Next Article in Journal
Haplotypes of ATP-Binding Cassette CaABCC6 in Chickpea from Kazakhstan Are Associated with Salinity Tolerance and Leaf Necrosis via Oxidative Stress
Previous Article in Journal
Chemogenetic Excitation of Ventromedial Hypothalamic Steroidogenic Factor 1 (SF1) Neurons Increases Muscle Thermogenesis in Mice
Previous Article in Special Issue
Rapid and Highly Efficient Genetic Transformation and Application of Interleukin-17B Expressed in Duckweed as Mucosal Vaccine Adjuvant
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein

1
School of Life Sciences, Ludong University, Yantai 264025, China
2
School of Resources and Environmental Engineering, Ludong University, Yantai 264025, China
*
Author to whom correspondence should be addressed.
Biomolecules 2024, 14(7), 822; https://doi.org/10.3390/biom14070822
Submission received: 5 June 2024 / Revised: 4 July 2024 / Accepted: 4 July 2024 / Published: 9 July 2024
(This article belongs to the Collection Feature Papers in Synthetic Biology and Bioengineering)

Abstract

:
The diatom Phaeodactylum tricornutum, known for its high triacylglycerol (TAG) content and significant levels of n-3 long chain polyunsaturated fatty acids (LC-PUFAs), such as eicosapentaenoic acid (EPA), has a limited ability to utilize exogenous organic matter. This study investigates the enhancement of acetate utilization in P. tricornutum by introducing an exogenous acetate transport protein. The acetate transporter gene ADY2 from Saccharomyces cerevisiae endowed the organism with the capability to assimilate acetate and accelerating its growth. The transformants exhibited superior growth rates at an optimal NaAc concentration of 0.01 M, with a 1.7- to 2.0-fold increase compared to the wild-type. The analysis of pigments and photosynthetic activities demonstrated a decline in photosynthetic efficiency and maximum electron transport rate. This decline is speculated to result from the over-reduction of the electron transport components between photosystems due to acetate utilization. Furthermore, the study assessed the impact of acetate on the crude lipid content and fatty acid composition, revealing an increase in the crude lipid content and alterations in fatty acid profiles, particularly an increase in C16:1n-7 at the expense of EPA and a decrease in the unsaturation index. The findings provide insights into guiding the biomass and biologically active products production of P. tricornutum through metabolic engineering.

1. Introduction

Oleaginous microalgae have become a focal point for the development of sustainable biofuel and bioproducts. Particularly, polyunsaturated fatty acids (PUFAs) are of high interest due to their recognized health advantages for human consumption [1]. As a model diatom species, Phaeodactylum tricornutum contains high content of triacylglycerols (TAGs) and significant amounts of the n-3 long chain PUFA-like eicosapentaenoic acid (EPA) [2,3]. This organism is capable of photoautotrophic growth, utilizing carbon dioxide (CO2) as its carbon source, which is predominantly accumulated as lipid, constituting up to 57.8% of dry cell weight [4]. Furthermore, mixotrophic or heterotrophic growth has also been widely reported with glycerol, glucose, and acetate as the main carbon sources [5,6,7]. However, the actual utilization capacity of organic carbon sources by P. tricornutum varies significantly due to differences in algal strains and experimental conditions.
In the past, P. tricornutum had been regarded as a strictly autotrophic organism, with a limited ability to utilize exogenous organic matter [7,8]. However, a variety of organic substances, including saccharides, alcohols, carboxylic acids, amino acids, and phenolic compounds, have been found to be utilizable by P. tricornutum [9]. P. tricornutum can utilize glycerol, acetate, and glucose at concentrations up to 100 mM, achieving growth rates 1.60, 1.28, and 1.21 times higher than autotrophic conditions, respectively [5]. Nonetheless, this is less than the heterotrophic growth of species like Chlorella, which can surpass autotrophic growth by more than twofold and even by an order of magnitude [10]. Similar to the heterotrophic growth of green algae, the heterotrophic growth of P. tricornutum also has a significant impact on its photosynthesis and biochemical composition. Heterotrophic growth leads to a reduction in the content of photosynthetic pigments, and a decrease in the efficiency of photosynthesis [5,11]. Lipid content is usually increased and the composition of fatty acids is altered, with an increase in the levels of saturated and monounsaturated fatty acids and a decrease in the levels of PUFAs [12].
Glucose and acetate have been widely reported as two main carbon sources that microalgae can utilize. Microalgae that can process organic materials are sorted into two groups: those that mainly use acetate, and those that mostly use sugars [13]. P. tricornutum is capable of mixotrophic growth utilizing acetate and glucose as carbon sources, although its growth rate is markedly lower than when utilizing glycerol as a carbon source. Glycerol can freely diffuse into the cells, whereas acetate and glucose typically require active transport mechanisms to enter the cells. It is likely that P. tricornutum lacks the necessary transporters to facilitate the uptake of acetate and glucose. This hypothesis is substantiated by the observation that the introduction of glucose transporter protein into P. tricornutum has enabled the organism to utilize glucose, resulting in a growth rate that significantly surpasses that of the wild-type strain [14,15]. Additionally, this has also led to an increase in lipid content and alterations in the composition of fatty acids, as well as changes in the pathways of glucose metabolism. However, there have been no reports concerning acetate transporter in P. tricornutum to date. Acetate presents significant potential as a carbon source for mixotrophic cultivation. It has several benefits over glucose, including being more economical and readily accessible. Acetate can be produced from C1 gases such as CH4, CO, and CO2 [16]. Moreover, acetate’s antibacterial properties reduce the likelihood of contamination [17]. It also promotes the synthesis of biomass and lipids by intensifying the carbon flow through the tricarboxylic acid cycle by providing the acetyl coenzyme A as substrate [18].
This study aims to investigate whether the assimilation of acetate by P. tricornutum requires the presence of an acetate transporter protein and to explore whether the introduction of such a protein would alter its photosynthetic activity and lipid metabolism. The findings of this research could provide guidance for the biomass production of P. tricornutum and its application in the production of biologically active products such as PUFAs.

2. Materials and Methods

2.1. Microorganisms and Culture Media

P. tricornutum CCAP 1055/1 was acquired from the Culture Collection of Algae and Protozoa (CCAP). The cultivation was carried out in artificial seawater prepared with silicon-free f/2 medium [19]. When carrying out the mixotrophic growth, sodium acetate (NaAc) was added to f/2 medium.
Saccharomyces cerevisiae was cultivated in the yeast extracts-peptone-dextrose (YPD) medium at 28 °C with shaking at 150 rpm. It was used to obtain acetate transporter gene ADY2 (Gene ID: 850368) [20].

2.2. ADY2 Modification of P. tricornutum

The acetate transporter gene ADY2 was obtained through PCR amplification of S. cerevisiae genome with primers listed in Table 1. ADY2 was ligated to the downstream of fcpA promotor in the plasmid pPha-T1 [21] (Figure S1) by T4 DNA ligase after digestion with Bam HI and Sph I (Sangon Biotech. Co., Ltd., Shanghai, China). The ligation product was transformed into Escherichia coli TOP10 cells (Sangon Biotech. Co., Ltd.) and incubated at 37 °C overnight. After incubation, it was spread onto an LB solid medium and cultured for 12 h. Positive clones were screened using colony PCR technology and sent to Sangon Biotech. Co., Ltd. for sequencing.
Positive clone strains were expanded using LB culture and the plasmids were extracted. The recombinant plasmids were then bombarded into P. tricornutum as described by Krämer et al. [22]. The cells were cultured at 21 °C with a light intensity of 60 μmol m−2 s−1 for 24 h and then washed with an equal volume of PBS and transferred into a 1.5 mL sterile centrifuge tube. Subsequently, they were spread onto a solid f/2 medium containing 1 mg mL−1 bleomycin (Invitrogen) and cultured at 21 °C, a light intensity of 60 μmol m−2 s−1, and a light:dark cycle of 12 h:12 h. After 15 days of cultivation, single colonies appeared. The single colonies were picked and expanded in a 12 mL culture tube containing 10 mL f/2 medium with 0.7 mg mL−1 bleomycin. Three transformants (ADY2-4, ADY2-9, and ADY2-12) and the wild-type P. tricornutum were inoculated into fresh medium for the subsequent growth evaluation.

2.3. Culture and Growth

To screen for the transformant that grows rapidly under the condition of NaAc supplementation and to determine the optimal concentration of NaAc for growth, three transformants and the wild-type strain were each cultured in f/2 medium containing NaAc at concentrations of 0, 0.005, 0.01, 0.05, and 0.1 M for 7 days to compare the specific growth rates. The growth curves under NaAc concentrations of 0 M and 0.01 M were plotted to assess the growth differences between the transgenic and wild-type strains. After selecting the rapid growth strain, a comparative analysis was conducted on the dry weight content of the mutant strain and the wild-type strain after 7 days of growth under 0 M and 0.01 M NaAc conditions. Additionally, the specific growth rates of the mutant and wild-type strains were compared and analyzed after 7 days of growth under conditions of 0.01 M and 0.05 M sodium propionate and sodium butyrate. The inoculation and cultivation procedures were carried out according to the following steps.
Algal cultures in the logarithmic growth phase were collected via centrifugation at 4000× g for 10 min and rinsed twice with artificial seawater. The resulting pellets were subsequently suspended in 500 mL of medium to create the inoculum. Cells were cultivated at a temperature of 21 °C under cool white fluorescent lamps (100 μmol m−2 s−1) with a light:dark cycle of 12 h for 7 days, and the cultivation was conducted with shaking at a speed of 150 rpm. Each bottle of algal culture was inoculated with an initial density of 106 cells mL−1. Daily sampling for analysis was conducted 1 h after the end of the light cycle. Cell density measurements were performed using a cell counter (Ruiyu, Shanghai, China), and the specific growth rate (μ) was calculated using the following formula.
μ = (lnXtlnX0) (txt0)−1
where Xt and X0 represent the cell density at culture time tx and t0, respectively.
After measuring the cell density on the 7th day, the algal cells were collected by centrifugation at 4000× g for 10 min and washed twice with PBS solution before proceeding with the subsequent experiments.

2.4. Dry Weight

An accurate volume of the culture was filtered onto a pre-dried and pre-weighed glass fiber filter (with a pore size of 0.22 μm) using a vacuum pump. Then, the filter was washed with a 0.5 M ammonium formate solution to remove salts. The same volume of filtered seawater was filtered as a control following the same procedure. Both filters were dried at 100 °C for 4 h to allow the ammonium formate to evaporate and then weighed on an analytical balance, respectively. We calculated the dry weight per liter culture according to Formula (2):
DW (g·L−1) = (DWA − DWC)·V−1
where DWA is the average dry weight retained on algal filter (g), DWC is the average dry weight retained on control filter (g), and V is the volume of algal culture filtered on the filter (L).

2.5. Photosynthetic Pigments

Five milliliters of the algal culture cultivated up to the 7th day were filtered through a GF/F membrane (Whatman, Maidstone, UK). The membrane was then placed into a centrifuge tube in an ice bath. Thereafter, 5 mL of 90% acetone were immediately added to the centrifuge tube, which was subsequently wrapped in aluminum foil to avoid light. The tube was shaken and allowed to stand in a 4 °C refrigerator for 24 h, with intermittent shaking at intervals of every 3 to 4 h. Following this, the mixture was centrifuged at 10,000× g for 10 min at 4 °C. The resulting supernatant was carefully transferred to a fresh centrifuge tube.
The absorbance of the supernatant was then measured using a spectrophotometer at specific wavelengths, namely 750 nm, 663 nm, 645 nm, 630 nm, and 470 nm. The absorbance values obtained at each of these wavelengths were corrected by subtracting the absorbance measured at 750 nm. These corrected absorbance values were subsequently divided by the cuvette path length, which was 1 cm, to yield the respective values of D663, D645, D630, and D470. Finally, the concentrations of chlorophyll a (Chl-a) and c (Chl-c) and carotenoids present in the extract were calculated using the following formula [23]:
Chl-a (μg mL−1) = 11.64 × D663 − 2.16 × D645 + 0.10 × D630,
Chl-c (μg mL−1) = −5.53 × D663 − 14.81 × D645 + 54.22 × D630,
Carotenoid (μg mL−1) = (1000 × D470 − 3.27 × Chl-a)/229
We calculated the content of each pigment inside the cells according to the following formula, with units expressed in micrograms per 107 cells.
Pigment (μg 10−7 cells) = (C(pigment) × VAcetone)/(Dcell × Vsample) × 107
where C(pigment) represents the concentration of each photosynthetic pigment in the extract, VAcetone is the volume of acetone (mL), Dcell is the cell density (cells mL−1), and Vsample is the volume of the algal sample (mL).

2.6. Photosynthetic Activity

On the 7th day, the photosynthetic activity of 2 mL cultures from each group was measured using a fluorimeter (AquaPen AP 100, Photon Systems Instruments, Drasov, Czech Republic). Each sample was dark-adapted for 15 min, and then the maximal photochemical efficiency of photosystem II (Fv⁄Fm), the effective photochemical efficiency of PSII in the light [QY = yield = Fv′/Fm′ = (Fm′ − Fo′)/Fm′], the OJIP test, and the light response curve protocol (LC3) were carried out following the instructions of the manufacturers.

2.7. Microscopic Observation

The wild-type and mutant cells in the late-exponential growth phase were stained with fluorescent neutral lipid stain Nile Red to detect the lipid droplets [24,25]. A solution of Nile Red (0.1 mg mL−1 in acetone) was combined with 20 μL of DMSO and 80 μL of cell culture. The resulting mixture was then stained for 30 min at room temperature in a dark environment, followed by observation using an Axio Observer fluorescence microscope (Carl Zeiss, Gottingen, Germany) equipped with a Colibri 7-illumination module. Fluorescence was excited with a blue light at 475 nm.

2.8. Crude Lipid Content

The crude lipid content was determined according to a modified procedure of Folch et al. [26]. Typically, 50–100 μL (approximately 20 mg) of freeze-dried cells was weighed into a centrifuge tube. Then, 1 mL of methanol and 2 mL of chloroform were added. The mixture was vigorously vortexed for 2 min on a vortex mixer, followed by centrifugation for 5 min at 5000× g and 4 °C. The supernatant was transferred to a new tube, and 1/5 volume (about 600 μL) of NaCl solution (0.9% w/w) was added. After vigorous vortexing for 2 min, the mixture was allowed to stand for 5 min until the layers separated. The upper layer was removed, and the lower layer containing the crude lipid extract was retained. After evaporating the solvent under a stream of nitrogen, the residue was dried at 85 °C for 15 min until reaching a stable weight. Then, it was placed in a desiccator or immediately weighed using a precision balance. The crude lipid content was calculated by the difference between the total mass of the centrifuge tube after the test and the mass of the empty centrifuge tube before the test.

2.9. Fatty Acid Composition

The fatty acid composition was analyzed according to our prior publication [27]. Typically, an appropriate amount of wet cell pellet (c.a. 100 mg) was accurately weighed into a screw-capped test tube (12 cm × 1.5 cm). Half a milliliter of toluene containing internal standard (0.1 mg glyceryl triheptadecanoate) and 1 mL of 0.5 M NaOH methanol solution were slowly added and vortex-mixed at 80 °C with constant stirring at 300 rpm for 20 min. The mixture was cooled to room temperature for 5 min, followed by the addition of 1 mL of 10:100 (v/v) acetyl chloride in anhydrous methanol, repeating the above incubation procedure. After cooling for 5 min to room temperature, 1 mL of 6% K2CO3 and 400 μL of n-hexane were added and vortex-mixed, and the supernatant was extracted by centrifugation at 4000× g for 1 min, followed by collection of the upper layer. The resulting fatty acid methyl esters were then subjected to analysis via gas chromatography (GC-1949; Panna, Changzhou, China) equipped with a fused silica capillary column (Supelco SP-2560: 100 m × 0.25 mm, film thickness 0.20 μm; Bellefonte, PA, USA). The heater was maintained at 260 °C with nitrogen as the carrier gas. The column temperature was ramped from 140 to 260 °C at a rate of 10 °C per minute. Fatty acids were identified by correlating the relative retention times with those of the reference standards (Merck, Rahway, NJ, USA). The unsaturation index (UI) of fatty acids was calculated using the following formula [28]:
UI = 1 × (% monoenoic) + 2 × (% dienoic) + 3 × (% trienoic) + 4 × (% tetraenoic) +
5 × (% pentaenoic) + 6 × (% hexaenoic)

2.10. Chemical Oxygen Demand (COD)

To assess the consumption rate of NaAc during growth, the chemical oxygen demand (COD) was measured before and after cultivation to represent the rate of NaAc consumption. Cultivated until the 7th day, 100 mL of algal culture was taken and centrifuged at 4000× g for 10 min. The supernatant and the initial media without inoculation were used for COD measurement. According to the national standard of China GB17378.4-2007 [29], COD was determined using the alkaline potassium permanganate method.

2.11. Statistical Analysis

Experimental results were expressed as the mean ± standard deviation (SD) of the three replicates. The Kolmogorov–Smirnov test and Levene’s F-test were used to check normality and heterogeneity of variances. Data with parametric distribution were subjected to one-way analysis of variance (more than two groups) or t-test (two groups). Duncan multiple-range test [30] or Least-Significant-Difference test [31] was performed to identify significant differences between any two means that differed at p < 0.05. All statistical analyses were performed using IBM SPSS statistics version 20.0 (IBM, Armonk, NY, USA).

3. Results and Discussion

3.1. Evaluation of Growth and NaAc Assimilation

The ADY2 from S. cerevisiae was successfully inserted into the plasmid pPha-T1 and introduced into P. tricornutum (Figure S2). Three transformants (ADY2-4, ADY2-9, and ADY2-12) were obtained. By comparing the specific growth rates of the wild-type (WT) and transgenic strains at different NaAc concentrations for 7 days, we observed the optimal growth conditions for all strains at the NaAc concentration of 0.01 M (Figure 1). In low concentrations of NaAc (0–0.005 M), the growth of ADY2-4 and ADY2-9 was significantly superior to that of WT (p < 0.05), whereas there was no significant difference in growth between ADY2-12 and WT (p > 0.05). In contrast, at high concentrations of NaAc (0.01 M–0.1 M), the growth of all three mutant strains was significantly better than that of WT (p < 0.05), demonstrating that ADY2 was transferred into the P. tricornutum cell and conferred it the ability of acetate assimilation to accelerate growth. The growth rate of the transformants was increased by 1.7–2.0 fold in comparison with WT at the NaAc concentration of 0.1 M. However, the maximum growth rate of all three mutant strains appeared at the NaAc concentration of 0.01 M. Wang et al. (2012) tested the capability of P. tricornutum to utilize NaAc within the concentration range of 0.5 g L−1 to 5 g L−1, and it was found that the algal cells exhibited optimal growth at a NaAc concentration of 0.5 g L−1 (0.006 M) [12]. Haro et al. [30] also reported that a NaAc concentration of 0.01 M promoted the best growth [32]. The results of these reports were consistent with the WT in this study; however, the mutant strains of ADY2-4 and ADY2-9 still grew well without affecting the growth rate at a NaAc concentration of 0.1 M. Actually, we found that the ADY2-4 strain ceased to grow under conditions of up to 1 M NaAc (Figure S3). To the best of our knowledge, there are currently no reports on the expression of acetate transport protein in P. tricornutum. The present study demonstrates that the expression of acetate transport protein in P. tricornutum can enhance the growth of the algae as effectively as the expression of glucose transport proteins [33,34].
Subsequently, we selected 0.01 M as the testing concentration of NaAc to investigate the growth process. As shown in Figure 2, all strains completed the logarithmic phase within 7 days, regardless of the conditions with or without the addition of NaAc. This trend is consistent with recent reports regarding the algal strain [35,36,37]. There was a noticeable increase in cell density during the period from the 2nd to the 6th day. Starting from the 3rd day, the cell densities of ADY2-4 and ADY2-9 were significantly higher than the other groups (F(7, 16)= 15.80, p < 0.05). By the 7th day of cultivation, this effect became even more pronounced, with the cell densities of ADY2-4 and ADY2-9 reaching 16.28 and 16.24 × 106 cells mL−1, respectively. After comparison, we proceeded with the subsequent experiments using the ADY2-4 strain.
Without NaAc treatment, there was no significant difference in the dry weight between the wild-type and mutant strain (p > 0.05, Figure 3a). However, after NaAc treatment, the dry weight of the mutant strain ADY2-4 increased significantly (p < 0.05, Figure 3a). Compared to the control treatment WT-0M and WT-0.01M, the dry weight of ADY2-4-0.01M increased by 66.97% and 39.20%, respectively, indicating that the modification of acetate transport proteins has the potential to enhance the biomass of P. tricornutum.
To explore whether the mutant strain can grow normally in sodium propionate and sodium butyrate, we added 0.01 M and 0.05 M sodium propionate and sodium butyrate separately to f/2 medium and measured the specific growth rate of the wild-type and mutant strain. As shown in Figure 3b, under low concentrations of sodium propionate (0.01 M) and sodium butyrate (0.01 M) treatment, there was no significant difference in specific growth rate between the wild-type and mutant strain (p < 0.05). Under high concentrations of sodium propionate (0.05 M) and sodium butyrate (0.05 M) treatment, the growth of both strains was inhibited, while the growth of the wild-type was nearly halved in comparison to the mutant type. The results indicate that the ADY2-4 strain not only has the ability to utilize NaAc but also has the capability to assimilate sodium propionate and sodium butyrate. This suggests that the acetate transport protein exhibits a generality in the transport of small fatty acid molecules [38].
The NaAc assimilation capacity of algal cells can be reflected by the changes in COD values. As shown in Table 2, by the 7th day of cultivation, the utilization rate of NaAc by the wild-type was 86.23 ± 0.25%, while that of the mutant strain was 90.30 ± 0.27%, significantly higher than the wild-type (p < 0.05). It is not easy to determine the concentration of NaAc in seawater. Changes in the concentration of COD can effectively represent the variations of acetate concentration. Observing the COD removal rate, both the wild type and mutant strain are capable of utilizing NaAc in the culture medium. The mutant strain continues to absorb NaAc even at low concentrations, suggesting that the acetate transport protein may carry out the active transport at low acetate concentrations.

3.2. Photosynthesis Evaluation

3.2.1. Photosynthetic Pigments

There was a significant difference in the pigment content between the wild-type and mutant strains (Figure 4). The content of each pigment in the ADY2-4 was higher than that in the wild type when culturing in the NaAc-free medium, with Chl-a increasing by 33.32%, Chl-c by 14.41%, and carotenoids by 31.45%. However, after NaAc treatment, the content of each pigment in the WT-0.01M and ADY2-4-0.01M was significantly lower than that in the NaAc-free groups (p < 0.05). It is noteworthy that the content of each pigment in the ADY2-4-0.01M was significantly lower than that in the WT-0.01M (p < 0.05), with Chl-a reducing by 35.46%, Chl-c by 30.73%, and carotenoids by 35.03%. Consistent results of pigments’ decline when treated with acetate in P. tricornutum were reported by Liu et al. [5]. Similar results were also obtained in other microalgae when cultivated with acetate or glucose [39,40,41]. It appears that the mutant strain had absorbed a greater amount of NaAc (Table 2), leading to a lower pigment content compared to the wild type (Figure 4). This observation may be attributed to acetate inhibiting the expression of pigment-related proteins [42]. Interestingly, the mutant demonstrated a higher pigment content in the absence of NaAc compared to the wild type. Further investigation is required to elucidate the mechanism underlying this phenomenon.

3.2.2. Photosynthetic Activities

On the 7th day of treatment, there was no significant difference in Fv/Fm between the wild-type and ADY2-4 in the NaAc blank groups. However, after treatment with NaAc, the Fv/Fm of ADY2-4 decreased significantly compared to the blank groups (p < 0.05, Figure 5a). Regarding QY, in the blank groups, the mutant strain ADY2-4 had a slightly higher QY value than the wild-type. After treatment with NaAc, the QY values decreased in both strains, but there was no significant difference between the wild-type and mutant strain ADY2-4 (Figure 5b). Liu et al. reported that photosynthesis activities including Fv/Fm, CO2 fixation, carbohydrase activity, and net O2 release were inhibited by acetate in P. tricornutum [5]. Our previous report also found the apparent decline of Fv/Fm and QY in Chlorella sorokiniana when treated with acetate [43].
In order to study the effect of NaAc on PSII electron transfer reactions, we assessed the rapid chlorophyll fluorescence induction curves in the absence and presence of NaAc. Under both conditions, the chlorophyll fluorescence induction kinetics curves of the two algal strains exhibited distinct O, J, I, and P phases (Figure 5c). Under all treatment conditions, the trend of fluorescence value changes from point O to point J was consistent, indicating that the NaAc culture had no significant effect on the electron transfer from QA to QB of PSII. After the addition of NaAc, the fluorescence values of WT-0.01M and ADY2-4-0.01M increased rapidly from point J to point I, resulting in relatively variable fluorescence (VI) at point I being higher than the corresponding blank group, respectively. This suggests that the transfer of PSII electrons from QB to PQ pool was inhibited by NaAc culture. The light response curves of all treatments exhibited an initial increase followed by a gradual stabilization trend (Figure 5d). In the absence of NaAc, the mutant strain’s maximum electron transport rate (ETRmax) was significantly higher than that of the control group (F(2, 2) = infinity, p < 0.05). This trend aligns with the pattern of changes observed in photosynthetic pigments (Figure 4). However, after the addition of NaAc, the ETRmax of both the wild-type and mutant strains decreased with no significant difference (F(2, 2) = 1, p > 0.05), which is consistent with the trend in the variation of Fv/Fm and QY (Figure 5a,b). These findings also align well with the report of Liu et al. [5].
Upon entry into the cell via an acetate transport protein, exogenous acetate undergoes conversion by acetyl coenzyme A synthetase to form acetyl coenzyme A with ATP consumption [44]. Acetyl coenzyme A enters the glyoxylate cycle, and ultimately generates oxaloacetic acid to drive the TCA cycle within the mitochondria or produce carbohydrates through gluconeogenesis. Therefore, acetate addition generally accompanies a drop in the ATP content and a sharp increase in the NADPH content [45]. The elevated levels of NADPH led to excessive reduction of the inter-photosystem electron transport components, including the cytochrome b/f complex and the PQ pool [43,45]. This effect hinders the electron transfer from PS II to PS I, as evidenced by the inhibited transfer of PSII electrons from QB to PQ pool and the reduced ETRm in the present study (Figure 5c,d).
In NaAc culture, the mutant exhibited lower photosynthetic pigment content compared to the wild type, yet maintained the same photosynthetic efficiency (Figure 4 and Figure 5a–c). This may be associated with the rebalancing of photon conversion and photon utilization efficiency. Huang et al. [46] found that when the photosynthetic pigment content decreased, the cyanobacterium Microcystis flosaquae enhanced photosynthetic activity by stabilizing the actual photon conversion efficiency and photon utilization efficiency.

3.3. Lipid and Fatty Acids Analysis

Under NaAc culture conditions, both wild-type and mutant cells showed the presence of lipid droplets (golden fluorescence) in the late-exponential growth phase, while no apparent lipid droplets were observed under conditions without NaAc (Figure S4). This indicates that lipid accumulation occurred in subcellular structures of both wild-type and mutant strains under acetate assimilation conditions.
The crude lipid content after cultivation for seven days is shown in Figure 6a. In the absence of NaAc, the wild-type exhibited a crude lipid content of 0.26 g·g−1, while the mutant strain showed a crude lipid content of 0.34 g·g−1. When cultured with NaAc, there was a significant increase in the crude lipid content for both strains. Specifically, the wild-type strain exhibited an enhancement to 0.38 g·g−1, which corresponds to a 46.15% increase compared to WT-0M. Similarly, the mutant strain demonstrated an increase to 0.47 g·g−1, amounting to a 38.24% augmentation compared to ADY2-4-0M. This is consistent with the results of fluorescence observation, as mentioned above. The promoting effect of acetate on lipid accumulation has been widely reported in microalgae, such as P. tricornutum [12], Navicula saprophila [47], and C. vulgaris [41]. However, the study conducted by Haro et al. reported that acetate promoted growth but did not enhance lipid accumulation in a Chilean strain of P. tricornutum [32]. The deviation may be related to the intrinsic characteristics of the strain.
In the absence of NaAc, the total fatty acid content did not exhibit any significant variance (p > 0.05, Figure 6b). Nevertheless, upon the introduction of NaAc into the culture medium, a noteworthy discrepancy emerged between the two strains. Specifically, the total fatty acid content of the wild-type remained statistically unchanged (p > 0.05), whereas that of the mutant experienced a pronounced elevation. This increase was measured to be 42.35% relative to the levels observed in ADY2-4-0M.
The fatty acid compositions after 7 days of cultivation are illustrated in Table 3. The main components of fatty acids in each group include C14:0 (6.17–8.92%), C16:0 (11.97–23.64%), C16:1n-7 (16.00–33.82%), C18:1n-9 (6.58–9.41%), and EPA (12.59–27.19%). After treatment with NaAc, the percentage content of C16:0 and C16:1n-7 in both the wild-type and mutant strains significantly increased, while the percentage content of EPA decreased (p < 0.05). This trend is consistent with the findings reported by Haro et al. in P. tricornutum treated with acetate [32]. Compared to WT-0M, ADY2-4-0M increased the relative content of C16:0 and C16:1n-7 while decreasing the relative content of EPA. Compared to WT-0.01M, ADY2-4-0.01M increased the relative content of C16:1n-7 and slightly reduced the relative content of EPA, while maintaining the relative content of C16:0. The primary fatty acids synthesized in the chloroplast of P. tricornutum are C16:0 and C16:1n-7 [48], while EPA derived from C16:0 through C18:0 and C18:1n-9 are mainly synthesized in the endoplasmic reticulum [49,50]. Therefore, EPA and C16:1n-7 compete for the substrate C16:0, exhibiting a competitive relationship of trade-off [51]. The results of this study provide a good explanation of this mechanism. It is also indicated that the mutant enhanced the synthesis of C16:1n-7 by strengthening acetate transport and utilization, thereby strengthening the prokaryotic pathway within the chloroplast [52].
Without the addition of NaAc in the culture, the UI of fatty acids in the mutant strain was significantly lower than that of the wild-type (p < 0.05). However, under conditions of culturing with NaAc, there was no significant difference in the UI between the wild-type and the mutant strain, but it decreased by 35.51% and 34.22%, respectively, compared to when cultured without NaAc (p > 0.05). Previous reports have indicated a strong positive correlation between the polar/neutral lipids ratio and the UI in microalgae [53,54]. In this study, assimilation of acetate led to a decrease in the UI, which also implies a decrease in the percentage content of polar lipids. In general, polar lipids, which play a role in forming membrane structures, typically contain higher levels of PUFA compared to other lipids [55]. The reduction in PUFA (Table 3, EPA) in the polar lipids often predicts a potential decrease in membrane fluidity. Whether this decrease in fluidity benefits the conformational change of acetate transport protein to facilitate the transport of acetate thus remains to be investigated.

4. Conclusions

The introduction of the acetate transport protein ADY2 from S. cerevisiae into P. tri-cornutum successfully conferred the microalga with an enhanced capacity for acetate assimilation, leading to accelerated growth. The transformant ADY2-4 demonstrated significantly higher growth rates and increased dry weight under 0.01 M NaAc conditions compared to the wild-type. Additionally, the strain exhibited the ability to assimilate other short-chain fatty acids such as sodium propionate and sodium butyrate. Regarding photosynthesis, although pigment content decreased with NaAc treatment, the mutant strain displayed higher pigment content in the absence of NaAc compared to the wild type. In terms of lipid and fatty acid profiles, the addition of NaAc significantly increased the crude lipid content in the mutant, with a notable increase in total fatty acid content. The fatty acid composition analysis indicated an increase in C16:0 and C16:1n-7 content and a decrease in EPA content and the UI after NaAc treatment. These results suggest that the mutant strain bolsters the prokaryotic pathway within the chloroplast by enhancing acetate transport and utilization. The study presents a novel perspective on improving organic carbon source utilization in microalgae through metabolic engineering, offering potential strategies for the development of microalgae-based biofuels and bioproducts.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom14070822/s1, Figure S1. Construction of the recombinant vector pPha-T1-ADY2; Figure S2. Positive confirmation of pPha-T1-ADY2 transformants. WT, wild-type strain; NC, negative control; Figure S3. The growth comparison of the wild-type and mutant strain ADY2-4 under different concentrations of sodium acetate after 7 days; Figure S4. The cell morphology comparison of the wild-type and mutant strain ADY2-4 in the late-exponential growth phase under conditions with and without the addition of NaAc. FF, fluorescence filed, stained with Nile Red; BF, bright field.

Author Contributions

Conceptualization, P.S. and H.Q.; data curation, S.D.; formal analysis, P.S. and Y.Z.; funding acquisition, H.Q.; investigation, P.S., N.M. and H.Q.; methodology, P.S. and H.Q.; project administration, H.Q. and S.T.; resources, H.Q. and S.T.; software, P.S.; supervision, H.Q.; validation, P.S., H.Q. and B.G.; writing—original draft, P.S. and H.Q.; writing—review and editing, P.S., H.Q. and J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant No. 32072997), Talent Induction Program for Youth Innovation Teams in Colleges and Universities of Shandong Province (2022–2024), Fund of Yantai Key Laboratory of Quality and Safety Control and Deep Processing of Marine Food (QSCDP202302), and Natural Science Foundation of Shandong Province (ZR2020QC042). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supplementary Materials.

Acknowledgments

All authors would like to thank Qingrong Huang for his help in the microscopic observation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qi, B.; Fraser, T.; Mugford, S.; Dobson, G.; Sayanova, O.; Butler, J.; Napier, J.A.; Stobart, A.K.; Lazarus, C.M. Production of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plants. Nat. Biotechnol. 2004, 22, 739–745. [Google Scholar] [CrossRef] [PubMed]
  2. Balamurugan, S.; Wang, X.; Wang, H.-L.; An, C.-J.; Li, H.; Li, D.-W.; Yang, W.-D.; Liu, J.-S.; Li, H.-Y. Occurrence of plastidial triacylglycerol synthesis and the potential regulatory role of AGPAT in the model diatom Phaeodactylum tricornutum. Biotechnol. Biofuels 2017, 10, 97. [Google Scholar] [CrossRef] [PubMed]
  3. Cui, Y.; Thomas-Hall, S.R.; Chua, E.T.; Schenk, P.M. Development of high-level omega-3 eicosapentaenoic acid (EPA) production from Phaeodactylum tricornutum. J. Phycol. 2021, 57, 258–268. [Google Scholar] [CrossRef] [PubMed]
  4. Xue, J.; Niu, Y.-F.; Huang, T.; Yang, W.-D.; Liu, J.-S.; Li, H.-Y. Genetic improvement of the microalga Phaeodactylum tricornutum for boosting neutral lipid accumulation. Metab. Eng. 2015, 27, 1–9. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, X.; Duan, S.; Li, A.; Xu, N.; Cai, Z.; Hu, Z. Effects of organic carbon sources on growth, photosynthesis, and respiration of Phaeodactylum tricornutum. J. Appl. Phycol. 2009, 21, 239–246. [Google Scholar] [CrossRef]
  6. Cerón Garcí, M.C.; Fernández Sevilla, J.M.; Acién Fernández, F.G.; Molina Grima, E.; García Camacho, F. Mixotrophic growth of Phaeodactylum tricornutum on glycerol: Growth rate and fatty acid profile. J. Appl. Phycol. 2000, 12, 239–248. [Google Scholar] [CrossRef]
  7. Cooksey, K.E. Acetate metabolism by whole cells of Phaeodactylum tricornutum Bohlin. J. Phycol. 1974, 10, 253–257. [Google Scholar] [CrossRef]
  8. Hayward, J. Studies on the growth of Phaeodaetylum tricornutum: II. The effect of organic substances on growth. Physiol. Plant. 1968, 21, 100–108. [Google Scholar] [CrossRef]
  9. Li, K.; Xia, Y.; Wang, Z.; Gao, E.; Huo, S.; Chen, H. Progress in the cultivation of diatoms using organic carbon sources. Algal Res. 2023, 74, 103191. [Google Scholar] [CrossRef]
  10. Young, E.B.; Reed, L.; Berges, J.A. Growth parameters and responses of green algae across a gradient of phototrophic, mixotrophic and heterotrophic conditions. PeerJ 2022, 10, e13776. [Google Scholar] [CrossRef]
  11. Villanova, V.; Singh, D.; Pagliardini, J.; Fell, D.; Le Monnier, A.; Finazzi, G.; Poolman, M. Boosting biomass quantity and quality by improved mixotrophic culture of the diatom Phaeodactylum tricornutum. Adv. Front. Plant Sci. 2021, 12, 642199. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, H.; Fu, R.; Pei, G. A study on lipid production of the mixotrophic microalgae Phaeodactylum tricornutum on various carbon sources. Afr. J. Microbiol. Res 2012, 6, 1041–1047. [Google Scholar]
  13. Pringsheim, E.G. Beiträge zur physiologie saprophytischer algen und flagellaten. Planta 1937, 26, 665–691. [Google Scholar] [CrossRef]
  14. García, T.; Castillo, T.; Flores, C.; Galindo, E. Characterization of a new HUP+ Phaeodactylum tricornutum strain having improved production of eicosapentaenoic acid. J. Appl. Chem. Biotechnol. 2024, 99, 474–480. [Google Scholar] [CrossRef]
  15. Zhang, W.; Zhou, W.; Jiang, S.; Wang, Y.; Chen, L.; Yang, G.; Liu, T. Heterotrophic modification of Phaeodactylum tricornutum Bohlin. Algal Res. 2023, 72, 103137. [Google Scholar] [CrossRef]
  16. Kim, Y.; Lama, S.; Agrawal, D.; Kumar, V.; Park, S. Acetate as a potential feedstock for the production of value-added chemicals: Metabolism and applications. Biotechnol. Adv. 2021, 49, 107736. [Google Scholar] [CrossRef] [PubMed]
  17. Dragone, G. Challenges and opportunities to increase economic feasibility and sustainability of mixotrophic cultivation of green microalgae of the genus Chlorella. Renew. Sustain. Energy Rev. 2022, 160, 112284. [Google Scholar] [CrossRef]
  18. Cheng, J.; Fan, W.; Zheng, L. Development of a mixotrophic cultivation strategy for simultaneous improvement of biomass and photosynthetic efficiency in freshwater microalga Scenedesmus obliquus by adding appropriate concentration of sodium acetate. Biochem. Eng. J 2021, 176, 108177. [Google Scholar] [CrossRef]
  19. Guillard, R.R.L. Culture of Phytoplankton for Feeding Marine Invertebrates. In Culture of Marine Invertebrate Animals: Proceedings—1st Conference on Culture of Marine Invertebrate Animals Greenport; Smith, W.L., Chanley, M.H., Eds.; Springer: Boston, MA, USA, 1975; pp. 29–60. [Google Scholar]
  20. Paiva, S.; Devaux, F.; Barbosa, S.; Jacq, C.; Casal, M. Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast 2004, 21, 201–210. [Google Scholar] [CrossRef]
  21. Zaslavskaia, L.A.; Lippmeier, J.C.; Kroth, P.G.; Grossman, A.R.; Apt, K.E. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. J. Phycol. 2000, 36, 379–386. [Google Scholar] [CrossRef]
  22. Krämer, L.C.; Wasser, D.; Haitz, F.; Sabel, B.; Büchel, C. Heterologous expression of HUP1 glucose transporter enables low-light mediated growth on glucose in Phaeodactylum tricornutum. Algal Res. 2022, 64, 102719. [Google Scholar] [CrossRef]
  23. Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar] [CrossRef]
  24. Greenspan, P.; Mayer, E.P.; Fowler, S.D. Nile Red: A selective fluorescent stain for intracellular lipid droplets. J. Cell Biol. 1985, 100, 965–973. [Google Scholar] [CrossRef] [PubMed]
  25. Leyland, B.; Novichkova, E.; Dolui, A.K.; Jallet, D.; Daboussi, F.; Legeret, B.; Li, Z.; Li-Beisson, Y.; Boussiba, S.; Khozin-Goldberg, I. Acyl-CoA binding protein is required for lipid droplet degradation in the diatom Phaeodactylum Tricornutum. Plant Physiol. 2024, 194, 958–981. [Google Scholar] [CrossRef] [PubMed]
  26. Folch, J.; Lees, M.; Stanley, G.S. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [PubMed]
  27. Qiao, H.; Wang, J.; Zhang, L.; Sun, C.; Ma, J.; Song, Z.; Li, B. An improved direct transesterification method for fatty acid determination of Phaeodactylum tricornutum. J. Appl. Phycol. 2015, 27, 697–701. [Google Scholar] [CrossRef]
  28. Anh, T.P.T.; Borrel-Flood, C.; da Silva, J.V.; Justin, A.M.; Mazliak, P. Effects of water stress on lipid metabolism in cotton leaves. Phytochemistry 1985, 24, 723–727. [Google Scholar] [CrossRef]
  29. The State Oceanic Administration of China. The Specification for Marine Monitoring—Part 4: Seawater Analysis (In Chinese); Stardards Press of China: Beijing, China, 2008; pp. 101–103.
  30. Duncan, D.B.J.B. Multiple range and multiple f tests. Biometrics 1955, 11, 1–42. [Google Scholar] [CrossRef]
  31. Williams, L.J.; Abdi, H.H. Fisher’s least significant difference (LSD) test. Encycl. Res. Des. 2010, 218, 840–853. [Google Scholar]
  32. Haro, P.; Sáez, K.; Gómez, P.I. Physiological plasticity of a Chilean strain of the diatom Phaeodactylum tricornutum: The effect of culture conditions on the quantity and quality of lipid production. J. Appl. Phycol. 2017, 29, 2771–2782. [Google Scholar] [CrossRef]
  33. Zaslavskaia, L.; Lippmeier, J.; Shih, C.; Ehrhardt, D.; Grossman, A.; Apt, K. Trophic conversion of an obligate photoautotrophic organism through metabolic engineering. Science 2001, 292, 2073–2075. [Google Scholar] [CrossRef]
  34. Morales-Sánchez, D.; Martinez-Rodriguez, O.A.; Kyndt, J.; Martinez, A. Heterotrophic growth of microalgae: Metabolic aspects. World J. Microbiol. Biotechnol. 2015, 31, 1–9. [Google Scholar] [CrossRef] [PubMed]
  35. Fantino, E.; Awwad, F.; Merindol, N.; Garza, A.M.D.; Gélinas, S.-E.; Robles, G.C.G.; Custeau, A.; Meddeb-Mouelhi, F.; Desgagné-Penix, I. Bioengineering Phaeodactylum tricornutum, a marine diatom, for cannabinoid biosynthesis. Algal Res. 2024, 77, 103379. [Google Scholar] [CrossRef]
  36. Macdonald Miller, S.A. Screening, Mutagenesis and Gene Expression Analysis for Improving Fucoxanthin Biosynthesis in the Marine Diatom Phaeodactylum tricornutum. Ph.D. Thesis, University of Technology Sydney, Sydney, Australia, 2023. [Google Scholar]
  37. Wang, C.; Zhang, H.; Wang, J.; Sprecher, B.; Lin, S. Glyphosate (Roundup) as phosphorus nutrient enhances carbon and nitrogen accumulation and up-regulates phosphorus metabolisms in the haptophyte Isochrysis galbana. Sci. Total Environ. 2024, 913, 169715. [Google Scholar] [CrossRef] [PubMed]
  38. Liqun, J.I.N.; Xiaohan, L.I.; Beibei, Z.; Zhiqiang, L.I.U.; Yuguo, Z. Organic acid transporters in microorganisms. Acta Microbiol. Sin. 2023, 63, 3386–3408. [Google Scholar]
  39. Giovanardi, M.; Baldisserotto, C.; Ferroni, L.; Longoni, P.; Cella, R.; Pancaldi, S. Growth and lipid synthesis promotion in mixotrophic Neochloris oleoabundans (Chlorophyta) cultivated with glucose. Protoplasma 2014, 251, 115–125. [Google Scholar] [CrossRef] [PubMed]
  40. Ip, P.-F.; Wong, K.-H.; Chen, F. Enhanced production of astaxanthin by the green microalga Chlorella zofingiensis in mixotrophic culture. Process Biochem. 2004, 39, 1761–1766. [Google Scholar] [CrossRef]
  41. Peng, S.; Cao, Y.; Xie, Z.; Zhang, X.; Ma, S.; Kong, W. Effects of sodium acetate and ammonium acetate on the growth and production of cellular components of Chlorella vulgaris 31. J. Appl. Phycol. 2024, 36, 1–14. [Google Scholar] [CrossRef]
  42. Kindle, K.L. Expression of a gene for a light-harvesting chlorophyll a/b-binding protein in Chlamydomonas reinhardtii: Effect of light and acetate. Plant Mol. Biol. 1987, 9, 547–563. [Google Scholar] [CrossRef] [PubMed]
  43. Qiao, H.; Wang, G.; Liu, K.; Gu, W. Short-term effects of acetate and microaerobic conditions on photosynthesis and respiration in Chlorella sorokiniana GXNN 01 (Chlorophyta). J. Phycol. 2012, 48, 992–1001. [Google Scholar] [CrossRef]
  44. Lemaire, S.D.; Guillon, B.; Le Maréchal, P.; Keryer, E.; Miginiac-Maslow, M.; Decottignies, P. New thioredoxin targets in the unicellular photosynthetic eukaryote Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 2004, 101, 7475–7480. [Google Scholar] [CrossRef]
  45. Kovács, L.; Wiessner, W.; Kis, M.; Nagy, F.; Mende, D.; Demeter, S. Short-and long-term redox regulation of photosynthetic light energy distribution and photosystem stoichiometry by acetate metabolism in the green alga, Chlamydobotrys stellata. Photosynth. Res. 2000, 65, 231–247. [Google Scholar] [CrossRef] [PubMed]
  46. Huang, P.-L.; Li, L.; Li, J.-J.; Li, X.-Y. Effects of S-metolachlor on photosynthetic characteristics of Microcystis flos-aquae. Res. J. Environ. Sci. 2020, 33, 1885–1893. [Google Scholar]
  47. Kitano, M.; Matsukawa, R.; Karube, I. Changes in eicosapentaenoic acid content of Navicula saprophila, Rhodomonas salina and Nitzschia sp. under mixotrophic conditions. J. Appl. Phycol. 1997, 9, 559–563. [Google Scholar]
  48. Abida, H.; Dolch, L.-J.; Meï, C.; Villanova, V.; Conte, M.; Block, M.A.; Finazzi, G.; Bastien, O.; Tirichine, L.; Bowler, C. Membrane glycerolipid remodeling triggered by nitrogen and phosphorus starvation in Phaeodactylum tricornutum. Plant Physiol. 2015, 167, 118–136. [Google Scholar] [CrossRef]
  49. Schnurr, J.A.; Shockey, J.M.; de Boer, G.-J.; Browse, J.A. Fatty acid export from the chloroplast. Molecular characterization of a major plastidial acyl-coenzyme A synthetase from Arabidopsis. Plant Physiol. 2002, 129, 1700–1709. [Google Scholar] [CrossRef] [PubMed]
  50. Li-Beisson, Y.; Thelen, J.J.; Fedosejevs, E.; Harwood, J.L. The lipid biochemistry of eukaryotic algae. Prog. Lipid Res. 2019, 74, 31–68. [Google Scholar] [CrossRef] [PubMed]
  51. Smith, R.; Jouhet, J.; Gandini, C.; Nekrasov, V.; Marechal, E.; Napier, J.A.; Sayanova, O. Plastidial acyl carrier protein Δ9-desaturase modulates eicosapentaenoic acid biosynthesis and triacylglycerol accumulation in Phaeodactylum tricornutum. Plant J. 2021, 106, 1247–1259. [Google Scholar] [CrossRef] [PubMed]
  52. Guschina, I.A.; Harwood, J.L. Lipids and lipid metabolism in eukaryotic algae. Prog. Lipid Res. 2006, 45, 160–186. [Google Scholar] [CrossRef] [PubMed]
  53. Mendoza Guzmán, H.; de la Jara Valido, A.; Carmona Duarte, L.; Freijanes Presmanes, K. Analysis of interspecific variation in relative fatty acid composition: Use of flow cytometry to estimate unsaturation index and relative polyunsaturated fatty acid content in microalgae. J. Appl. Phycol. 2011, 23, 7–15. [Google Scholar] [CrossRef]
  54. Mendoza Guzmán, H.; de la Jara Valido, A.; Freijanes Presmanes, K.; Carmona Duarte, L. Quick estimation of intraspecific variation of fatty acid composition in Dunaliella salina using flow cytometry and Nile Red. J. Appl. Phycol. 2012, 24, 1237–1243. [Google Scholar] [CrossRef]
  55. Roessler, P.G. Environmental control of glycerolipid metabolism in microalgae: Commercial implications and future research directions. J. Phycol. 1990, 26, 393–399. [Google Scholar] [CrossRef]
Figure 1. The specific growth rates of P. tricornutum cells under different concentrations of sodium acetate. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Figure 1. The specific growth rates of P. tricornutum cells under different concentrations of sodium acetate. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Biomolecules 14 00822 g001
Figure 2. The growth curves of (a) WT, (b) ADY2-4, (c) ADY2-9, and (d) ADY2-12 strains cultivated under conditions with and without the addition of NaAc.
Figure 2. The growth curves of (a) WT, (b) ADY2-4, (c) ADY2-9, and (d) ADY2-12 strains cultivated under conditions with and without the addition of NaAc.
Biomolecules 14 00822 g002
Figure 3. (a) Comparison of the cell dry weight at the end of the growth experiment for cells with or without 0.01 M NaAc, and (b) the specific growth rate of cells treated with 0.01 M or 0.05 M sodium propionate (NaPr) or sodium butyrate (NaBu). Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Figure 3. (a) Comparison of the cell dry weight at the end of the growth experiment for cells with or without 0.01 M NaAc, and (b) the specific growth rate of cells treated with 0.01 M or 0.05 M sodium propionate (NaPr) or sodium butyrate (NaBu). Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Biomolecules 14 00822 g003
Figure 4. Photosynthetic pigments content per 107 cells of the wild-type and ADY2-4 under different treatments. (a) The content of Chl-a; (b) the content of Chl-c; (c) the content of carotenoid. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Figure 4. Photosynthetic pigments content per 107 cells of the wild-type and ADY2-4 under different treatments. (a) The content of Chl-a; (b) the content of Chl-c; (c) the content of carotenoid. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Biomolecules 14 00822 g004
Figure 5. (a) Responses of maximum quantum yield of PSII (Fv/Fm), (b) the effective quantum yield (QY), (c) rapid chlorophyll fluorescence induction curves (OJIP-test), and (d) light response curves of the wild-type and mutant strains under conditions with and without the addition of NaAc. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Figure 5. (a) Responses of maximum quantum yield of PSII (Fv/Fm), (b) the effective quantum yield (QY), (c) rapid chlorophyll fluorescence induction curves (OJIP-test), and (d) light response curves of the wild-type and mutant strains under conditions with and without the addition of NaAc. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Biomolecules 14 00822 g005
Figure 6. (a) The crude lipid content and (b) total fatty acid content of the wild-type and mutant strains under conditions with or without the addition of sodium acetate. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Figure 6. (a) The crude lipid content and (b) total fatty acid content of the wild-type and mutant strains under conditions with or without the addition of sodium acetate. Column values (mean ± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Biomolecules 14 00822 g006
Table 1. Acetate transporter gene ADY2 primer sequences for PCR amplification.
Table 1. Acetate transporter gene ADY2 primer sequences for PCR amplification.
PrimerSequence (5′-3′)
ADY2-PCR-FCATGCATGCTCTCGTTATTAGTAGGTCGTGC
ADY2-PCR-RCGCGGATCCGTTGGATCGTATTTCCCTGAG
Table 2. The removal efficiency of COD by wild-type and mutant strains. Values (mean± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
Table 2. The removal efficiency of COD by wild-type and mutant strains. Values (mean± SD of three replicates) with different lowercase letters are significantly different (p < 0.05).
StrainsInitial COD (mg L−1)Final COD (mg L−1)COD Removal Rate (%)
WT180.58 ± 8.2124.86 ± 1.23 a86.23 ± 0.25 a
ADY2-4180.58 ± 8.2117.51 ± 1.25 b90.30 ± 0.27 b
Table 3. The fatty acid composition (% of total fatty acids) and unsaturation index (UI) of the wild-type and mutant strains under conditions with or without the addition of sodium acetate. Values (mean ± SD of three replicates) within the same row with different lowercase letters are significantly different (p < 0.05).
Table 3. The fatty acid composition (% of total fatty acids) and unsaturation index (UI) of the wild-type and mutant strains under conditions with or without the addition of sodium acetate. Values (mean ± SD of three replicates) within the same row with different lowercase letters are significantly different (p < 0.05).
Fatty AcidsGroups
WT-0MADY2-4-0MWT-0.01MADY2-4-0.01M
C14:08.92 ± 0.28 a7.69 ± 0.32 b7.69 ± 0.12 b6.17 ± 0.16 c
C16:011.97 ± 0.75 a14.63 ± 0.29 b23.64 ± 1.05 c22.76 ± 0.37 c
C16:1n-716.01 ± 0.56 a20.50 ± 0.54 b28.17 ± 1.95 c33.82 ± 0.76 d
C18:1n-99.33 ± 0.13 a8.17 ± 0.20 b9.41 ± 0.33 a6.58 ± 0.12 c
EPA27.19 ± 0.65 a24.42 ± 0.25 b13.41 ± 0.33 c12.59 ± 0.45 c
C16:43.00 ± 0.25 a3.53 ± 0.15 b1.40 ± 0.10 c1.25 ± 0.09 c
C18:00.56 ± 0.09 a0.55 ± 0.02 a1.44 ± 0.19 b0.82 ± 0.03 a
C18:1n-70.55 ± 0.02 a0.81 ± 0.03 b1.19 ± 0.08 c2.17 ± 0.14 d
C18:2n-62.91 ± 0.04 a2.15 ± 0.18 b1.22 ± 0.05 c1.35 ± 0.06 c
C20:3n-31.79 ± 0.15 a1.36 ± 0.02 b1.02 ± 0.06 c0.05 ± 0.00 d
C20:4n-31.06 ± 0.05 a0.50 ± 0.11 b0.33 ± 0.03 b0.44 ± 0.02 b
C24:01.51 ± 0.11 a1.53 ± 0.03 a0.89 ± 0.06 b0.84 ± 0.02 b
Minor FAs *2.39 ± 0.04 a2.52 ± 0.03 a2.66 ± 0.40 a1.81 ± 0.06 b
UI200.59 ± 3.51 a188.80 ± 0.92 b129.36 ± 2.32 c124.20 ± 2.73 c
* The sum of the percentages of the fatty acids including C16:2, C16:3, C18:3n-3, C18:3n-6, C20:4n-6, C22:5n-3, and DHA, with the proportion of each minor component ranging from 0.01% to 0.86%.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Song, P.; Ma, N.; Dong, S.; Qiao, H.; Zhang, J.; Guan, B.; Tong, S.; Zhao, Y. Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules 2024, 14, 822. https://doi.org/10.3390/biom14070822

AMA Style

Song P, Ma N, Dong S, Qiao H, Zhang J, Guan B, Tong S, Zhao Y. Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules. 2024; 14(7):822. https://doi.org/10.3390/biom14070822

Chicago/Turabian Style

Song, Pu, Ning Ma, Shaokun Dong, Hongjin Qiao, Jumei Zhang, Bo Guan, Shanying Tong, and Yancui Zhao. 2024. "Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein" Biomolecules 14, no. 7: 822. https://doi.org/10.3390/biom14070822

APA Style

Song, P., Ma, N., Dong, S., Qiao, H., Zhang, J., Guan, B., Tong, S., & Zhao, Y. (2024). Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules, 14(7), 822. https://doi.org/10.3390/biom14070822

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop