Treatment of Dystrophic mdx Mice with an ADAMTS-5 Specific Monoclonal Antibody Increases the Ex Vivo Strength of Isolated Fast Twitch Hindlimb Muscles
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval, Mouse Husbandry and Antibody Treatment
2.2. Ex Vivo EDL and Soleus Contractile Function Testing
2.3. Immunohistochemistry for ADAMTS-1, -5 and -15 and Versikine
2.4. Immunoblotting for Versikine—A Read out of Total ADAMTS Versicanase Activity
2.5. Histological Assessment of mdx EDL Muscle Morphology Following Adamts-5 mAb Treatment
2.6. Real Time Quantitative PCR (qPCR)
2.7. Statistical Analyses
3. Results
3.1. Increased ADAMTS-5 Immunoreactivity in Dystrophic mdx Compared to Wild Type Hindlimb Muscles
3.2. Effects of ADAMTS-5 Blockade on Post-natal Growth and Muscle Mass
3.3. ADAMTS-5 Blockade Does Not Reduce Versican Processing in Dystrophic EDL and Soleus Muscles
3.4. Contractile Properties of Isolated, Dystrophic EDL and Soleus Muscles Following ADAMTS-5 Blockade
3.5. Effects of ADAMTS-5 Blockade on EDL Muscle Structure
3.6. Effect of ADAMTS-5 Blockade on Markers Regenerative Myogenesis in EDL Muscles
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mercuri, E.; Muntoni, F. Muscular dystrophies. Lancet 2013, 381, 845–860. [Google Scholar] [CrossRef]
- Simonds, A.; Muntoni, F.; Heather, S.; Fielding, S. Impact of nasal ventilation on survival in hypercapnic Duchenne muscular dystrophy. Thorax 1998, 53, 949–952. [Google Scholar] [CrossRef]
- Wagner, K.R.; Lechtzin, N.; Judge, D.P. Current treatment of adult Duchenne muscular dystrophy. Biochimica et Biophysica Acta (BBA) - Mol. Basis Disease 2007, 1772, 229–237. [Google Scholar] [CrossRef]
- Emery, A.E.H. The muscular dystrophies. Lancet 2002, 359, 687–695. [Google Scholar] [CrossRef]
- Dadgar, S.; Wang, Z.; Johnston, H.; Kesari, A.; Nagaraju, K.; Chen, Y.W.; Hill, D.A.; Partridge, T.A.; Giri, M.; Freishtat, R.J.; et al. Asynchronous remodeling is a driver of failed regeneration in Duchenne muscular dystrophy. J. Cell. Biol. 2014, 207, 139–158. [Google Scholar] [CrossRef]
- Klingler, W.; Jurkat-Rott, K.; Lehmann-Horn, F.; Schleip, R. The role of fibrosis in Duchenne muscular dystrophy. Acta Myol. 2012, 31, 184–195. [Google Scholar]
- Bushby, K.; Finkel, R.; Birnkrant, D.J.; Case, L.E.; Clemens, P.R.; Cripe, L.; Kaul, A.; Kinnett, K.; McDonald, C.; Pandya, S.; et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. Lancet Neurol 2010, 9, 77–93. [Google Scholar] [CrossRef]
- Yamazaki, M.; Minota, S.; Sakurai, H.; Miyazono, K.; Yamada, A.; Kanazawa, I.; Kawai, M. Expression of transforming growth factor-beta 1 and its relation to endomysial fibrosis in progressive muscular dystrophy. American J. Pathol. 1994, 144, 221–226. [Google Scholar]
- Zhou, L.; Lu, H. Targeting fibrosis in Duchenne muscular dystrophy. J. Neuropathol Exp. Neurol. 2010, 69, 771–776. [Google Scholar] [CrossRef] [PubMed]
- Coles, C.A.; Gordon, L.; Hunt, L.C.; Webster, T.; Piers, A.T.; Kintakas, C.; Woodman, K.; Touslon, S.L.; Smythe, G.M.; White, J.D.; et al. Expression profiling in exercised mdx suggests a role for extracellular proteins in the dystrophic muscle immune response. Hum. Mol. Genetics 2020, 29, 353–368. [Google Scholar] [CrossRef]
- Calve, S.; Odelberg, S.J.; Simon, H.G. A transitional extracellular matrix instructs cell behavior during muscle regeneration. Dev. Biol. 2010, 344, 259–271. [Google Scholar] [CrossRef] [PubMed]
- Wight, T.N. Provisional matrix: A role for versican and hyaluronan. Matrix Biol. 2011, 60–61, 353–368. [Google Scholar] [CrossRef] [PubMed]
- McCulloch, D.R.; Nelson, C.M.; Dixon, L.J.; Silver, D.L.; Wylie, J.D.; Lindner, V.; Sasaki, T.; Cooley, M.A.; Argraves, W.S.; Apte, S.S. ADAMTS metalloproteases generate active versican fragments that regulate interdigital web regression. Developmental Cell 2009, 17, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Hope, C.; Foulcer, S.; Jagodinsky, J.; Chen, S.X.; Jensen, J.L.; Patel, S.; Leith, C.; Maroulakou, I.; Callander, N.; Miyamoto, S.; et al. Immunoregulatory roles of versican proteolysis in the myeloma microenvironment. Blood 2016, 128, 680–685. [Google Scholar] [CrossRef]
- Carthy, J.M.; Abraham, T.; Meredith, A.J.; Boroomand, S.; McManus, B.M. Versican localizes to the nucleus in proliferating mesenchymal cells. Cardiovasc. Pathol. 2015, 24, 368–374. [Google Scholar] [CrossRef]
- Negroni, E.; Henault, E.; Chevalier, F.; Gilbert-Sirieix, M.; Van Kuppevelt, T.H.; Papy-Garcia, D.; Uzan, G.; Albanese, P. Glycosaminoglycan modifications in Duchenne muscular dystrophy: specific remodeling of chondroitin sulfate/dermatan sulfate. J. Neuropathol. Exp. Neurol. 2014, 73, 789–797. [Google Scholar] [CrossRef]
- McRae, N.; Forgan, L.; McNeill, B.; Addinsall, A.; McCulloch, D.; Van der Poel, C.; Stupka, N. Glucocorticoids Improve Myogenic Differentiation In Vitro by Suppressing the Synthesis of Versican, a Transitional Matrix Protein Overexpressed in Dystrophic Skeletal Muscles. Int J. Mol. Sci. 2017, 18, 2629. [Google Scholar] [CrossRef]
- Chen, Y.W.; Zhao, P.; Borup, R.; Hoffman, E.P. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J. Cell. Biol. 2000, 151, 1321–1336. [Google Scholar] [CrossRef]
- Marotta, M.; Ruiz-Roig, C.; Sarria, Y.; Peiro, J.L.; Nunez, F.; Ceron, J.; Munell, F.; Roig-Quilis, M. Muscle genome-wide expression profiling during disease evolution in mdx mice. Physiol. Genomics 2009, 37, 119–132. [Google Scholar] [CrossRef]
- Coenen-Stass, A.M.; McClorey, G.; Manzano, R.; Betts, C.A.; Blain, A.; Saleh, A.F.; Gait, M.J.; Lochmuller, H.; Wood, M.J.; Roberts, T.C. Identification of novel, therapy-responsive protein biomarkers in a mouse model of Duchenne muscular dystrophy by aptamer-based serum proteomics. Sci. Reports 2015, 5, 17014. [Google Scholar] [CrossRef]
- Stupka, N.; Kintakas, C.; White, J.D.; Fraser, F.W.; Hanciu, M.; Aramaki-Hattori, N.; Martin, S.; Coles, C.; Collier, F.; Ward, A.C.; et al. Versican processing by a disintegrin-like and metalloproteinase domain with thrombospondin-1 repeats proteinases-5 and -15 facilitates myoblast fusion. J. Biol. Chem. 2013, 288, 1907–1917. [Google Scholar] [CrossRef] [PubMed]
- McCulloch, D.R.; Le Goff, C.; Bhatt, S.; Dixon, L.J.; Sandy, J.D.; Apte, S.S. Adamts5, the gene encoding a proteoglycan-degrading metalloprotease, is expressed by specific cell lineages during mouse embryonic development and in adult tissues. Gene Expression Patterns: GEP 2009, 9, 314–323. [Google Scholar] [CrossRef] [PubMed]
- Barthel, K.K.B.; Liu, X. A Transcriptional Enhancer from the Coding Region of ADAMTS5. PLoS ONE 2008, 3, e2184. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dancevic, C.M.; Fraser, F.W.; Smith, A.D.; Stupka, N.; Ward, A.C.; McCulloch, D.R. Biosynthesis and expression of a disintegrin-like and metalloproteinase domain with thrombospondin-1 repeats-15: a novel versican-cleaving proteoglycanase. J. Biol. Chem. 2013, 288, 37267–37276. [Google Scholar] [CrossRef]
- Pallafacchina, G.; Francois, S.; Regnault, B.; Czarny, B.; Dive, V.; Cumano, A.; Montarras, D.; Buckingham, M. An adult tissue-specific stem cell in its niche: a gene profiling analysis of in vivo quiescent and activated muscle satellite cells. Stem. Cell Res. 2010, 4, 77–91. [Google Scholar] [CrossRef]
- Velleman, S.G.; Sporer, K.R.B.; Ernst, C.W.; Reed, K.M.; Strasburg, G.M. Versican, matrix Gla protein, and death-associated protein expression affect muscle satellite cell proliferation and differentiation1. Poultry Sci. 2012, 91, 1964–1973. [Google Scholar] [CrossRef]
- Dancevic, M.C.; Gibert, Y.; Berger, J.; Smith, D.A.; Liongue, C.; Stupka, N.; Ward, C.A.; McCulloch, R.D. The ADAMTS5 Metzincin Regulates Zebrafish Somite Differentiation. Int J. Mol. Sci 2018, 19, E766. [Google Scholar] [CrossRef]
- McMahon, M.; Ye, S.; Izzard, L.; Dlugolenski, D.; Tripp, R.A.; Bean, A.G.; McCulloch, D.R.; Stambas, J. ADAMTS5 Is a Critical Regulator of Virus-Specific T Cell Immunity. PLoS Biology 2016, 14, e1002580. [Google Scholar] [CrossRef]
- Wight, T.N.; Frevert, C.W.; Debley, J.S.; Reeves, S.R.; Parks, W.C.; Ziegler, S.F. Interplay of extracellular matrix and leukocytes in lung inflammation. Cell Immunol. 2017, 312, 1–14. [Google Scholar] [CrossRef]
- Ashlin, T.G.; Kwan, A.P.; Ramji, D.P. Regulation of ADAMTS-1, -4 and -5 expression in human macrophages: differential regulation by key cytokines implicated in atherosclerosis and novel synergism between TL1A and IL-17. Cytokine 2013, 64, 234–242. [Google Scholar] [CrossRef]
- Du, H.; Shih, C.-H.; Wosczyna, M.N.; Mueller, A.A.; Cho, J.; Aggarwal, A.; Rando, T.A.; Feldman, B.J. Macrophage-released ADAMTS1 promotes muscle stem cell activation. Nature Comm. 2017, 8, 669. [Google Scholar] [CrossRef] [PubMed]
- Sharma, N.; Drobinski, P.; Kayed, A.; Chen, Z.; Kjelgaard-Petersen, C.F.; Gantzel, T.; Karsdal, M.A.; Michaelis, M.; Ladel, C.; Bay-Jensen, A.-C.; et al. Inflammation and joint destruction may be linked to the generation of cartilage metabolites of ADAMTS-5 through activation of toll-like receptors. Osteoarthritis Cartilage 2019. [Google Scholar] [CrossRef]
- Larkin, J.; Lohr, T.A.; Elefante, L.; Shearin, J.; Matico, R.; Su, J.L.; Xue, Y.; Liu, F.; Genell, C.; Miller, R.E.; et al. Translational development of an ADAMTS-5 antibody for osteoarthritis disease modification. Osteoarthritis Cartilage 2015, 23, 1254–1266. [Google Scholar] [CrossRef]
- Kosasih, H.J.; Last, K.; Rogerson, F.M.; Golub, S.B.; Gauci, S.J.; Russo, V.C.; Stanton, H.; Wilson, R.; Lamande, S.R.; Holden, P.; et al. A Disintegrin and Metalloproteinase with Thrombospondin Motifs-5 (ADAMTS-5) Forms Catalytically Active Oligomers. J. Biol. Chem. 2016, 291, 3197–3208. [Google Scholar] [CrossRef] [PubMed]
- Grounds, M.D.; Radley, H.G.; Lynch, G.S.; Nagaraju, K.; De Luca, A. Towards developing standard operating procedures for pre-clinical testing in the mdx mouse model of Duchenne muscular dystrophy. Neurobiol. Dis. 2008, 31, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.E.; Tran, P.B.; Ishihara, S.; Larkin, J.; Malfait, A.M. Therapeutic effects of an anti-ADAMTS-5 antibody on joint damage and mechanical allodynia in a murine model of osteoarthritis. Osteoarthritis Cartilage 2016, 24, 299–306. [Google Scholar] [CrossRef] [PubMed]
- Stupka, N.; Schertzer, J.D.; Bassel-Duby, R.; Olson, E.N.; Lynch, G.S. Calcineurin-A alpha activation enhances the structure and function of regenerating muscles after myotoxic injury. Am. J. Physiol. - Reg. Int. Comp. 2007, 293, R686–R694. [Google Scholar] [CrossRef][Green Version]
- Addinsall, A.B.; Wright, C.R.; Shaw, C.S.; McRae, N.L.; Forgan, L.G.; Weng, C.-H.; Conlan, X.A.; Francis, P.S.; Smith, Z.M.; Andrikopoulos, S.; et al. Deficiency of selenoprotein S, an endoplasmic reticulum resident oxidoreductase, impairs the contractile function of fast-twitch hindlimb muscles. Am. J. Physiol. - Reg. Int. Comp. 2018, 315, R380–R396. [Google Scholar] [CrossRef]
- Lynch, G.S.; Hinkle, R.T.; Chamberlain, J.S.; Brooks, S.V.; Faulkner, J.A. Force and power output of fast and slow skeletal muscles from mdx mice 6-28 months old. J. Physiol. 2001, 535, 591–600. [Google Scholar] [CrossRef]
- Emde, B.; Heinen, A.; Godecke, A.; Bottermann, K. Wheat germ agglutinin staining as a suitable method for detection and quantification of fibrosis in cardiac tissue after myocardial infarction. Eur. J. Histochem. 2014, 58, 2448. [Google Scholar] [CrossRef]
- Helliwell, T.R. Lectin binding and desmin staining during bupivicaine-induced necrosis and regeneration in rat skeletal muscle. J. Pathol. 1988, 155, 317–326. [Google Scholar] [CrossRef] [PubMed]
- Wright, C.R.; Allsopp, G.L.; Addinsall, A.B.; McRae, N.L.; Andrikopoulos, S.; Stupka, N. A Reduction in Selenoprotein S Amplifies the Inflammatory Profile of Fast-Twitch Skeletal Muscle in the mdx Dystrophic Mouse. Mediators Inflam. 2017, 2017, 12. [Google Scholar] [CrossRef] [PubMed]
- Mann, C.J.; Perdiguero, E.; Kharraz, Y.; Aguilar, S.; Pessina, P.; Serrano, A.L.; Munoz-Canoves, P. Aberrant repair and fibrosis development in skeletal muscle. Skelet Muscle 2011, 1, 21. [Google Scholar] [CrossRef] [PubMed]
- Nandadasa, S.; Foulcer, S.; Apte, S.S. The multiple, complex roles of versican and its proteolytic turnover by ADAMTS proteases during embryogenesis. Matrix Biol. 2014, 35, 34–41. [Google Scholar] [CrossRef]
- Hattori, N.; Carrino, D.A.; Lauer, M.E.; Vasanji, A.; Wylie, J.D.; Nelson, C.M.; Apte, S.S. Pericellular versican regulates the fibroblast-myofibroblast transition: a role for ADAMTS5 protease-mediated proteolysis. J. Biol. Chem. 2011, 286, 34298–34310. [Google Scholar] [CrossRef]
- Didangelos, A.; Mayr, U.; Monaco, C.; Mayr, M. Novel Role of ADAMTS-5 Protein in Proteoglycan Turnover and Lipoprotein Retention in Atherosclerosis. J. Biol. Chem. 2012, 287, 19341–19345. [Google Scholar] [CrossRef]
- Schiaffino, S.; Reggiani, C. Fiber Types in Mammalian Skeletal Muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef]
- Gorski, D.J.; Xiao, W.; Li, J.; Luo, W.; Lauer, M.; Kisiday, J.; Plaas, A.; Sandy, J. Deletion of ADAMTS5 does not affect aggrecan or versican degradation but promotes glucose uptake and proteoglycan synthesis in murine adipose derived stromal cells. Matrix Biol. 2015, 47, 66–84. [Google Scholar] [CrossRef]
- McGeachie, J.K.; Grounds, M.D.; Partridge, T.A.; Morgan, J.E. Age-related changes in replication of myogenic cells in mdx mice: Quantitative autoradiographic studies. J. Neurol. Sci. 1993, 119, 169–179. [Google Scholar] [CrossRef]
- Hardy, D.; Besnard, A.; Latil, M.; Jouvion, G.; Briand, D.; Thépenier, C.; Pascal, Q.; Guguin, A.; Gayraud-Morel, B.; Cavaillon, J.-M.; et al. Comparative Study of Injury Models for Studying Muscle Regeneration in Mice. PLoS ONE 2016, 11, e0147198. [Google Scholar] [CrossRef]
- Lee, A.S.J.; Anderson, J.E.; Joya, J.E.; Head, S.I.; Pather, N.; Kee, A.J.; Gunning, P.W.; Hardeman, E.C. Aged skeletal muscle retains the ability to fully regenerate functional architecture. Bioarchitecture 2013, 3, 25–37. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Zhu, J.; Westfield, L.A.; Tuley, E.A.; Anderson, P.J.; Sadler, J.E. Rearranging exosites in noncatalytic domains can redirect the substrate specificity of ADAMTS proteases. J. Biol. Chem. 2012, 287, 26944–26952. [Google Scholar] [CrossRef] [PubMed]
- Apte, S.S. A disintegrin-like and metalloprotease (reprolysin-type) with thrombospondin type 1 motif (ADAMTS) superfamily: functions and mechanisms. J. Biol. Chem. 2009, 284, 31493–31497. [Google Scholar] [CrossRef] [PubMed]
- Straface, G.; Aprahamian, T.; Flex, A.; Gaetani, E.; Biscetti, F.; Smith, R.C.; Pecorini, G.; Pola, E.; Angelini, F.; Stigliano, E.; et al. Sonic hedgehog regulates angiogenesis and myogenesis during post-natal skeletal muscle regeneration. J. Cell Mol. Med. 2009, 13, 2424–2435. [Google Scholar] [CrossRef] [PubMed]
- Piccioni, A.; Gaetani, E.; Palladino, M.; Gatto, I.; Smith, R.C.; Neri, V.; Marcantoni, M.; Giarretta, I.; Silver, M.; Straino, S.; et al. Sonic hedgehog gene therapy increases the ability of the dystrophic skeletal muscle to regenerate after injury. Gene Therapy 2014, 21, 413–421. [Google Scholar] [CrossRef]
- Stedman, H.H.; Sweeney, H.L.; Shrager, J.B.; Maguire, H.C.; Panettieri, R.A.; Petrof, B.; Narusawa, M.; Leferovich, J.M.; Sladky, J.T.; Kelly, A.M. The mdx mouse diaphragm reproduces the degenerative changes of Duchenne muscular dystrophy. Nature 1991, 352, 536–539. [Google Scholar] [CrossRef]
- Capogrosso, R.F.; Mantuano, P.; Cozzoli, A.; Sanarica, F.; Massari, A.M.; Conte, E.; Fonzino, A.; Giustino, A.; Rolland, J.-F.; Quaranta, A.; et al. Contractile efficiency of dystrophic mdx mouse muscle: in vivo and ex vivo assessment of adaptation to exercise of functional end points. J. Appl. Physiol. 2017, 122, 828–843. [Google Scholar] [CrossRef] [PubMed]
- Webster, C.; Silberstein, L.; Hays, A.P.; Blau, H.M. Fast muscle fibers are preferentially affected in Duchenne muscular dystrophy. Cell 1988, 52, 503–513. [Google Scholar] [CrossRef]
Accession Number | Name | Forward Sequence | Reverse Sequence |
---|---|---|---|
NM_001081249.1(V0) | V0 Vcan | GCA GGG ACC AAG TTC CA | ATC ACT CAA TCG ACC TGT CTT GT |
NM_019389.2(V1) | V1 Vcan | ACT GCT TTA AAC GTC GAT TGA GTG | TCA CTG CAA GGT TCC TCT |
NM_011577.2 | TGFβ1 | GCC TGA GTG GCT GTC TTT TGA | CAC AAG AGC AGT GAG CGC TGA A |
NM_011333.3 | MCP1 | CCCAATGAGTAGGCTGGAGA | TCTGGACCCATTCCTTCTTG |
NM_031189.2 | Myogenin | TCGGTCCCAACCCAGGA | GCAGATTGTGGGCGTCTGTA |
NM_008656.5 | Myf | CCC ACC TCC AAC TGC TCT G | CCG ATC CAC AAT GCT GGA C |
Units | IgG | ADAMTS-5 mAb | P Value | |
Muscle mass | mg | 10.29 ± 0.51 | *8.85 ± 0.51 | 0.037 |
Muscle mass : BW | mg:g | 0.49 ± 0.01 | 0.46 ± 0.02 | 0.187 |
Pt | mN | 39.3 ± 3.3 | 48.5 ± 5.9 | 0.176 |
sPt | mN/mm2 | 27.5 ± 1.6 | 35.5 ± 3.0 | 0.026 |
TPT | s | 0.2198 ± 0.0005 | 0.2217 ± 0.0018 | 0.282 |
½ RT | s | 0.0151 ± 0.0006 | 0.0236 ± 0.0056 | 0.132 |
Units | IgG | ADAMTS-5 mAb | P Value | |
Muscle mass | mg | 7.04 ± 0.46 | 6.71 ± 0.84 | 0.743 |
Muscle mass : BW | mg:g | 0.34 ± 0.02 | 0.34 ± 0.01 | 0.966 |
Pt | mN | 16.1 ± 1.7 | 13.5 ± 1.4 | 0.273 |
sPt | mN/mm2 | 25.4 ± 2.1 | 25.8 ± 2.6 | 0.9.02 |
TPT | s | 0.2661 ± 0.0303 | 0.2567 ± 0.0193 | 0.794 |
½ RT | s | 0.0559 ± 0.0088 | 0.0646 ± 0.0219 | 0.725 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Addinsall, A.B.; Forgan, L.G.; McRae, N.L.; Kelly, R.W.; McDonald, P.L.; McNeil, B.; McCulloch, D.R.; Stupka, N. Treatment of Dystrophic mdx Mice with an ADAMTS-5 Specific Monoclonal Antibody Increases the Ex Vivo Strength of Isolated Fast Twitch Hindlimb Muscles. Biomolecules 2020, 10, 416. https://doi.org/10.3390/biom10030416
Addinsall AB, Forgan LG, McRae NL, Kelly RW, McDonald PL, McNeil B, McCulloch DR, Stupka N. Treatment of Dystrophic mdx Mice with an ADAMTS-5 Specific Monoclonal Antibody Increases the Ex Vivo Strength of Isolated Fast Twitch Hindlimb Muscles. Biomolecules. 2020; 10(3):416. https://doi.org/10.3390/biom10030416
Chicago/Turabian StyleAddinsall, Alex B., Leonard G. Forgan, Natasha L. McRae, Rhys W. Kelly, Penny L. McDonald, Bryony McNeil, Daniel R. McCulloch, and Nicole Stupka. 2020. "Treatment of Dystrophic mdx Mice with an ADAMTS-5 Specific Monoclonal Antibody Increases the Ex Vivo Strength of Isolated Fast Twitch Hindlimb Muscles" Biomolecules 10, no. 3: 416. https://doi.org/10.3390/biom10030416
APA StyleAddinsall, A. B., Forgan, L. G., McRae, N. L., Kelly, R. W., McDonald, P. L., McNeil, B., McCulloch, D. R., & Stupka, N. (2020). Treatment of Dystrophic mdx Mice with an ADAMTS-5 Specific Monoclonal Antibody Increases the Ex Vivo Strength of Isolated Fast Twitch Hindlimb Muscles. Biomolecules, 10(3), 416. https://doi.org/10.3390/biom10030416