Graphene Oxide-Coated Patterned Silk Fibroin Films Promote Cell Adhesion and Induce Cardiomyogenic Differentiation of Human Mesenchymal Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Fabrication of P-GSF Films
2.2. Characterization of P-GSF Films
2.3. Cell Adhesion Assay
2.4. Cell Morphology and Viability Assay
2.5. Cardiomyogenic Differentiation of hAMSCs on P-GSF Films
2.6. Statistical Analysis
3. Results
3.1. Formation and Characterization of P-GSF Films
3.2. Cell Adhesion of AMSCs
3.3. Cell Proliferation and Cell Morphology of AMSCs
3.4. Cardiomyocytes Differentiation and Cardiac-Specific Gene Expression of AMSCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Orlic, D.; Kajstura, J.; Chimenti, S.; Jakoniuk, I.; Anderson, S.M.; Li, B.S.; Pickel, J.; McKay, R.; Nadal-Ginard, B.; Bodine, D.M.; et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001, 410, 701–705. [Google Scholar] [PubMed]
- Kinnaird, T.; Stabile, E.; Burnett, M.S.; Lee, C.W.; Barr, S.; Fuchs, S.; Epstein, S.E. Marrow-derived stromal cells express genes encoding a broad spectrum of arteriogenic cytokines and promote in vitro and in vivo arteriogenesis through paracrine mechanisms. Circ. Res. 2004, 94, 678–685. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Kim, R.Y.; Park, B.W.; Lee, S.; Choi, S.W.; Park, J.H.; Choi, J.J.; Kim, S.W.; Jang, J.; Cho, D.W.; et al. Dual stem cell therapy synergistically improves cardiac function and vascular regeneration following myocardial infarction. Nat. Commun. 2019, 10, 3123. [Google Scholar] [CrossRef] [PubMed]
- Rangappa, S.; Fen, C.; Lee, E.H.; Bongso, A.; Wei, E.S.K. Transformation of adult mesenchymal stem cells isolated from the fatty tissue into cardiomyocytes. Ann. Thorac. Surg. 2003, 75, 775–779. [Google Scholar]
- Tay, C.Y.; Yu, H.Y.; Pal, M.; Leong, W.S.; Tan, N.S.; Ng, K.W.; Leong, D.T.; Tan, L.P. Micropatterned matrix directs differentiation of human mesenchymal stem cells towards myocardial lineage. Exp. Cell Res. 2010, 316, 1159–1168. [Google Scholar]
- Coulombe, K.L.K.; Bajpai, V.K.; Andreadis, S.T.; Murry, C.E. Heart Regeneration with Engineered Myocardial Tissue. Annu. Rev. Biomed. Eng. 2014, 16, 1–28. [Google Scholar] [PubMed]
- Lee, W.Y.; Wei, H.J.; Lin, W.W.; Yeh, Y.C.; Hwang, S.M.; Wang, J.J.; Tsai, M.S.; Chang, Y.; Sung, H.W. Enhancement of cell retention and functional benefits in myocardial infarction using human amniotic-fluid stem-cell bodies enriched with endogenous ECM. Biomaterials 2011, 32, 5558–5567. [Google Scholar]
- Terrovitis, J.; Lautamaki, R.; Bonios, M.; Fox, J.; Engles, J.M.; Yu, J.H.; Leppo, M.K.; Pomper, M.G.; Wahl, R.L.; Seidel, J.; et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography after Intramyocardial Cardiac-Derived Stem Cell Delivery. J. Am. Coll. Cardiol. 2009, 54, 1619–1626. [Google Scholar]
- Mignone, J.L.; Kreutziger, K.L.; Paige, S.L.; Murry, C.E. Cardiogenesis From Human Embryonic Stem Cells-Mechanisms and Applications. Circ. J. 2010, 74, 2517–2526. [Google Scholar]
- Lee, T.J.; Park, S.; Bhang, S.H.; Yoon, J.K.; Jo, I.; Jeong, G.J.; Hong, B.H.; Kim, B.S. Graphene enhances the cardiomyogenic differentiation of human embryonic stem cells. Biochem. Bioph. Res. Commun. 2014, 452, 174–180. [Google Scholar]
- Kassiri, Z.; Khokha, R. Myocardial extra-cellular matrix and its regulation by metalloproteinases and their inhibitors. Thromb. Haemost. 2005, 93, 212–219. [Google Scholar] [CrossRef] [PubMed]
- Papadaki, M.; Bursac, N.; Langer, R.; Merok, J.; Vunjak-Novakovic, G.; Freed, L.E. Tissue engineering of functional cardiac muscle: Molecular, structural, and electrophysiological studies. Am. J. Physiol.-Heart C 2001, 280, H168–H178. [Google Scholar] [CrossRef] [PubMed]
- Camelliti, P.; Borg, T.K.; Kohl, P. Structural and functional characterisation of cardiac fibroblasts. Cardiovasc. Res. 2005, 65, 40–51. [Google Scholar] [CrossRef]
- Shin, S.R.; Zihlmann, C.; Akbari, M.; Assawes, P.; Cheung, L.; Zhang, K.Z.; Manoharan, V.; Zhang, Y.S.; Yuksekkaya, M.; Wan, K.T.; et al. Reduced Graphene Oxide-GelMA Hybrid Hydrogels as Scaffolds for Cardiac Tissue Engineering. Small 2016, 12, 3677–3689. [Google Scholar] [CrossRef]
- Altman, G.H.; Diaz, F.; Jakuba, C.; Calabro, T.; Horan, R.L.; Chen, J.S.; Lu, H.; Richmond, J.; Kaplan, D.L. Silk-based biomaterials. Biomaterials 2003, 24, 401–416. [Google Scholar] [CrossRef] [PubMed]
- Farokhi, M.; Mottaghitalab, F.; Shokrgozar, M.A.; Kaplan, D.L.; Kim, H.W.; Kundu, S.C. Prospects of peripheral nerve tissue engineering using nerve guide conduits based on silk fibroin protein and other biopolymers. Int. Mater. Rev. 2017, 62, 367–391. [Google Scholar] [CrossRef]
- Zhang, Q.; Ma, L.; Zheng, S.N.; Wang, Y.R.; Feng, M.L.; Shuai, Y.J.; Duan, B.; Fan, X.; Yang, M.Y.; Mao, C.B. Air-plasma treatment promotes bone-like nano-hydroxylapatite formation on protein films for enhanced in vivo osteogenesis. Biomater. Sci. 2019, 7, 2326–2334. [Google Scholar] [CrossRef]
- Shuai, Y.J.; Mao, C.B.; Yang, M.Y. Protein Nanofibril Assemblies Templated by Graphene Oxide Nanosheets Accelerate Early Cell Adhesion and Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells. Acs Appl. Mater. Interfaces 2018, 10, 31988–31997. [Google Scholar] [CrossRef]
- Lu, K.; Chen, X.D.; Tang, H.; Zhou, M.; He, G.; Liu, J.; Bian, X.T.; Guo, Y.P.; Lai, F.; Yang, M.Y.; et al. Bionic Silk Fibroin Film Induces Morphological Changes and Differentiation of Tendon Stem/Progenitor Cells. Appl. Bionics Biomech. 2020, 2020, 8865841. [Google Scholar] [CrossRef]
- Sayin, E.; Baran, E.T.; Hasirci, V. Osteogenic differentiation of adipose derived stem cells on high and low aspect ratio micropatterns. J. Biomat. Sci.-Polym. E 2015, 26, 1402–1424. [Google Scholar] [CrossRef]
- Wang, D.Y.; Sun, Y.; Ding, X.L.; Peng, G.; Zou, T.Q.; Liu, H.F.; Fan, Y.B. Influence of Micropatterned Silk Fibroin Films on Human Umbilical Endothelial Cell Behaviors. J. Med. Biol. Eng. 2017, 37, 750–759. [Google Scholar] [CrossRef]
- Yang, M.Y.; Shuai, Y.J.; Zhou, G.S.; Mandal, N.; Zhu, L.J.; Mao, C.B. Tuning Molecular Weights of Bombyx mori (B. mori) Silk Sericin to Modify Its Assembly Structures and Materials Formation. Acs Appl. Mater. Interfaces 2014, 6, 13782–13789. [Google Scholar] [CrossRef] [PubMed]
- Hronik-Tupaj, M.; Raja, W.K.; Tang-Schomer, M.; Omenetto, F.G.; Kaplan, D.L. Neural responses to electrical stimulation on patterned silk films. J. Biomed. Mater. Res. A 2013, 101, 2559–2572. [Google Scholar] [CrossRef] [PubMed]
- Tang-Schomer, M.D.; Hu, X.; Hronik-Tupaj, M.; Tien, L.W.; Whalen, M.J.; Omenetto, F.G.; Kaplan, D.L. Film-Based Implants for Supporting Neuron-Electrode Integrated Interfaces for The Brain. Adv. Funct. Mater. 2014, 24, 1938–1948. [Google Scholar] [CrossRef]
- Chen, J.P.; Chen, S.H.; Lai, G.J. Preparation and characterization of biomimetic silk fibroin/chitosan composite nanofibers by electrospinning for osteoblasts culture. Nanoscale Res. Lett. 2012, 7, 170. [Google Scholar] [CrossRef]
- Stoppel, W.L.; Hu, D.J.; Domian, I.J.; Kaplan, D.L.; Black, L.D. Anisotropic silk biomaterials containing cardiac extracellular matrix for cardiac tissue engineering. Biomed. Mater. 2015, 10, 034105. [Google Scholar] [CrossRef]
- Zhang, L.M.; Xia, J.G.; Zhao, Q.H.; Liu, L.W.; Zhang, Z.J. Functional Graphene Oxide as a Nanocarrier for Controlled Loading and Targeted Delivery of Mixed Anticancer Drugs. Small 2010, 6, 537–544. [Google Scholar] [CrossRef]
- Chung, C.; Kim, Y.K.; Shin, D.; Ryoo, S.R.; Hong, B.H.; Min, D.H. Biomedical Applications of Graphene and Graphene Oxide. Accounts Chem. Res. 2013, 46, 2211–2224. [Google Scholar] [CrossRef]
- Dreyer, D.R.; Park, S.; Bielawski, C.W.; Ruoff, R.S. The chemistry of graphene oxide. Chem. Soc. Rev. 2010, 39, 228–240. [Google Scholar] [CrossRef]
- Cha, C.Y.; Shin, S.R.; Gao, X.G.; Annabi, N.; Dokmeci, M.R.; Tang, X.W.; Khademhosseini, A. Controlling Mechanical Properties of Cell-Laden Hydrogels by Covalent Incorporation of Graphene Oxide. Small 2014, 10, 514–523. [Google Scholar] [CrossRef]
- Lee, W.C.; Lim, C.H.Y.X.; Shi, H.; Tang, L.A.L.; Wang, Y.; Lim, C.T.; Loh, K.P. Origin of Enhanced Stem Cell Growth and Differentiation on Graphene and Graphene Oxide. Acs Nano 2011, 5, 7334–7341. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.T.; Chang, H.X.; Chen, S.; Lai, C.; Khademhosseini, A.; Wu, H.K. Regulating Cellular Behavior on Few-Layer Reduced Graphene Oxide Films with Well-Controlled Reduction States. Adv. Funct. Mater. 2012, 22, 751–759. [Google Scholar] [CrossRef]
- Park, S.; An, J.H.; Jung, I.W.; Piner, R.D.; An, S.J.; Li, X.S.; Velamakanni, A.; Ruoff, R.S. Colloidal Suspensions of Highly Reduced Graphene Oxide in a Wide Variety of Organic Solvents. Nano Lett. 2009, 9, 1593–1597. [Google Scholar] [CrossRef]
- Kang, S.M.; Park, S.; Kim, D.; Park, S.Y.; Ruoff, R.S.; Lee, H. Simultaneous Reduction and Surface Functionalization of Graphene Oxide by Mussel-Inspired Chemistry. Adv. Funct. Mater. 2011, 21, 108–112. [Google Scholar] [CrossRef]
- Shao, L.H.; Zhang, R.R.; Lu, J.Q.; Zhao, C.Y.; Deng, X.W.; Wu, Y. Mesoporous Silica Coated Polydopamine Functionalized Reduced Graphene Oxide for Synergistic Targeted Chemo-Photothermal Therapy. ACS Appl. Mater. Interfaces 2017, 9, 1226–1236. [Google Scholar] [CrossRef]
- Wang, Y.X.; Ma, R.L.; Hu, K.S.; Kim, S.H.; Fang, G.Q.; Shao, Z.Z.; Tsukruk, V.V. Dramatic Enhancement of Graphene Oxide/Silk Nanocomposite Membranes: Increasing Toughness, Strength, and Young’s modulus via Annealing of Interfacial Structures. ACS Appl. Mater. Interfaces 2016, 8, 24962–24973. [Google Scholar] [CrossRef]
- Tang, P.F.; Han, L.; Li, P.F.; Jia, Z.R.; Wang, K.F.; Zhang, H.P.; Tan, H.; Guo, T.L.; Lu, X. Mussel-Inspired Electroactive and Antioxidative Scaffolds with Incorporation of Polydopamine-Reduced Graphene Oxide for Enhancing Skin Wound Healing. ACS Appl. Mater. Interfaces 2019, 11, 7703–7714. [Google Scholar] [CrossRef]
- Wang, S.D.; Ma, Q.; Wang, K.; Chen, H.W. Improving Antibacterial Activity and Biocompatibility of Bioinspired Electrospinning Silk Fibroin Nanofibers Modified by Graphene Oxide. ACS Omega 2018, 3, 406–413. [Google Scholar] [CrossRef]
- Tasnim, N.; Kumar, A.; Joddar, B. Attenuation of the in vitro neurotoxicity of 316L SS by graphene oxide surface coating. Mater. Sci. Eng. C 2017, 73, 788–797. [Google Scholar] [CrossRef]
- Kim, J.; Choi, K.S.; Kim, Y.; Lim, K.T.; Seonwoo, H.; Park, Y.; Kim, D.H.; Choung, P.H.; Cho, C.S.; Kim, S.Y.; et al. Bioactive effects of graphene oxide cell culture substratum on structure and function of human adipose-derived stem cells. J. Biomed. Mater. Res. A 2013, 101, 3520–3530. [Google Scholar] [CrossRef]
- Zhang, Y.; Lu, L.H.; Chen, Y.P.; Wang, J.; Chen, Y.Y.; Mao, C.B.; Yang, M.Y. Polydopamine modification of silk fibroin membranes significantly promotes their wound healing effect. Biomater. Sci. 2019, 7, 5232–5237. [Google Scholar] [CrossRef] [PubMed]
- Potapova, I.A.; Gaudette, G.R.; Brink, P.R.; Robinson, R.B.; Rosen, M.R.; Cohen, I.S.; Doronin, S.V. Mesenchymal stem cells support migration, extracellular matrix invasion, proliferation, and survival of endothelial cells in vitro. Stem Cells 2007, 25, 1761–1768. [Google Scholar] [CrossRef] [PubMed]
- Hsu, S.H.; Huang, G.S.; Lin, S.Y.F.; Feng, F.; Ho, T.T.; Liao, Y.C. Enhanced Chondrogenic Differentiation Potential of Human Gingival Fibroblasts by Spheroid Formation on Chitosan Membranes. Tissue Eng. Part A 2012, 18, 67–79. [Google Scholar] [CrossRef]
- Lee, E.J.; Park, S.J.; Kang, S.K.; Kim, G.H.; Kang, H.J.; Lee, S.W.; Leo, H.B.; Kim, H.S. Spherical Bullet Formation via E-cadherin Promotes Therapeutic Potency of Mesenchymal Stem Cells Derived From Human Umbilical Cord Blood for Myocardial Infarction. Mol. Ther. 2012, 20, 1424–1433. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.B.; Moncivais, K.; Caplan, A.I. Mesenchymal stem cells: Environmentally responsive therapeutics for regenerative medicine. Exp. Mol. Med. 2013, 45, e54. [Google Scholar] [CrossRef]
- Pagliari, F.; Mandoli, C.; Forte, G.; Magnani, E.; Pagliari, S.; Nardone, G.; Licoccia, S.; Minieri, M.; Di Nardo, P.; Traversa, E. Cerium Oxide Nanoparticles Protect Cardiac Progenitor Cells from Oxidative Stress. ACS Nano 2012, 6, 3767–3775. [Google Scholar] [CrossRef]
- Park, J.; Kim, Y.S.; Ryu, S.; Kang, W.S.; Park, S.; Han, J.; Jeong, H.C.; Hong, B.H.; Ahn, Y.; Kim, B.S. Graphene Potentiates the Myocardial Repair Efficacy of Mesenchymal Stem Cells by Stimulating the Expression of Angiogenic Growth Factors and Gap Junction Protein. Adv. Funct. Mater. 2015, 25, 2590–2600. [Google Scholar] [CrossRef]





| Genes | 5′-3′ | Primers |
|---|---|---|
| GAPDH | forward | TGACGCTGGGGCTGGCATTG |
| reverse | GGCTGGTGGTCCAGGGGTCT | |
| cTnT | forward | GGCAGCGGAAGAGGATGCTGAA |
| reverse | GAGGCACCAAGTTGGGCATGAACGAC | |
| Connexin 43 | forward | ACT GGC GAC AGA AAC AAT TCT TC |
| reverse | TTC TGC ACT GTA ATT AGC CCA GTT | |
| GATA-4 | forward | TCCCTCTTCCCTCCTCAAAT |
| reverse | TCAGCGTGTAAAGGCATCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Wu, Y.; Wang, Y.; Shuai, Y.; Xu, Z.; Wan, Q.; Chen, Y.; Yang, M. Graphene Oxide-Coated Patterned Silk Fibroin Films Promote Cell Adhesion and Induce Cardiomyogenic Differentiation of Human Mesenchymal Stem Cells. Biomolecules 2023, 13, 990. https://doi.org/10.3390/biom13060990
Wang J, Wu Y, Wang Y, Shuai Y, Xu Z, Wan Q, Chen Y, Yang M. Graphene Oxide-Coated Patterned Silk Fibroin Films Promote Cell Adhesion and Induce Cardiomyogenic Differentiation of Human Mesenchymal Stem Cells. Biomolecules. 2023; 13(6):990. https://doi.org/10.3390/biom13060990
Chicago/Turabian StyleWang, Jie, Yi Wu, Yecheng Wang, Yajun Shuai, Zongpu Xu, Quan Wan, Yuyin Chen, and Mingying Yang. 2023. "Graphene Oxide-Coated Patterned Silk Fibroin Films Promote Cell Adhesion and Induce Cardiomyogenic Differentiation of Human Mesenchymal Stem Cells" Biomolecules 13, no. 6: 990. https://doi.org/10.3390/biom13060990
APA StyleWang, J., Wu, Y., Wang, Y., Shuai, Y., Xu, Z., Wan, Q., Chen, Y., & Yang, M. (2023). Graphene Oxide-Coated Patterned Silk Fibroin Films Promote Cell Adhesion and Induce Cardiomyogenic Differentiation of Human Mesenchymal Stem Cells. Biomolecules, 13(6), 990. https://doi.org/10.3390/biom13060990

