Evidence for a Cytokine-Sensitive Network of Iron-Associated Genes That Protects Pancreatic Islets Against Ferroptosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Islet Isolation
2.3. Microarray Data Collection and Analysis
2.4. Treatment with Islet Stressors
2.5. Quantitative PCR
2.6. Viral Transduction
2.7. Glucose-Stimulated Insulin Secretion
2.8. Intracellular Calcium
2.9. Cell Death Detection
2.10. Statistical Analysis
3. Results
3.1. Iron-Associated Genes in the Beta-Cell Are Highly Sensitive to Inflammation
3.2. Upregulation of Iron-Regulating Genes Is Specific to Cytokine Action
3.3. Overexpression of Steap4 Results in Upregulation of Lcn2 and Hamp1
3.4. Steap4 Overexpression Attenuates Cytokine-Mediated Islet Dysfunction
3.5. Cytokine Action and Ferroptosis
4. Discussion
4.1. A Network of Iron Genes: A Pathway to Destruction or Protection
4.2. A Model of Cytokine-Mediated Iron Redistribution
4.3. A Note on STEAP4 and Metabolic Function
4.4. Other Considerations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| IL-1B | Interleukin-1beta |
| IL-6 | Interleukin-6 |
| T2D | Type 2 Diabetes |
| ROS | Reactive Oxygen Species |
| LCN2 | Lipcalin-2 |
| HAMP | Hepcidin antimicrobial protein |
| STEAP | Six-transmembrane epithelial antigen of the prostate |
| DMT1 | Divalent metal transporter 1 |
| LDH | Lactate dehydrogenase |
| GFP | Green fluorescent protein |
References
- Ahlqvist, E.; van Zuydam, N.R.; Groop, L.C.; McCarthy, M.I. The Genetics of Diabetic Complications. Nat. Rev. Nephrol. 2015, 11, 277–287. [Google Scholar] [CrossRef] [Scilit]
- Taylor, S.I.; Yazdi, Z.S.; Beitelshees, A.L. Pharmacological Treatment of Hyperglycemia in Type 2 Diabetes. J. Clin. Investig. 2021, 131, 142243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cnop, M.; Welsh, N.; Jonas, J.-C.; Jörns, A.; Lenzen, S.; Eizirik, D.L. Mechanisms of Pancreatic Beta-Cell Death in Type 1 and Type 2 Diabetes: Many Differences, Few Similarities. Diabetes 2005, 54, S97–S107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marchetti, P.; Bugliani, M.; Lupi, R.; Marselli, L.; Masini, M.; Boggi, U.; Filipponi, F.; Weir, G.C.; Eizirik, D.L.; Cnop, M. The Endoplasmic Reticulum in Pancreatic Beta Cells of Type 2 Diabetes Patients. Diabetologia 2007, 50, 2486–2494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klein, S.; Gastaldelli, A.; Yki-Järvinen, H.; Scherer, P.E. Why Does Obesity Cause Diabetes? Cell Metab. 2022, 34, 11–20. [Google Scholar] [CrossRef] [Scilit]
- Nunemaker, C.S. Considerations for Defining Cytokine Dose, Duration, and Milieu That Are Appropriate for Modeling Chronic Low-Grade Inflammation in Type 2 Diabetes. J. Diabetes Res. 2016, 2016, 2846570. [Google Scholar] [CrossRef] [Scilit]
- Hotamisligil, G.S. Inflammation, Metaflammation and Immunometabolic Disorders. Nature 2017, 542, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Masters, S.L.; Dunne, A.; Subramanian, S.L.; Hull, R.L.; Tannahill, G.M.; Sharp, F.A.; Becker, C.; Franchi, L.; Yoshihara, E.; Chen, Z.; et al. Activation of the NLRP3 Inflammasome by Islet Amyloid Polypeptide Provides a Mechanism for Enhanced IL-1β in Type 2 Diabetes. Nat. Immunol. 2010, 11, 897–904. [Google Scholar] [CrossRef] [Scilit]
- Spranger, J.; Kroke, A.; Möhlig, M.; Hoffmann, K.; Bergmann, M.M.; Ristow, M.; Boeing, H.; Pfeiffer, A.F.H. Inflammatory Cytokines and the Risk to Develop Type 2 Diabetes: Results of the Prospective Population-Based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. Diabetes 2003, 52, 812–817. [Google Scholar] [CrossRef] [Scilit]
- O’Neill, C.M.; Lu, C.; Corbin, K.L.; Sharma, P.R.; Dula, S.B.; Carter, J.D.; Ramadan, J.W.; Xin, W.; Lee, J.K.; Nunemaker, C.S. Circulating Levels of IL-1B+IL-6 Cause ER Stress and Dysfunction in Islets from Prediabetic Male Mice. Endocrinology 2013, 154, 3077–3088. [Google Scholar] [CrossRef] [Scilit]
- Dula, S.B.; Jecmenica, M.; Wu, R.; Jahanshahi, P.; Verrilli, G.M.; Carter, J.D.; Brayman, K.L.; Nunemaker, C.S. Evidence That Low-Grade Systemic Inflammation Can Induce Islet Dysfunction as Measured by Impaired Calcium Handling. Cell Calcium 2010, 48, 133–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simcox, J.A.; McClain, D.A. Iron and Diabetes Risk. Cell Metab. 2013, 17, 329–341. [Google Scholar] [CrossRef] [Scilit]
- Hansen, J.B.; Moen, I.W.; Mandrup-Poulsen, T. Iron: The Hard Player in Diabetes Pathophysiology. Acta Physiol. 2014, 210, 717–732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrison, A.; Lorenzo, F.; McClain, D. Iron and the Pathophysiology of Diabetes. Annu. Rev. Physiol. 2022, 85, 339–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anderson, G.J.; Frazer, D.M. Current Understanding of Iron Homeostasis. Am. J. Clin. Nutr. 2017, 106, 1559S–1566S. [Google Scholar] [CrossRef] [Scilit]
- Paul, B.T.; Manz, D.H.; Torti, F.M.; Torti, S.V. Mitochondria and Iron: Current Questions. Expert Rev. Hematol. 2017, 10, 65–79. [Google Scholar] [CrossRef] [Scilit]
- Winterbourn, C.C. Toxicity of Iron and Hydrogen Peroxide: The Fenton Reaction. Toxicol. Lett. 1995, 82–83, 969–974. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Comish, P.B.; Tang, D.; Kang, R. Characteristics and Biomarkers of Ferroptosis. Front. Cell Dev. Biol. 2021, 9, 637162. [Google Scholar] [CrossRef] [Scilit]
- Dongiovanni, P.; Ruscica, M.; Rametta, R.; Recalcati, S.; Steffani, L.; Gatti, S.; Girelli, D.; Cairo, G.; Magni, P.; Fargion, S.; et al. Dietary Iron Overload Induces Visceral Adipose Tissue Insulin Resistance. Am. J. Pathol. 2013, 182, 2254–2263. [Google Scholar] [CrossRef] [Scilit]
- Hansen, J.B.; Tonnesen, M.F.; Madsen, A.N.; Hagedorn, P.H.; Friberg, J.; Grunnet, L.G.; Heller, R.S.; Nielsen, A.Ø.; Størling, J.; Baeyens, L.; et al. Divalent Metal Transporter 1 Regulates Iron-Mediated ROS and Pancreatic β Cell Fate in Response to Cytokines. Cell Metab. 2012, 16, 449–461. [Google Scholar] [CrossRef] [Scilit]
- Nicolas, G.; Chauvet, C.; Viatte, L.; Danan, J.L.; Bigard, X.; Devaux, I.; Beaumont, C.; Kahn, A.; Vaulont, S. The Gene Encoding the Iron Regulatory Peptide Hepcidin Is Regulated by Anemia, Hypoxia, and Inflammation. J. Clin. Investig. 2002, 110, 1037–1044. [Google Scholar] [CrossRef]
- Flo, T.H.; Smith, K.D.; Sato, S.; Rodriguez, D.J.; Holmes, M.A.; Strong, R.K.; Akira, S.; Aderem, A. Lipocalin 2 Mediates an Innate Immune Response to Bacterial Infection by Sequestrating Iron. Nature 2004, 432, 917–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.-Y.; Babitt, J.L. Hepcidin Regulation in the Anemia of Inflammation. Curr. Opin. Hematol. 2016, 23, 189–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nemeth, E.; Tuttle, M.S.; Powelson, J.; Vaughn, M.B.; Donovan, A.; Ward, D.M.; Ganz, T.; Kaplan, J. Hepcidin Regulates Cellular Iron Efflux by Binding to Ferroportin and Inducing Its Internalization. Science 2004, 306, 2090–2093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nemeth, E.; Ganz, T. The Role of Hepcidin in Iron Metabolism. Acta Haematol. 2009, 122, 78–86. [Google Scholar] [CrossRef] [Scilit]
- Goetz, D.H.; Holmes, M.A.; Borregaard, N.; Bluhm, M.E.; Raymond, K.N.; Strong, R.K. The Neutrophil Lipocalin NGAL Is a Bacteriostatic Agent That Interferes with Siderophore-Mediated Iron Acquisition. Mol. Cell 2002, 10, 1033–1043. [Google Scholar] [CrossRef] [Scilit]
- Ohgami, R.S.; Campagna, D.R.; McDonald, A.; Fleming, M.D. The Steap Proteins Are Metalloreductases. Blood 2006, 108, 1388–1394. [Google Scholar] [CrossRef] [Scilit]
- Moldes, M.; Lasnier, F.; Gauthereau, X.; Klein, C.; Pairault, J.; Fève, B.; Chambaut-Guérin, A.M. Tumor Necrosis Factor-Alpha-Induced Adipose-Related Protein (TIARP), a Cell-Surface Protein That Is Highly Induced by Tumor Necrosis Factor-Alpha and Adipose Conversion. J. Biol. Chem. 2001, 276, 33938–33946. [Google Scholar] [CrossRef] [Scilit]
- Fasshauer, M.; Kralisch, S.; Klier, M.; Lossner, U.; Bluher, M.; Chambaut-Guérin, A.-M.; Klein, J.; Paschke, R. Interleukin-6 Is a Positive Regulator of Tumor Necrosis Factor Alpha-Induced Adipose-Related Protein in 3T3-L1 Adipocytes. FEBS Lett. 2004, 560, 153–157. [Google Scholar] [CrossRef] [Scilit]
- Kralisch, S.; Sommer, G.; Weise, S.; Lipfert, J.; Lossner, U.; Kamprad, M.; Schröck, K.; Bluher, M.; Stumvoll, M.; Fasshauer, M. Interleukin-1beta Is a Positive Regulator of TIARP/STAMP2 Gene and Protein Expression in Adipocytes in Vitro. FEBS Lett. 2009, 583, 1196–1200. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.R.; Mackey, A.J.; Dejene, E.A.; Ramadan, J.W.; Langefeld, C.D.; Palmer, N.D.; Taylor, K.D.; Wagenknecht, L.E.; Watanabe, R.M.; Rich, S.S.; et al. An Islet-Targeted Genome-Wide Association Scan Identifies Novel Genes Implicated in Cytokine-Mediated Islet Stress in Type 2 Diabetes. Endocrinology 2015, 156, 3147–3156. [Google Scholar] [CrossRef] [Scilit]
- Scarl, R.T.; Lawrence, C.M.; Gordon, H.M.; Nunemaker, C.S. STEAP4: Its Emerging Role in Metabolism and Homeostasis of Cellular Iron and Copper. J. Endocrinol. 2017, 234, R123–R134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corbin, K.L.; West, H.L.; Brodsky, S.; Whitticar, N.B.; Koch, W.J.; Nunemaker, C.S. A Practical Guide to Rodent Islet Isolation and Assessment Revisited. Biol. Proced. Online 2021, 23, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallagher, P.G.; Bao, Y.; Serrano, S.M.T.; Kamiguti, A.S.; Theakston, R.D.G.; Fox, J.W. Use of Microarrays for Investigating the Subtoxic Effects of Snake Venoms: Insights into Venom-Induced Apoptosis in Human Umbilical Vein Endothelial Cells. Toxicon 2003, 41, 429–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.-M.; Mei, R.; Di, X.; Ryder, T.B.; Hubbell, E.; Dee, S.; Webster, T.A.; Harrington, C.A.; Ho, M.-H.; Baid, J.; et al. Analysis of High Density Expression Microarrays with Signed-Rank Call Algorithms. Bioinformatics 2002, 18, 1593–1599. [Google Scholar] [CrossRef] [Scilit]
- Qureshi, F.M.; Dejene, E.A.; Corbin, K.L.; Nunemaker, C.S. Stress-Induced Dissociations between Intracellular Calcium Signaling and Insulin Secretion in Pancreatic Islets. Cell Calcium 2015, 57, 366–375. [Google Scholar] [CrossRef] [Scilit]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
- Gelin, L.; Li, J.; Corbin, K.L.; Jahan, I.; Nunemaker, C.S. Metformin Inhibits Mouse Islet Insulin Secretion and Alters Intracellular Calcium in a Concentration-Dependent and Duration-Dependent Manner near the Circulating Range. J. Diabetes Res. 2018, 2018, 9163052. [Google Scholar] [CrossRef] [Scilit]
- Whitticar, N.B.; Strahler, E.W.; Rajan, P.; Kaya, S.; Nunemaker, C.S. An Automated Perifusion System for Modifying Cell Culture Conditions over Time. Biol. Proced. Online 2016, 18, 19. [Google Scholar] [CrossRef] [Scilit]
- Sonay, A.Y.; Apfelbaum, E.; Larney, B.E.M.; Grimm, J. Phosphatidylserine Exposure and Plasma Membrane Perforation as Ferroptotic Signatures for in Vivo Imaging. npj Imaging 2025, 3, 48. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Li, M.; Deng, Y.; Hou, Y.; Hou, L.; Zhang, X.; Zheng, Z.; Guo, F.; Sun, K. The Roles of DMT1 in Inflammatory and Degenerative Diseases. Mol. Neurobiol. 2025, 62, 6317–6332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jimenez Jimenez, A.M.; Michalkova, H.; Krizkova, S.; Barreto de Melo Rego, M.J.; Adam, V.; Merlos Rodrigo, M.A. New Insights into the Role of Metallothioneins in Obesity and Diabetes. Int. J. Obes. 2025, 49, 1958–1972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gordon, H.M.; Majithia, N.; MacDonald, P.E.; Fox, J.E.M.; Sharma, P.R.; Byrne, F.L.; Hoehn, K.L.; Evans-Molina, C.; Langman, L.; Brayman, K.L.; et al. STEAP4 Expression in Human Islets Is Associated with Differences in Body Mass Index, Sex, HbA1c, and Inflammation. Endocrine 2017, 56, 528–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, S.; Seravalli, J.; Harrison-Findik, D. Inductively Coupled Mass Spectrometry Analysis of Biometals in Conditional Hamp1 and Hamp1 and Hamp2 Transgenic Mouse Models. Transgenic Res. 2015, 24, 765–773. [Google Scholar] [CrossRef] [Scilit]
- Krijt, J.; Cmejla, R.; Sýkora, V.; Vokurka, M.; Vyoral, D.; Necas, E. Different Expression Pattern of Hepcidin Genes in the Liver and Pancreas of C57BL/6N and DBA/2N Mice. J. Hepatol. 2004, 40, 891–896. [Google Scholar] [CrossRef]
- Stancill, J.S.; Kasmani, M.Y.; Khatun, A.; Cui, W.; Corbett, J.A. Cytokine and Nitric Oxide-Dependent Gene Regulation in Islet Endocrine and Nonendocrine Cells. Function 2022, 3, zqab063. [Google Scholar] [CrossRef] [Scilit]
- Ramadan, J.W.; Steiner, S.R.; O’Neill, C.M.; Nunemaker, C.S. The Central Role of Calcium in the Effects of Cytokines on Beta-Cell Function: Implications for Type 1 and Type 2 Diabetes. Cell Calcium 2011, 50, 481–490. [Google Scholar] [CrossRef] [Scilit]
- Gilon, P.; Shepherd, R.M.; Henquin, J.C. Oscillations of Secretion Driven by Oscillations of Cytoplasmic Ca2+ as Evidences in Single Pancreatic Islets. J. Biol. Chem. 1993, 268, 22265–22268. [Google Scholar] [CrossRef] [Scilit]
- Martin, F.; Soria, B. Glucoseminduced [Ca2+]i Oscillations in Single Human Pancreatic Islets. Cell Calcium 1996, 20, 409–414. [Google Scholar] [CrossRef] [Scilit]
- Henquin, J.C. Regulation of Insulin Secretion: A Matter of Phase Control and Amplitude Modulation. Diabetologia 2009, 52, 739–751. [Google Scholar] [CrossRef] [Scilit]
- Kalwat, M.A.; Cobb, M.H. Mechanisms of the Amplifying Pathway of Insulin Secretion in the β Cell. Pharmacol. Ther. 2017, 179, 17–30. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Fang, Z.-M.; Yi, X.; Wei, X.; Jiang, D.-S. The Interaction between Ferroptosis and Inflammatory Signaling Pathways. Cell Death Dis. 2023, 14, 205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slepchenko, K.G.; Chen, S.; Counts, G.P.; Corbin, K.L.; Colvin, R.A.; Nunemaker, C.S. Synchrotron Fluorescence Imaging of Individual Mouse Beta-Cells Reveals Changes in Zinc, Calcium, and Iron in a Model of Low-Grade Inflammation. Metallomics 2021, 13, mfab051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Li, H.; Jiang, X.; Shi, W.; Shen, Z.; Li, M. Hepcidin Is Directly Regulated by Insulin and Plays an Important Role in Iron Overload in Streptozotocin-Induced Diabetic Rats. Diabetes 2014, 63, 1506–1518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wellen, K.E.; Fucho, R.; Gregor, M.F.; Furuhashi, M.; Morgan, C.; Lindstad, T.; Vaillancourt, E.; Gorgun, C.Z.; Saatcioglu, F.; Hotamisligil, G.S. Coordinated Regulation of Nutrient and Inflammatory Responses by STAMP2 Is Essential for Metabolic Homeostasis. Cell 2007, 129, 537–548. [Google Scholar] [CrossRef] [Scilit]
- Cheng, R.; Qiu, J.; Zhou, X.-Y.; Chen, X.-H.; Zhu, C.; Qin, D.-N.; Wang, J.-W.; Ni, Y.-H.; Ji, C.-B.; Guo, X.-R. Knockdown of STEAP4 Inhibits Insulin-Stimulated Glucose Transport and GLUT4 Translocation via Attenuated Phosphorylation of Akt, Independent of the Effects of EEA1. Mol. Med. Rep. 2011, 4, 519–523. [Google Scholar] [CrossRef] [Scilit]
- Qin, D.; Zhu, J.-G.; Ji, C.; Chunmei-Shi; Kou, C.; Zhu, G.; Zhang, C.-M.; Wang, Y.-P.; Ni, Y.; Guo, X. Monoclonal Antibody to Six Transmembrane Epithelial Antigen of Prostate-4 Influences Insulin Sensitivity by Attenuating Phosphorylation of P13K (P85) and Akt: Possible Mitochondrial Mechanism. J. Bioenerg. Biomembr. 2011, 43, 247–255. [Google Scholar] [CrossRef] [Scilit]
- Yan, Q.-W.; Yang, Q.; Mody, N.; Graham, T.E.; Hsu, C.-H.; Xu, Z.; Houstis, N.E.; Kahn, B.B.; Rosen, E.D. The Adipokine Lipocalin 2 Is Regulated by Obesity and Promotes Insulin Resistance. Diabetes 2007, 56, 2533–2540. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Jiang, C.; Mei, G.; Zhao, Y.; Chen, L.; Liu, J.; Tang, Y.; Gao, C.; Yao, P. Quercetin Alleviates Ferroptosis of Pancreatic β Cells in Type 2 Diabetes. Nutrients 2020, 12, 2954. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Cao, F.; Yin, H.-L.; Huang, Z.-J.; Lin, Z.-T.; Mao, N.; Sun, B.; Wang, G. Ferroptosis: Past, Present and Future. Cell Death Dis. 2020, 11, 88. [Google Scholar] [CrossRef] [Scilit]
- MacDonald, M.J.; Cook, J.D.; Epstein, M.L.; Flowers, C.H. Large Amount of (Apo)Ferritin in the Pancreatic Insulin Cell and Its Stimulation by Glucose. FASEB J. 1994, 8, 777–781. [Google Scholar] [CrossRef] [Scilit]
- Daru, J.; Colman, K.; Stanworth, S.J.; De La Salle, B.; Wood, E.M.; Pasricha, S.-R. Serum Ferritin as an Indicator of Iron Status: What Do We Need to Know? Am. J. Clin. Nutr. 2017, 106, 1634S–1639S. [Google Scholar] [CrossRef] [Scilit]
- Wu, K.; Zhao, W.; Hou, Z.; Zhang, W.; Qin, L.; Qiu, J.; Wang, D.; Zhuang, L.; Xue, X.; Sun, D. Ferritinophagy: Multifaceted Roles and Potential Therapeutic Strategies in Liver Diseases. Front. Cell Dev. Biol. 2025, 13, 1551003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Wu, N.; Peng, M.; Oyang, L.; Jiang, X.; Peng, Q.; Zhou, Y.; He, Z.; Liao, Q. Ferritinophagy: Research Advance and Clinical Significance in Cancers. Cell Death Discov. 2023, 9, 463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marku, A.; Galli, A.; Marciani, P.; Dule, N.; Perego, C.; Castagna, M. Iron Metabolism in Pancreatic Beta-Cell Function and Dysfunction. Cells 2021, 10, 2841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, S.; Qiu, T.; Yao, X.; Wang, N.; Jiang, L.; Jia, X.; Tao, Y.; Wang, Z.; Pei, P.; Zhang, J.; et al. Arsenic Induces Pancreatic Dysfunction and Ferroptosis via Mitochondrial ROS-Autophagy-Lysosomal Pathway. J. Hazard. Mater. 2020, 384, 121390. [Google Scholar] [CrossRef] [Scilit]
- Song, X.; Xie, Y.; Kang, R.; Hou, W.; Sun, X.; Epperly, M.W.; Greenberger, J.S.; Tang, D. FANCD2 Protects against Bone Marrow Injury from Ferroptosis. Biochem. Biophys. Res. Commun. 2016, 480, 443–449. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, N.; Choudhary, B.S.; Shah, S.G.; Khapare, N.; Dwivedi, N.; Gaikwad, A.; Joshi, N.; Raichanna, J.; Basu, S.; Gurjar, M.; et al. Lipocalin 2 Expression Promotes Tumor Progression and Therapy Resistance by Inhibiting Ferroptosis in Colorectal Cancer. Int. J. Cancer 2021, 149, 1495–1511. [Google Scholar] [CrossRef] [Scilit]
- Michels, K.; Nemeth, E.; Ganz, T.; Mehrad, B. Hepcidin and Host Defense against Infectious Diseases. PLoS Pathog. 2015, 11, e1004998. [Google Scholar] [CrossRef] [Scilit]
- Galaris, D.; Barbouti, A.; Pantopoulos, K. Iron Homeostasis and Oxidative Stress: An Intimate Relationship. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2019, 1866, 118535. [Google Scholar] [CrossRef] [Scilit]
- Scarim, A.L.; Heitmeier, M.R.; Corbett, J.A. Heat Shock Inhibits Cytokine-Induced Nitric Oxide Synthase Expression by Rat and Human Islets. Endocrinology 1998, 139, 5050–5057. [Google Scholar] [CrossRef] [PubMed]
- Hughes, K.J.; Chambers, K.T.; Meares, G.P.; Corbett, J.A. Nitric Oxides Mediates a Shift from Early Necrosis to Late Apoptosis in Cytokine-Treated Beta-Cells That Is Associated with Irreversible DNA Damage. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E1187–E1196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spinas, G.A.; Mandrup-Poulsen, T.; Molvig, J.; Baek, L.; Bendtzen, K.; Dinarello, C.A.; Nerup, J. Low Concentrations of Interleukin-1 Stimulate and High Concentrations Inhibit Insulin Release from Isolated Rat Islets of Langerhans. Acta Endocrinol. 1986, 113, 551–558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arous, C.; Ferreira, P.G.; Dermitzakis, E.T.; Halban, P.A. Short Term Exposure of Beta Cells to Low Concentrations of Interleukin-1β Improves Insulin Secretion through Focal Adhesion and Actin Remodeling and Regulation of Gene Expression. J. Biol. Chem. 2015, 290, 6653–6669. [Google Scholar] [CrossRef] [Scilit]
- Corbett, J.A.; Sweetland, M.A.; Wang, J.L.; Lancaster, J.R., Jr.; McDaniel, M.L. Nitric Oxide Mediates Cytokine-Induced Inhibition of Insulin Secretion by Human Islets of Langerhans. Proc. Natl. Acad. Sci. USA 1993, 90, 1731–1735. [Google Scholar] [CrossRef] [Scilit]
- Ehses, J.A.; Boni-Schnetzler, M.; Faulenbach, M.; Donath, M.Y. Macrophages, Cytokines and Beta-Cell Death in Type 2 Diabetes. Biochem. Soc. Trans. 2008, 36, 340–342. [Google Scholar] [CrossRef] [Scilit]
- Dinarello, C.A.; Donath, M.Y.; Mandrup-Poulsen, T. Role of IL-1beta in Type 2 Diabetes. Curr. Opin. Endocrinol. Diabetes Obes. 2010, 17, 314–321. [Google Scholar] [CrossRef] [Scilit]
- Sétula, C.; Pensado-Evans, I.; Scelza-Figueredo, A.; Orellano, M.S.; Rodríguez-Valero, I.; Spinedi, E.; Mirmira, R.G.; Andreone, L.; Perone, M.J. IL-1β Priming Triggers an Adaptive Stress Response That Enhances Pancreatic β-Cell Resilience to Subsequent Cytotoxic Inflammatory Insult. Cell Death Dis. 2025, 16, 744. [Google Scholar] [CrossRef] [Scilit]
- Schröder, S.K.; Gasterich, N.; Weiskirchen, S.; Weiskirchen, R. Lipocalin 2 Receptors: Facts, Fictions, and Myths. Front. Immunol. 2023, 14, 1229885. [Google Scholar] [CrossRef] [Scilit]
- Moreno-Navarrete, J.M.; Ortega, F.; Serrano, M.; Perez-Perez, R.; Sabater, M.; Ricart, W.; Tinahones, F.; Peral, B.; Fernandez-Real, J.M. Decreased STAMP2 Expression in Association with Visceral Adipose Tissue Dysfunction. J. Clin. Endocrinol. Metab. 2011, 96, E1816–E1825. [Google Scholar] [CrossRef] [Scilit]
- Song, F.-Q.; Song, M.; Ma, W.-X.; Gao, Z.; Ti, Y.; Zhang, X.; Hu, B.-A.; Zhong, M.; Zhang, W.; Yu, Y. Overexpressing STAMP2 Attenuates Diabetic Renal Injuries via Upregulating Autophagy in Diabetic Rats. Biochem. Biophys. Res. Commun. 2021, 579, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Han, L.; Qin, R.-R.; Zhang, Y.-Y.; Wang, D.; Wang, Z.-H.; Tang, M.-X.; Zhang, Y.; Zhong, M.; Zhang, W. Overexpressing STAMP2 Attenuates Adipose Tissue Angiogenesis and Insulin Resistance in Diabetic ApoE(−/−) /LDLR(−/−) Mouse via a PPARγ/CD36 Pathway. J. Cell Mol. Med. 2017, 21, 3298–3308. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Han, L.; Wang, Z.; Ding, W.; Shang, Y.; Tang, M.; Li, W.; Zhang, Y.; Zhang, W.; Zhong, M. Overexpression of STAMP2 Suppresses Atherosclerosis and Stabilizes Plaques in Diabetic Mice. J. Cell Mol. Med. 2014, 18, 735–748. [Google Scholar] [CrossRef] [Scilit]
- Scarim, A.L.; Heitmeier, M.R.; Corbett, J.A. Irreversible Inhibition of Metabolic Function and Islet Destruction after a 36-Hour Exposure to Interleukin-1beta. Endocrinology 1997, 138, 5301–5307. [Google Scholar] [CrossRef]
- Hajmrle, C.; Smith, N.; Spigelman, A.F.; Dai, X.; Senior, L.; Bautista, A.; Ferdaoussi, M.; MacDonald, P.E. Interleukin-1 Signaling Contributes to Acute Islet Compensation. JCI Insight 2016, 1, e86055. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Steap4 | TGGTAGCTCTGGGATTTGCC | CCCAGCGCCAAGTAGGAATC |
| Hamp1 | CTGAGCAGCACCACCTATCTC | TGGCTCTAGGCTATGTTTTGC |
| Hamp2 | CTGAGCAGCACCACCTATCTC | GGCTCTAGGCTCTCTATTCTTCA |
| Lcn2 | CCAGGGCAGGTGGTTCGTTG | GCCCCTGACCAGGATGGAAG |
| Ferritin | CCATCAACCGCCAGATCAAC | GCCACATCATCTCGGTCAAA |
| Ferroportin | GCACTTTGCAGTGTCTGTGTTTCT | CTTATCCACCCAGTCACCAATGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Slepchenko, K.G.; Counts, G.P.; Sharma, P.R.; Chen, S.; Corbin, K.L.; Qureshi, F.M.; Colvin, R.A.; Lawrence, C.M.; Nunemaker, C.S. Evidence for a Cytokine-Sensitive Network of Iron-Associated Genes That Protects Pancreatic Islets Against Ferroptosis. Metabolites 2026, 16, 112. https://doi.org/10.3390/metabo16020112
Slepchenko KG, Counts GP, Sharma PR, Chen S, Corbin KL, Qureshi FM, Colvin RA, Lawrence CM, Nunemaker CS. Evidence for a Cytokine-Sensitive Network of Iron-Associated Genes That Protects Pancreatic Islets Against Ferroptosis. Metabolites. 2026; 16(2):112. https://doi.org/10.3390/metabo16020112
Chicago/Turabian StyleSlepchenko, Kira G., Grace P. Counts, Poonam R. Sharma, Si Chen, Kathryn L. Corbin, Farhan M. Qureshi, Robert A. Colvin, C. Martin Lawrence, and Craig S. Nunemaker. 2026. "Evidence for a Cytokine-Sensitive Network of Iron-Associated Genes That Protects Pancreatic Islets Against Ferroptosis" Metabolites 16, no. 2: 112. https://doi.org/10.3390/metabo16020112
APA StyleSlepchenko, K. G., Counts, G. P., Sharma, P. R., Chen, S., Corbin, K. L., Qureshi, F. M., Colvin, R. A., Lawrence, C. M., & Nunemaker, C. S. (2026). Evidence for a Cytokine-Sensitive Network of Iron-Associated Genes That Protects Pancreatic Islets Against Ferroptosis. Metabolites, 16(2), 112. https://doi.org/10.3390/metabo16020112

