google Scholar] [CrossRef]
- Lockett, A.D.; Kimani, S.; Ddungu, G.; Wrenger, S.; Tuder, R.M.; Janciauskiene, S.M.; Petrache, I. α1-Antitrypsin modulates lung endothelial cell inflammatory responses to TNF-α. Am. J. Respir. Cell Mol. Biol. 2013, 49, 143–150. [Google Scholar] [CrossRef]
- Han, Y.P.; Yan, C.; Garner, W.L. Proteolytic activation of matrix metalloproteinase-9 in skin wound healing is inhibited by alpha-1-antichymotrypsin. J. Investig. Dermatol. 2008, 128, 2334–2342. [Google Scholar] [CrossRef]
- Wei, X.; Niu, X. T follicular helper cells in autoimmune diseases. J. Autoimmun. 2023, 134, 102976. [Google Scholar] [CrossRef]
- Young, C.; Brink, R. The unique biology of germinal center B cells. Immunity 2021, 54, 1652–1664. [Google Scholar] [CrossRef]
- Hasham, M.G.; Baxan, N.; Stuckey, D.J.; Branca, J.; Perkins, B.; Dent, O.; Duffy, T.; Hameed, T.S.; Stella, S.E.; Bellahcene, M.; et al. Systemic autoimmunity induced by the TLR7/8 agonist Resiquimod causes myocarditis and dilated cardiomyopathy in a new mouse model of autoimmune heart disease. Dis. Model. Mech. 2017, 10, 259–270. [Google Scholar] [CrossRef] [PubMed]
- Yokogawa, M.; Takaishi, M.; Nakajima, K.; Kamijima, R.; Fujimoto, C.; Kataoka, S.; Terada, Y.; Sano, S. Epicutaneous application of toll-like receptor 7 agonists leads to systemic autoimmunity in wild-type mice: A new model of systemic Lupus erythematosus. Arthritis Rheumatol. 2014, 66, 694–706. [Google Scholar] [CrossRef] [PubMed]
- Duan, T.; Du, Y.; Xing, C.; Wang, H.Y.; Wang, R.F. Toll-Like Receptor Signaling and Its Role in Cell-Mediated Immunity. Front. Immunol. 2022, 13, 812774. [Google Scholar] [CrossRef] [PubMed]
- Fillatreau, S.; Manfroi, B.; Dörner, T. Toll-like receptor signalling in B cells during systemic lupus erythematosus. Nat. Rev. Rheumatol. 2021, 17, 98–108. [Google Scholar] [CrossRef]
- Li, Q.; Yan, Y.; Liu, J.; Huang, X.; Zhang, X.; Kirschning, C.; Xu, H.C.; Lang, P.A.; Dittmer, U.; Zhang, E.; et al. Toll-Like Receptor 7 Activation Enhances CD8+ T Cell Effector Functions by Promoting Cellular Glycolysis. Front. Immunol. 2019, 10, 2191. [Google Scholar] [CrossRef]
Forward | Reverse | |
---|---|---|
Ppia | CACAGCCAAGGGTCGATTCC | CCCAGGTATCGTGCTTTGTCT |
IL-12p40 | AGCAGTAGCAGTTCCCCTGA | AGTCCCTTTGGTCCAGTGTG |
IRF-7 | CAGCGAGTGCTGTTTGGAGAC | AAGTTCGTACACCTTATGCGG |
MX-I | GATCCGACTTCACTTCCAGATGG | CATCTCAGTGGTAGTCAACCC |
ISG-15 | GAGCTAGAGCCTGCAGCAAT | TAAGACCGTCCTGGAGCACT |
TNF-a | CCACCACGCTCTTCTGTCTAC | AGGGTCTGGGCCATAGAACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elshikha, A.S.; Abboud, G.; Avdiaj, R.; Morel, L.; Song, S. The Inhibitory Effects of Alpha 1 Antitrypsin on Endosomal TLR Signaling Pathways. Biomolecules 2025, 15, 43. https://doi.org/10.3390/biom15010043
Elshikha AS, Abboud G, Avdiaj R, Morel L, Song S. The Inhibitory Effects of Alpha 1 Antitrypsin on Endosomal TLR Signaling Pathways. Biomolecules. 2025; 15(1):43. https://doi.org/10.3390/biom15010043
Chicago/Turabian StyleElshikha, Ahmed S., Georges Abboud, Rigena Avdiaj, Laurence Morel, and Sihong Song. 2025. "The Inhibitory Effects of Alpha 1 Antitrypsin on Endosomal TLR Signaling Pathways" Biomolecules 15, no. 1: 43. https://doi.org/10.3390/biom15010043
APA StyleElshikha, A. S., Abboud, G., Avdiaj, R., Morel, L., & Song, S. (2025). The Inhibitory Effects of Alpha 1 Antitrypsin on Endosomal TLR Signaling Pathways. Biomolecules, 15(1), 43. https://doi.org/10.3390/biom15010043