Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Preparation of Total Cellular RNA, cDNA Synthesis and Quantitative Real-Time Polymerase Chain Reaction
2.3. Western Blot Analysis
2.4. siRNA-Mediated Knockdown
2.5. Confocal Microscopy
2.6. Construction of gRNA Targeting Vectors and Identification of Genome-Edited Cells
2.7. Oligonucleotides Primers
| pMDgRNAF: TTTCTTGGCTTTATATATC TTGTGGAAAGGACGAAACACCGACAG ATTATGTCATCGCAA | pMD gRNAR: GACTAGCCTTATTTTAA CTTGCTATTTCTAGCTCTAAAACTTG CGATGACATAATCTGGA |
| Col3a1Alt-RF: GGAAGAGGTTTATACTG CCAAGA | Col3a1Alt-RR: ACCCAATCTCCTGCTTT CTG |
| Col3a1F: CTGTAACATGGAAACTGGG GAAA | Col3a1R: CCATAGCTGAACTGAAAA CCACC |
2.8. Statistical Analysis
3. Results
3.1. Col3a1 KD Suppresses 3T3-L1 Cell Differentiation
3.2. Col3a1−/− Genome-Edited 3T3-L1 Cells
3.3. Inactivation of Col3a1 Abolishes 3T3-L1 Cell Adipogenesis
3.4. Col3a1 Cells Have Reduced Actin Stress Fibres
3.5. Col3a1−/− 3T3-L1 Cells Show Reduced Cellular Adhesion
3.6. Col3a1−/− 3T3-L1 Cells Show Changes in Extracellular Matrix Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Al Hasan, M.; Roy, P.; Dolan, S.; Martin, P.E.; Patterson, S.; Bartholomew, C. Adhesion G-protein coupled receptor 56 is required for 3T3-L1 adipogenesis. J. Cell. Physiol. 2019, 235, 1601–1614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, R.; Jeong, S.-J.; Jin, Z.; Strokes, N.; Li, S.; Piao, X. G protein-coupled receptor 56 and collagen III, a receptor-ligand pair, regulates cortical development and lamination. Proc. Natl. Acad. Sci. USA 2011, 108, 12925–12930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duner, P.; Al-Amily, I.M.; Soni, A.; Asplund, O.; Safi, F.; Storm, P.; Groop, L.; Amisten, S.; Salehi, A. Adhesion G Protein-Coupled Receptor G1 (ADGRG1/GPR56) and Pancreatic beta-Cell Function. J. Clin. Endocrinol. Metab. 2016, 101, 4637–4645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, K.; Tordjman, J.; Clément, K.; Scherer, P.E. Fibrosis and adipose tissue dysfunction. Cell Metab. 2013, 18, 470–477. [Google Scholar] [CrossRef] [Scilit]
- Ricard-Blum, S. The Collagen Family. Cold Spring Harb. Perspect. Biol. 2011, 3, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Mor-Yossef Moldovan, L.; Lustig, M.; Naftaly, A.; Mardamshina, M.; Geiger, T.; Gefen, A.; Benayahu, D. Cell shape alteration during adipogenesis is associated with coordinated matrix cues. J. Cell. Physiol. 2019, 234, 3850–3863. [Google Scholar] [CrossRef] [Scilit]
- Weiner, F.R.; Shah, A.; Smith, P.J.; Rubin, C.S.; Zern, M.A. Regulation of collagen gene expression in 3T3-L1 cells. Effects of adipocyte differentiation and tumor necrosis factor alpha. Biochemistry 1989, 28, 4094–4099. [Google Scholar] [CrossRef] [Scilit]
- Ibrahimi, A.; Bonino, F.; Bardon, S.; Ailhaud, G.; Dani, C. Essential role of collagens for terminal differentiation of preadipocytes. Biochem. Biophys. Res. Commun. 1992, 187, 1314–1322. [Google Scholar] [CrossRef] [Scilit]
- Cai, H.; Li, M.; Sun, X.; Plath, M.; Li, C.; Lan, X.; Lei, C.; Huang, Y.; Bai, Y.; Qi, X.; et al. Global transcriptome analysis during adipogenic differentiation and involvement of transthyretin gene in adipogenesis in cattle. Front. Genet. 2018, 9, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Ojima, K.; Oe, M.; Nakajima, I.; Muroya, S.; Nishimura, T. Dynamics of protein secretion during adipocyte differentiation. FEBS Open Bio 2016, 6, 816–826. [Google Scholar] [CrossRef] [Scilit]
- Mori, S.; Kiuchi, S.; Ouchi, A.; Hase, T.; Murase, T. Characteristic expression of extracellular matrix in subcutaneous adipose tissue development and adipogenesis; Comparison with visceral adipose tissue. Int. J. Biol. Sci. 2014, 10, 825–833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janeczko, R.A.; Ramirez, F. Nucleotide and amino acid sequences of the entire human alpha 1 (III) collagen. Nucleic Acids Res. 1989, 17, 6742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Wu, H.; Byrne, M.; Krane, S.; Jaenisch, R. Type III collagen is crucial for collagen I fibrillogenesis and for normal cardiovascular development. Proc. Natl. Acad. Sci. USA 1997, 94, 1852–1856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandervore, L.; Stouffs, K.; Tanyalçin, I.; Vanderhasselt, T.; Roelens, F.; Holder-Espinasse, M.; Jørgensen, A.; Pepin, M.G.; Petit, F.; Van Kien, P.K.; et al. Bi-allelic variants in COL3A1 encoding the ligand to GPR56 are associated with cobblestone-like cortical malformation, white matter changes and cerebellar cysts. J. Med. Genet. 2017, 54, 432–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, S.J.; Li, S.; Luo, R.; Strokes, N.; Piao, X. Loss of Col3a1, the gene for ehlers-danlos syndrome type IV, results in neocortical dyslamination. PLoS ONE 2012, 7, e29767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mariman, E.C.M.; Wang, P. Adipocyte extracellular matrix composition, dynamics and role in obesity. Cell. Mol. Life Sci. 2010, 67, 1277–1292. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; James, E.; Norville, J.E.; Church, G.M. RNA-Guided Human Genome Engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [Scilit]
- Gelse, K.; Pöschl, E.; Aigner, T. Collagens—Structure, function, and biosynthesis. Adv. Drug Deliv. Rev. 2003, 55, 1531–1546. [Google Scholar] [CrossRef] [Scilit]
- Iguchi, T.; Sakata, K.; Yoshizaki, K.; Tago, K.; Mizuno, N.; Itoh, H. Orphan G Protein-coupled Receptor GPR56 Regulates Neural Progenitor Cell Migration via a G 12/13 and Rho Pathway. J. Biol. Chem. 2008, 283, 14469–14478. [Google Scholar] [CrossRef] [Scilit]
- Leung, T.; Chen, X.Q.; Manser, E.; Lim, L. The p160 RhoA-binding kinase ROK alpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton. Mol. Cell. Biol. 1996, 16, 5313–5327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nobusue, H.; Onishi, N.; Shimizu, T.; Sugihara, E.; Oki, Y.; Sumikawa, Y.; Chiyoda, T.; Akashi, K.; Saya, H.; Kano, K. Regulation of MKL1 via actin cytoskeleton dynamics drives adipocyte differentiation. Nat. Commun. 2014, 5, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Titushkin, I.; Sun, S.; Paul, A.; Cho, M. Control of adipogenesis by ezrin, radixin and moesin-dependent biomechanics remodeling. J. Biomech. 2013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szabo, E.; Feng, T.; Dziak, E.; Opas, M. Cell adhesion and spreading affect adipogenesis from embryonic stem cells: The role of calreticulin. Stem Cells 2009, 27, 2092–2102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zoppi, N.; Gardella, R.; De Paepe, A.; Barlati, S.; Colombi, M. Human Fibroblasts with Mutations in COL5A1 and COL3A1 Genes Do Not Organize Collagens and Fibronectin in the Extracellular Matrix, Down-regulate α2β1 Integrin, and Recruit α vβ3 Instead of α5β1 Integrin. J. Biol. Chem. 2004, 279, 18157–18168. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Raynal, N.; Stathopoulos, S.; Myllyharju, J.; Farndale, R.W.; Leitinger, B. Collagen binding specificity of the discoidin domain receptors: Binding sites on collagens II and III and molecular determinants for collagen IV recognition by DDR1. Matrix Biol. 2011, 30, 16–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.K.; Xu, Y.; Xu, X.; Keene, D.R.; Gurusiddappa, S.; Liang, X.; Wary, K.K.; Höök, M. A novel binding site in collagen type III for integrins α1β1 and α2β1. J. Biol. Chem. 2005, 280, 32512–32520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ross, S.E.; Hemati, N.; Longo, K.A.; Bennett, C.N.; Lucas, P.C.; Erickson, R.L.; MacDougald, O.A. Inhibition of adipogenesis by Wnt signaling. Science 2000, 289, 950–953. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Huang, K.; Li, G.; Wang, P.; Liu, C.; Guo, C.; Sun, Z.; Pan, J. Ascorbic acid promotes 3T3-L1 cells adipogenesis by attenuating ERK signaling to upregulate the collagen VI. Nutr. Metab. 2017, 14, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Kamiya, S.; Kato, R.; Wakabayashi, M.; Tohyama, T.; Enami, I.; Ueki, M.; Yajima, H.; Ishii, T.; Nakamura, H.; Katayama, T.; et al. Fibronectin peptides derived from two distinct regions stimulate adipocyte differentiation by preventing fibronectin matrix assembly. Biochemistry 2002, 41, 3270–3277. [Google Scholar] [CrossRef] [Scilit]
- Lin, D.; Chun, T.-H.; Kang, L. Adipose extracellular matrix remodelling in obesity and insulin resistance. Biochem. Pharmacol. 2016, 119, 8–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Hata, A.; Kosugi, C.; Kataoka, N.; Funaki, M. The density of extracellular matrix proteins regulates inflammation and insulin signaling in adipocytes. FEBS Lett. 2010, 584, 4145–4150. [Google Scholar] [CrossRef] [Scilit] [PubMed]










Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al Hasan, M.; Martin, P.E.; Shu, X.; Patterson, S.; Bartholomew, C. Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes. Biomolecules 2021, 11, 156. https://doi.org/10.3390/biom11020156
Al Hasan M, Martin PE, Shu X, Patterson S, Bartholomew C. Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes. Biomolecules. 2021; 11(2):156. https://doi.org/10.3390/biom11020156
Chicago/Turabian StyleAl Hasan, Mohammad, Patricia E. Martin, Xinhua Shu, Steven Patterson, and Chris Bartholomew. 2021. "Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes" Biomolecules 11, no. 2: 156. https://doi.org/10.3390/biom11020156
APA StyleAl Hasan, M., Martin, P. E., Shu, X., Patterson, S., & Bartholomew, C. (2021). Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes. Biomolecules, 11(2), 156. https://doi.org/10.3390/biom11020156

