An Antagonistic Peptide of Gpr1 Ameliorates LPS-Induced Depression through the Hypothalamic-Pituitary-Ovarian Axis
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drugs
2.3. LPS Challenge
2.4. Drug Treatments and Experimental Design
2.5. Behavioral Tests
2.5.1. Open Field Test (OFT)
2.5.2. Forced Swim Test (FST)
2.5.3. Sucrose Preference Test (SPT)
2.6. Biochemical Analysis
2.6.1. Blood Sampling and Tissue Extraction
2.6.2. Brain-Derived Neurotrophic Factor (BDNF) and Corticosterone (CORT) Level Measurements by Enzyme-Linked Immunosorbent Assays (ELISAs)
2.6.3. Immunohistochemistry and Immunofluorescence
2.6.4. RNA Analysis by Quantitative PCR
2.6.5. Proinflammatory Cytokines and Hormone Measurements by RIA
2.6.6. Data and Statistical Analyses
3. Results
3.1. Expression of GPR1, GnRH, and CRF in Mouse Hypothalamus
3.2. Effect of GPR1 on Body Weight of LPS-Induced Depression Mice
3.3. Effects of GPR1 on Depression-Like Behaviour
3.4. Effect of G5 on Inflammatory Factors (TNF-α, IL-6, IL-1β)
3.5. Effect of G5 on Level of CORT, BDNF, Progesterone, Estrogen, and Testosterone in Serum in LPS-Induced Depression Mouse Level
3.6. Effect of G5 on the Expression of the Star, cyp21a, Aromatase, and 17β-HSD in LPS-Induced Depression Mouse Ovary
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wal, J.M.V.D.; Bergfeld, I.O.; Lok, A.; Mantione, M.; Figee, M.; Notten, P.; Beute, G.; Horst, F.; Munckhof, P.V.D.; Schuurman, P.R.; et al. Long-term deep brain stimulation of the ventral anterior limb of the internal capsule for treatment-resistant depression. J. Neurol. Neurosurg. Psychiatry 2019, 91, 189–195. [Google Scholar]
- Greenberg, P.E.; Fournier, A.A.; Sisitsky, T.; Pike, C.T.; Kessler, R.C. The economic burden of adults with major depressive disorder in the United States (2005 and 2010). J. Clin. Psychiatry 2015, 76, 155–162. [Google Scholar] [CrossRef] [PubMed]
- Darj, E.; Axelsson, O.; Carlström, K.; Nilsson, S.; von Schoultz, B. Liver metabolism during treatment with estradiol and natural progesterone. Gynecol. Endocrinol. 1993, 7, 111–114. [Google Scholar]
- Walker, C.D.; Perrin, M.; Vale, W.; Rivier, C. Ontogeny of the stress response in the rat: Role of the pituitary and the hypothalamus. Endocrinology 1986, 118, 1445–1451. [Google Scholar] [CrossRef] [PubMed]
- Bale, T.L.; Epperson, C.N. Sex differences and stress across the lifespan. Nat. Neurosci. 2015, 18, 1413–1420. [Google Scholar] [CrossRef] [PubMed]
- Cooney, L.G.; Dokras, A. Depression and Anxiety in Polycystic Ovary Syndrome: Etiology and Treatment. Curr. Psychiatry Rep. 2017, 19, 83. [Google Scholar] [CrossRef] [PubMed]
- Cooney, L.G.; Lee, I.; Sammel, M.D.; Dokras, A. High prevalence of moderate and severe depressive and anxiety symptoms in polycystic ovary syndrome: A systematic review and meta-analysis. Hum. Reprod. 2017, 32, 1075–1091. [Google Scholar] [CrossRef] [PubMed]
- Dokras, A. Mood and anxiety disorders in women with PCOS. Steroids 2012, 77, 338–341. [Google Scholar] [CrossRef] [PubMed]
- Klonoff-Cohen, H.; Chu, E.; Natarajan, L.; Sieber, W. A prospective study of stress among women undergoing in vitro fertilization or gamete intrafallopian transfer. Fertil. Steril. 2001, 76, 675–687. [Google Scholar] [CrossRef]
- An, Y.; Sun, Z.; Li, L.; Zhang, Y.; Ji, H. Relationship between psychological stress and reproductive outcome in women undergoing in vitro fertilization treatment: Psychological and neurohormonal assessment. J. Assist. Reprod. Genet. 2013, 30, 35–41. [Google Scholar] [CrossRef]
- Terzioglu, F.; Turk, R.; Yucel, C.; Dilbaz, S.; Cinar, O.; Karahalil, B. The effect of anxiety and depression scores of couples who underwent assisted reproductive techniques on the pregnancy outcomes. Afr. Health Sci. 2016, 16, 441–450. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Ouyang, N.; Li, R.; Tuo, P.; Mai, M.; Wang, W. The effects of anxiety and depression on in vitro fertilisation outcomes of infertile Chinese women. Psychol. Health Med. 2017, 22, 37–43. [Google Scholar] [CrossRef]
- Rooney, K.L.; Domar, A.D. The relationship between stress and infertility. Dialogues Clin. Neurosci. 2018, 20, 41–47. [Google Scholar] [PubMed]
- Bondue, B.; Wittamer, V.; Parmentier, M. Chemerin and its receptors in leukocyte trafficking, inflammation and metabolism. Cytokine Growth Factor Rev. 2011, 22, 331–338. [Google Scholar] [CrossRef] [PubMed]
- Marchese, A.; Docherty, J.M.; Nguyen, T.; Heiber, M.; Cheng, R.; Heng, H.H.; Tsui, L.C.; Shi, X.; George, S.R.; O’Dowd, B.F. Cloning of human genes encoding novel G protein-coupled receptors. Genomics 1994, 23, 609. [Google Scholar] [CrossRef]
- Nobuaki, S.; Soda, Y.; Kanbe, K.; Liu, H.Y.; Jinno, A.; Kitamura, T.; Hoshino, H. An Orphan G Protein-Coupled Receptor, GPR1, Acts as a Coreceptor To Allow Replication of Human Immunodeficiency Virus Types 1 and 2 in Brain-Derived Cells. J. Virol. 1999, 73, 5231–5239. [Google Scholar]
- Yang, Y.; Ren, L.R.; Sun, L.F.; Huang, C.; Xiao, T.X.; Wang, B.B.; Chen, J.; Zabel, B.A.; Ren, P.; Zhang, J.V. The role of GPR1 signaling in mice corpus luteum. J. Endocrinol. 2016, 230, 55–65. [Google Scholar] [CrossRef][Green Version]
- Huang, C.; Dai, X.Y.; Cai, J.X.; Chen, J.; Zhang, J.V. A Screened GPR1 Peptide Exerts Antitumor Effects on Triple-Negative Breast Cancer. Mol. Ther. Oncolytics 2020, 18, 602–612. [Google Scholar] [CrossRef]
- Kang, A.; Hao, H.; Zheng, X.; Liang, Y.; Xie, Y.; Xie, T.; Dai, C.; Zhao, Q.; Wu, X.; Xie, L.; et al. Peripheral anti-inflammatory effects explain the ginsenosides paradox between poor brain distribution and anti-depression efficacy. J. Neuroinflamm. 2011, 8, 100. [Google Scholar] [CrossRef]
- Jing, W.; Jia, Y.; Li, G.; Wang, B.; Zhou, T.; Zhu, L.; Chen, T.; Chen, Y. The Dopamine Receptor D3 Regulates Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Int. J. Neuropsychopharmacol. 2018, 21, 448–460. [Google Scholar]
- Borsini, F.; Lecci, A.; Sessarego, A.; Frassine, R.; Meli, A. Discovery of antidepressant activity by forced swimming test may depend on pre-exposure of rats to a stressful situation. Psychopharmacology 1989, 97, 183–188. [Google Scholar] [CrossRef]
- Henry, C.J.; Huang, Y.; Wynne, A.; Hanke, M.; Himler, J.; Bailey, M.T.; Sheridan, J.F.; Godbout, J.P. Minocycline attenuates lipopolysaccharide (LPS)-induced neuroinflammation, sickness behavior, and anhedonia. J. Neuroinflamm. 2008, 5, 15. [Google Scholar] [CrossRef] [PubMed]
- Sulakhiya, K.; Kumar, P.; Jangra, A.; Dwivedi, S.; Hazarika, N.K.; Baruah, C.C.; Lahkar, M. Honokiol abrogates lipopolysaccharide-induced depressive like behavior by impeding neuroinflammation and oxido-nitrosative stress in mice. Eur. J. Pharmacol. 2014, 744, 124–131. [Google Scholar] [CrossRef]
- Regard, J.B.; Sato, I.T.; Coughlin, S.R. Anatomical profiling of G protein-coupled receptor expression. Cell 2008, 135, 561–571. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, Y.; Pan, F. The effects of EGb761 on lipopolysaccharide-induced depressive-like behaviour in C57BL/6J mice. Cent. Eur J. Immunol 2015, 40, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Pothion, S.; Bizot, J.C.; Trovero, F.; Belzung, C. Strain differences in sucrose preference and in the consequences of unpredictable chronic mild stress. Behav. Brain Res. 2004, 155, 135–146. [Google Scholar] [CrossRef] [PubMed]
- Willner, P.; Towell, A.; Sampson, D.; Sophokleous, S.; Muscat, R. Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology 1987, 93, 358–364. [Google Scholar] [CrossRef]
- Mcarthur, R.; Borsini, F. Animal models of depression in drug discovery: A historical perspective. Pharmacol. Biochem. Behav. 2006, 84, 436–452. [Google Scholar] [CrossRef] [PubMed]
- Slavich, G.M.; Irwin, M.R. From stress to inflammation and major depressive disorder: A social signal transduction theory of depression. Psychol. Bull. 2014, 140, 774–815. [Google Scholar] [CrossRef]
- Tonelli, L.H.; Holmes, A.; Postolache, T.T. Intranasal immune challenge induces sex-dependent depressive-like behavior and cytokine expression in the brain. Neuropsychopharmacology 2008, 33, 1038–1048. [Google Scholar] [CrossRef]
- Xie, W.; Cai, L.; Yu, Y.; Gao, L.; Xiao, L.; He, Q.; Ren, Z.; Liu, Y. Activation of brain indoleamine 2,3-dioxygenase contributes to epilepsy-associated depressive-like behavior in rats with chronic temporal lobe epilepsy. J. Neuroinflamm. 2014, 11, 41. [Google Scholar] [CrossRef]
- Li, C.; Mao, S.; Wang, Y.; Sun, H. Effects of Combination Therapy of Dexamethasone and Fluoxetine on Levels of Interleukin-1 beta and Interleukin-6 in a Rat Model of Asthma with Depressive-like Behaviors. HealthMED 2012, 6, 1998–2003. [Google Scholar]
- Libman-Sokołowska, M.; Drozdowicz, E.; Nasierowski, T. BDNF as a biomarker in the course and treatment of schizophrenia. Psychiatr. Pol. 2015, 49, 1149–1158. [Google Scholar] [CrossRef]
- De Kloet, E.R.; Otte, C.; Kumsta, R.; Kok, L.; Hillegers, M.H.; Hasselmann, H.; Kliegel, D.; Joëls, M. Stress and Depression: A Crucial Role of the Mineralocorticoid Receptor. J. Neuroendocrinol. 2016, 28. [Google Scholar] [CrossRef] [PubMed]
- Björkholm, C.; Monteggia, L.M. BDNF—A key transducer of antidepressant effects. Neuropharmacology 2016, 102, 72–79. [Google Scholar] [CrossRef]
- Zhang, J.C.; Yao, W.; Hashimoto, K. Brain-derived Neurotrophic Factor (BDNF)-TrkB Signaling in Inflammation-related Depression and Potential Therapeutic Targets. Curr. Neuropharmacol. 2016, 14, 721–731. [Google Scholar] [CrossRef]
- Ma, M.; Ren, Q.; Yang, C.; Zhang, J.C.; Yao, W.; Dong, C.; Ohgi, Y.; Futamura, T.; Hashimoto, K. Antidepressant effects of combination of brexpiprazole and fluoxetine on depression-like behavior and dendritic changes in mice after inflammation. Psychopharmacology 2017, 234, 525–533. [Google Scholar] [CrossRef] [PubMed]
- Dwivedi, Y.; Rizavi, H.S.; Conley, R.R.; Roberts, R.C.; Tamminga, C.A.; Pandey, G.N. Altered gene expression of brain-derived neurotrophic factor and receptor tyrosine kinase B in postmortem brain of suicide subjects. Arch. Gen. Psychiatry 2003, 60, 804–815. [Google Scholar] [CrossRef] [PubMed]
- Heberden, C. Sex steroids and neurogenesis. Biochem. Pharmacol. 2017, 141, 56–62. [Google Scholar] [CrossRef]
- Zhang, Z.; Hong, J.; Zhang, S.; Zhang, T.; Sha, S.; Yang, R.; Qian, Y.; Chen, L. Postpartum estrogen withdrawal impairs hippocampal neurogenesis and causes depression- and anxiety-like behaviors in mice. Psychoneuroendocrinology 2016, 66, 138–149. [Google Scholar] [CrossRef]
- Liu, Y.X.; Hsueh, A.J. Synergism between granulosa and theca-interstitial cells in estrogen biosynthesis by gonadotropin-treated rat ovaries: Studies on the two-cell, two-gonadotropin hypothesis using steroid antisera. Biol. Reprod. 1986, 35, 27–36. [Google Scholar] [CrossRef] [PubMed]






| Gene | Sequences (5′–3′) | |
|---|---|---|
| β-Actin | Forward | GGAAATCGTGCGTGACATTA |
| Reverse | AGGAAGGAAGGCTGGAAGAG | |
| Star | Forward | CTGCTAGACCAGCCCATGGAC |
| Reverse | TGATTTCCTTGACATTTGGGTTCC | |
| 17β-HSD | Forward | AGGACCTGGATTCAGTTCCAAGC |
| Reverse | CTAGGTGTTTGAGAAAGTCTG | |
| Aromatase | Forward | GCAATCCTGAAGGAGATCCA |
| Reverse | GCCGTCAATTACGTCATCCT | |
| Cyp21a1 | Forward | AGGAATTCTCCTTCCTCACTTGT |
| Reverse | TCTGTACCAACGTGCTGTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, R.; Ma, C.; Xiong, Y.; Zhao, H.; Yang, Y.; Xue, L.; Wang, B.; Xiao, T.; Chen, J.; Lei, X.; et al. An Antagonistic Peptide of Gpr1 Ameliorates LPS-Induced Depression through the Hypothalamic-Pituitary-Ovarian Axis. Biomolecules 2021, 11, 857. https://doi.org/10.3390/biom11060857
Li R, Ma C, Xiong Y, Zhao H, Yang Y, Xue L, Wang B, Xiao T, Chen J, Lei X, et al. An Antagonistic Peptide of Gpr1 Ameliorates LPS-Induced Depression through the Hypothalamic-Pituitary-Ovarian Axis. Biomolecules. 2021; 11(6):857. https://doi.org/10.3390/biom11060857
Chicago/Turabian StyleLi, Rongrong, Chiyuan Ma, Yue Xiong, Huashan Zhao, Yali Yang, Li Xue, Baobei Wang, Tianxia Xiao, Jie Chen, Xiaohua Lei, and et al. 2021. "An Antagonistic Peptide of Gpr1 Ameliorates LPS-Induced Depression through the Hypothalamic-Pituitary-Ovarian Axis" Biomolecules 11, no. 6: 857. https://doi.org/10.3390/biom11060857
APA StyleLi, R., Ma, C., Xiong, Y., Zhao, H., Yang, Y., Xue, L., Wang, B., Xiao, T., Chen, J., Lei, X., Ma, B., & Zhang, J. (2021). An Antagonistic Peptide of Gpr1 Ameliorates LPS-Induced Depression through the Hypothalamic-Pituitary-Ovarian Axis. Biomolecules, 11(6), 857. https://doi.org/10.3390/biom11060857

