Characterization and Modification of Light-Sensitive Phosphodiesterases from Choanoflagellates
Abstract
:1. Introduction
2. Materials and Methods
2.1. Gene Synthesis and Generation of Constructs
2.2. Expression in Xenopus Oocytes
2.3. Xenopus Oocytes Membrane Extraction and In Vitro PDE Activity Assay
2.4. Fluorescence Emission Detection
2.5. Illumination Conditions
2.6. Imaging of Xenopus Oocytes
2.7. Data Analysis
2.8. Bioinformatics
3. Results
3.1. Comparison of RhoPDEs
3.2. The Hydrolysis Activities of RhoPDEs
3.3. Light Increased the Substrate Affinity of CfRhoPDE1
3.4. Molecular Engineering of Non-Functional RhoPDEs
3.5. PDE Mutants with Decreased Dark Activity and Unchanged L/D Rratio
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nagel, G.; Ollig, D.; Fuhrmann, M.; Kateriya, S.; Musti, A.M.; Bamberg, E.; Hegemann, P. Channelrhodopsin-1: A light-gated proton channel in green algae. Science 2002, 296, 2395–2398. [Google Scholar] [CrossRef]
- Nagel, G.; Mockel, B.; Buldt, G.; Bamberg, E. Functional expression of bacteriorhodopsin in oocytes allows direct measurement of voltage dependence of light induced H+ pumping. FEBS Lett. 1995, 377, 263–266. [Google Scholar] [CrossRef] [Green Version]
- Nagel, G.; Szellas, T.; Huhn, W.; Kateriya, S.; Adeishvili, N.; Berthold, P.; Ollig, D.; Hegemann, P.; Bamberg, E. Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proc. Natl. Acad. Sci. USA 2003, 100, 13940–13945. [Google Scholar] [CrossRef] [Green Version]
- Nagel, G.; Brauner, M.; Liewald, J.F.; Adeishvili, N.; Bamberg, E.; Gottschalk, A. Light activation of channelrhodopsin-2 in excitable cells of Caenorhabditis elegans triggers rapid Behavioral responses. Curr. Biol. 2005, 15, 2279–2284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, F.; Wang, L.-P.; Brauner, M.; Liewald, J.F.; Kay, K.; Watzke, N.; Wood, P.G.; Bamberg, E.; Nagel, G.; Gottschalk, A.; et al. Multimodal fast optical interrogation of neural circuitry. Nature 2007, 446, 633–639. [Google Scholar] [CrossRef] [PubMed]
- Dawydow, A.; Gueta, R.; Ljaschenko, D.; Ullrich, S.; Hermann, M.; Ehmann, N.; Gao, S.; Fiala, A.; Langenhan, T.; Nagel, G.; et al. Channelrhodopsin-2-XXL, a powerful optogenetic tool for low-light applications. Proc. Natl. Acad. Sci. USA 2014, 111, 13972–13977. [Google Scholar] [CrossRef] [Green Version]
- Boyden, E.S.; Zhang, F.; Bamberg, E.; Nagel, G.; Deisseroth, K. Millisecond-timescale, genetically targeted optical control of neural activity. Nat. Neurosci. 2005, 8, 1263–1268. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Gao, S.; von der Heyde, E.L.; Hallmann, A.; Nagel, G. Two-component cyclase opsins of green algae are ATP-dependent and light-inhibited guanylyl cyclases. BMC Biol. 2018, 16, 144. [Google Scholar] [CrossRef]
- Avelar, G.M.; Schumacher, R.I.; Zaini, P.A.; Leonard, G.; Richards, T.A.; Gomes, S.L. A rhodopsin-guanylyl cyclase gene fusion functions in visual perception in a fungus. Curr. Biol. 2014, 24, 1234–1240. [Google Scholar] [CrossRef] [Green Version]
- Gao, S.; Nagpal, J.; Schneider, M.W.; Kozjak-Pavlovic, V.; Nagel, G.; Gottschalk, A. Optogenetic manipulation of cGMP in cells and animals by the tightly light-regulated guanylyl-cyclase opsin CyclOp. Nat. Commun. 2015, 6, 8046. [Google Scholar] [CrossRef] [Green Version]
- Scheib, U.; Stehfest, K.; Gee, C.E.; Korschen, H.G.; Fudim, R.; Oertner, T.G.; Hegemann, P. The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling. Sci. Signal 2015, 8, rs8. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.; Nagel, G.; Gao, S. An engineered membrane-bound guanylyl cyclase with light-switchable activity. BMC Biol. 2021, 19, 54. [Google Scholar] [CrossRef]
- Lamarche, L.B.; Kumar, R.P.; Trieu, M.M.; Devine, E.L.; Cohen-Abeles, L.E.; Theobald, D.L.; Oprian, D.D. Purification and Characterization of RhoPDE, a Retinylidene/Phosphodiesterase Fusion Protein and Potential Optogenetic Tool from the Choanoflagellate Salpingoeca rosetta. Biochemistry 2017, 56, 5812–5822. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, K.; Tsunoda, S.P.; Brown, L.S.; Kandori, H. A unique choanoflagellate enzyme rhodopsin exhibits light-dependent cyclic nucleotide phosphodiesterase activity. J. Biol. Chem. 2017, 292, 7531–7541. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.H.; Gao, S.Q.; Yang, S.; Nagel, G. A novel rhodopsin phosphodiesterase from Salpingoeca rosetta shows light-enhanced substrate affinity. Biochem. J. 2018, 475, 1121–1128. [Google Scholar] [CrossRef] [Green Version]
- Ikuta, T.; Shihoya, W.; Sugiura, M.; Yoshida, K.; Watari, M.; Tokano, T.; Yamashita, K.; Katayama, K.; Tsunoda, S.P.; Uchihashi, T.; et al. Structural insights into the mechanism of rhodopsin phosphodiesterase. Nat. Commun. 2020, 11, 5605. [Google Scholar] [CrossRef]
- Brunet, T.; Larson, B.T.; Linden, T.A.; Vermeij, M.J.A.; McDonald, K.; King, N. Light-regulated collective contractility in a multicellular choanoflagellate. Science 2019, 366, 326. [Google Scholar] [CrossRef]
- Richter, D.J.; Fozouni, P.; Eisen, M.B.; King, N. Gene family innovation, conservation and loss on the animal stem lineage. eLife 2018, 7, e34226. [Google Scholar] [CrossRef] [PubMed]
- Sugiura, M.; Tsunoda, S.P.; Hibi, M.; Kandori, H. Molecular Properties of New Enzyme Rhodopsins with Phosphodiesterase Activity. ACS Omega 2020, 5, 10602–10609. [Google Scholar] [CrossRef] [PubMed]
- Moller, S.; Croning, M.D.; Apweiler, R. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 2001, 17, 646–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drozdetskiy, A.; Cole, C.; Procter, J.; Barton, G.J. JPred4: A protein secondary structure prediction server. Nucleic Acids Res. 2015, 43, W389–W394. [Google Scholar] [CrossRef]
- Schroder-Lang, S.; Schwarzel, M.; Seifert, R.; Strunker, T.; Kateriya, S.; Looser, J.; Watanabe, M.; Kaupp, U.B.; Hegemann, P.; Nagel, G. Fast manipulation of cellular cAMP level by light in vivo. Nat. Methods 2007, 4, 39–42. [Google Scholar] [CrossRef]
- Iseki, M.; Matsunaga, S.; Murakami, A.; Ohno, K.; Shiga, K.; Yoshida, K.; Sugai, M.; Takahashi, T.; Hori, T.; Watanabe, M. A blue-light-activated adenylyl cyclase mediates photoavoidance in Euglena gracilis. Nature 2002, 415, 1047–1051. [Google Scholar] [CrossRef] [PubMed]
- Weissenberger, S.; Schultheis, C.; Liewald, J.F.; Erbguth, K.; Nagel, G.; Gottschalk, A. PACα– an optogenetic tool for in vivo manipulation of cellular cAMP levels, neurotransmitter release, and behavior in Caenorhabditis elegans. J. Neurochem. 2011, 116, 616–625. [Google Scholar] [CrossRef] [PubMed]
- Stierl, M.; Stumpf, P.; Udwari, D.; Gueta, R.; Hagedorn, R.; Losi, A.; Gärtner, W.; Petereit, L.; Efetova, M.; Schwarzel, M. Light modulation of cellular cAMP by a small bacterial photoactivated adenylyl cyclase, bPAC, of the soil bacterium Beggiatoa. J. Biol. Chem. 2011, 286, 1181–1188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, S.; Constantin, O.M.; Sachidanandan, D.; Hofmann, H.; Kunz, T.C.; Kozjak-Pavlovic, V.; Oertner, T.G.; Nagel, G.; Kittel, R.J.; Gee, C.E.; et al. PACmn for improved optogenetic control of intracellular cAMP. BMC Biol. 2021, 19, 227. [Google Scholar] [CrossRef]
- Zhang, S.X.; Lutas, A.; Yang, S.; Diaz, A.; Fluhr, H.; Nagel, G.; Gao, S.; Andermann, M.L. Hypothalamic dopamine neurons motivate mating through persistent cAMP signalling. Nature 2021, 597, 245–249. [Google Scholar] [CrossRef]
- Tian, Y.; Yang, S.; Gao, S. Advances, Perspectives and Potential Engineering Strategies of Light-Gated Phosphodiesterases for Optogenetic Applications. Int. J. Mol. Sci. 2020, 21, 7544. [Google Scholar] [CrossRef] [PubMed]
- Stabel, R.; Stüven, B.; Hansen, J.N.; Körschen, H.G.; Wachten, D.; Möglich, A. Revisiting and Redesigning Light-Activated Cyclic-Mononucleotide Phosphodiesterases. J. Mol. Biol. 2019, 431, 3029–3045. [Google Scholar] [CrossRef] [PubMed]
- Gasser, C.; Taiber, S.; Yeh, C.-M.; Wittig, C.H.; Hegemann, P.; Ryu, S.; Wunder, F.; Möglich, A. Engineering of a red-light–activated human cAMP/cGMP-specific phosphodiesterase. Proc. Natl. Acad. Sci. USA 2014, 111, 8803–8808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ullrich, S.; Gueta, R.; Nagel, G. Degradation of channelopsin-2 in the absence of retinal and degradation resistance in certain mutants. Biol. Chem. 2013, 394, 271–280. [Google Scholar] [CrossRef] [PubMed]
Mutations | Forward | Reverse |
---|---|---|
YFP::CfRhoPDE2 del (28 AA-deletion) | GACCAAGTGAAGCTGG AAAAGCAGCT | GCTTCACTTGGTCGTTGAA CTCTTTCT |
YFP::CfRhoPDE3 mutant (441-LRNVG-445 to 441-CHDCD-445) | GATTGTGACCACTCTGCA CTGACCAAC | GTCACAATCGTGACACA GAGTAGCTAACATC |
YFP::AsRhoPDE N296K | CACCAAAGTGTCACTG GTGCACACA | CACTTTGGTGAAGTATTCCA GCAGGCA |
YFP::CpRhoPDE1 mutant (436-LRNVG-440 to 436-CHDCD-440) | GATTGTGACCACGCTGGCCT GACCAAC | GTCACAATCGTGACACAGAGCGG CCAGAGCAAG |
YFP::SrRhoPDE L623F | CCGTTTCCAAAAAGAGTTC AACAACCAG | CTCTTTTTGGAAACGGGCG CTCCAA |
YFP::SrRhoPDE E657Q | AAGGGCCAGATCGGCTTC ATTAACT | GCCGATCTGGCCCTTG GCCAGA |
RhoPDE Homologs | Identity | Similarity | cGMP/cAMP Hydrolysis | Light Regulation | Sequence Information |
---|---|---|---|---|---|
SrRhoPDE | 100% | 100% | Both, cGMP specific | Yes, L/D: 2–4 for both cGMP and cAMP [15] | as the reference sequence for other RhoPDE homologs |
CfRhoPDE1 | 63% | 81% | Both, cGMP specific | Yes, L/D: 3 for cGMP | |
CfRhoPDE2 | 37% | 57% | No detectable activity | No | additional sequences in the PDE domain in comparison to others |
CfRhoPDE3 | 34% | 55% | No detectable activity | No | conserved amino acid in the PDE domain is missing |
CfRhoPDE4 | 46% | 64% | Both, cGMP specific | Yes, L/D: 1.4 for cGMP | |
MrRhoPDE | 79% | 91% | Both, cGMP specific | Yes, L/D: 1.7 for cGMP | |
AsRhoPDE | 29% | 49% | No detectable activity | No, (no expression) | missing the conserved lysine for ATR binding |
CpRhoPDE1 | 35% | 56% | No detectable activity | No | conserved amino acid in the PDE domain is missing |
CpRhoPDE2 | 51% | 71% | No detectable activity | No |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Y.; Yang, S.; Nagel, G.; Gao, S. Characterization and Modification of Light-Sensitive Phosphodiesterases from Choanoflagellates. Biomolecules 2022, 12, 88. https://doi.org/10.3390/biom12010088
Tian Y, Yang S, Nagel G, Gao S. Characterization and Modification of Light-Sensitive Phosphodiesterases from Choanoflagellates. Biomolecules. 2022; 12(1):88. https://doi.org/10.3390/biom12010088
Chicago/Turabian StyleTian, Yuehui, Shang Yang, Georg Nagel, and Shiqiang Gao. 2022. "Characterization and Modification of Light-Sensitive Phosphodiesterases from Choanoflagellates" Biomolecules 12, no. 1: 88. https://doi.org/10.3390/biom12010088
APA StyleTian, Y., Yang, S., Nagel, G., & Gao, S. (2022). Characterization and Modification of Light-Sensitive Phosphodiesterases from Choanoflagellates. Biomolecules, 12(1), 88. https://doi.org/10.3390/biom12010088