Ability of Nicotinamide Riboside to Prevent Muscle Fatigue of Barrows Subjected to a Performance Test
Abstract
1. Introduction
2. Materials and Methods
2.1. Live Animal Management
2.2. Muscle Biopsy
2.3. Performance Test
2.4. Gait4 Mat Analysis
2.5. Electromyography Analysis
2.6. Serum Analyses
2.7. Immunohistochemistry and Histochemistry
2.8. Mitochondrial DNA Expression
2.9. Statistics
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Benjamin, M. Pig trucking and handling—Stress and fatigued pig. Adv. Pork. Prod. 2005, 16, 57–66. [Google Scholar]
- Ritter, M.; Ellis, M.; Berry, N.; Curtis, S.; Anil, L.; Berg, E.; Benjamin, M.; Butler, D.; Dewey, C.; Driessen, B.; et al. Review: Transport losses in market weight pigs: 1. A review of definitions, incidence, and economic impact. Prof. Anim. Sci. 2009, 25, 404–414. [Google Scholar] [CrossRef] [Scilit]
- Hamilton, D.N.; Ellis, M.; Bertol, T.M.; Miller, K.D. Effects of handling intensity and live weights on blood acid status in finishing pigs. J. Anim. Sci. 2004, 82, 2405. [Google Scholar] [CrossRef] [Scilit]
- Ritter, M.; Ellis, M.; Benjamin, M.; Berg, E.; DuBois, P.; Marchant-Forde, J.; Green, A.; Matzat, P.; Mormede, P.; Moyer, T.; et al. The fatigued pig syndrome. J. Anim. Sci. 2006, 83 (Suppl. S1), 258. [Google Scholar]
- Ritter, M.J.; Yoder, C.L.; Jones, C.L.; Carr, S.N.; Calvo-Lorenzo, M.S. Transport Losses in Market Weight Pigs: II. U.S. Incidence and Economic Impact. Transl. Anim. Sci. 2020, 4, 1103–1112. [Google Scholar] [CrossRef] [Scilit]
- Smith, L.; Allen, W. A study of the weather conditions related to the death of pigs during and after their transportation in england. Agric. Meteorol. 1976, 16, 115–124. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, R.F.; Stalder, K.J.; Matthews, J.O.; Kaster, C.M.S.; Johnson, A.K. Factors associated with fatigued, injured, and dead pig frequency during transport and lairage at a commercial abattoir. J. Anim. Sci. 2009, 87, 1156–1166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gesing, L.; Johnson, A.; Selsby, J.; Feuerbach, C.; Hill, H.; Faga, M.; Whiley, A.; Bailey, R.; Stalder, K.; Ritter, M. Effects of pre-sorting on stress responses at loading and unloading and the impact on transport losses from market-weight pigs. Prof. Anim. Sci. 2010, 26, 603–610. [Google Scholar] [CrossRef] [Scilit]
- Doonan, G.; Benard, G.; Cormier, N. Swine veterinarians are a vital resource for minimizing the incidence of stressed pigs during transport. Can. Vet. J. 2014, 55, 491–493. [Google Scholar]
- Bogan, K.L.; Brenner, C. Nicotinic Acid, Nicotinamide, and Nicotinamide Riboside: A molecular evaluation of NAD+ precursor vitamins in human nutrition. Annu. Rev. Nutr. 2008, 28, 115–130. [Google Scholar] [CrossRef] [Scilit]
- Egan, B.; Zierath, J.R. Exercise metabolism and the molecular regulation of skeletal muscle adaptation. Cell Metab. 2013, 17, 162–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Sauve, A.A. NAD+ Content and its Role in Mitochondria. Methods Mol. Biol. 2015, 1241, 39–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jöbsis, F.; Stainsby, W. Oxidation of NADH during contractions of circulated mammalian skeletal muscle. Respir. Physiol. 1968, 4, 292–300. [Google Scholar] [CrossRef] [Scilit]
- Duboc, D.; Muffat-Joly, M.; Renault, G.; Degeorges, M.; Toussaint, M.; Pocidalo, J.J. In situ NADH laser fluorimetry of rat fast- and slow-twitch muscles during tetanus. J. Appl. Physiol. 1988, 64, 2692–2695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graham, T.; Saltin, B.; Sjøgaard, G.; Löllgen, H. NAD in muscle of man at rest and during exercise. Pflugers Arch. 1978, 376, 35–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, J.M.; Henriksson, J.; Katz, A.; Sahlin, K. NADH content in type I and type II human muscle fibers after dynamic exercise. Biochem. J. 1988, 251, 183–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canto, C.; Houtkooper, R.H.; Pirinen, E.; Youn, D.Y.; Oosterveer, M.H.; Cen, Y.; Fernandez-Marcos, P.J.; Yamamoto, H.; Andreux, P.A.; Cettour-Rose, P.; et al. The NAD+ precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab. 2012, 15, 838–847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Ryu, D.; Wu, Y.; Gariani, K.; Wang, X.; Luan, P.; D’Amico, D.; Ropelle, E.R.; Lutolf, M.P.; Aebersold, R.; et al. NAD+ repletion improves mitochondrial and stem cell function and enhances life span in mice. Science 2016, 352, 1436–1443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Airhart, S.E.; Shireman, L.M.; Risler, L.J.; Anderson, G.D.; Gowda, G.A.N.; Raftery, D.; Tian, R.; Shen, D.D.; O’Brien, K.D. An open-label, non-randomized study of the pharmacokinetics of the nutritional supplement nicotinamide riboside (NR) and its effects on blood NAD+ levels in healthy volunteers. PLoS ONE 2017, 12, e0186459. [Google Scholar] [CrossRef] [Scilit]
- Conze, D.; Brenner, C.; Kruger, C.L. Safety and metabolism of long-term administration of NIAGEN in a randomized, double-blind, placebo-controlled clinical trial of healthy overweight adults. Nature 2019, 9, 97722. [Google Scholar] [CrossRef] [Scilit]
- A Khan, N.; Auranen, M.; Paetau, I.; Pirinen, E.; Euro, L.; Forsström, S.; Pasila, L.; Velagapudi, V.; Carroll, C.J.; Auwerx, J.; et al. Effective treatment of mitochondrial myopathy by nicotinamide riboside, a vitamin B3. Mol. Med. 2014, 6, 721–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- West, F.D.; Kinder, H.; Wang, H.; Baker, E.W.; Mandal, A.; Pidaparti, R.M. Identification of predictive MRI and functional biomarkers in a pediatric piglet traumatic brain injury model. Neural Regen. Res. 2021, 16, 338–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noel, J.A.; Broxterman, R.M.; McCoy, G.M.; Craig, J.C.; Phelps, K.J.; Burnett, D.D.; Vaughn, M.A.; Barstow, T.J.; O’Quinn, T.G.; Woodworth, J.C.; et al. Use of electromyography to detect muscle exhaustion in finishing barrows fed ractopamine HCl. J. Anim. Sci. 2016, 94, 2344–2356. [Google Scholar] [CrossRef] [Scilit]
- Paulk, C.B.; Tokach, M.D.; Nelssen, J.L.; Burnett, D.D.; Vaughn, M.A.; Phelps, K.J.; Dritz, S.S.; DeRouchey, J.M.; Goodband, R.D.; Woodworth, J.C.; et al. Effect of dietary zinc and ractopamine hydrochlorideon pork chop muscle fiber type. J. Anim. Sci. 2014, 92, 2325–2335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hellekant, G.; Danilova, V. Taste in domestic pig, Sus scrofa. J. Anim. Physiol. Anim. Nutr. 2001, 82, 8–24. [Google Scholar] [CrossRef] [Scilit]
- Bartuzi, P.; Roman-Liu, D.; Tokarski, T. A study of the influence of muscle type and muscle force level on individual frequency bands of the EMG power spectrum. Int. J. Occup. Saf. Ergon. 2007, 13, 241–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soares, F.A.; Carvalho, J.L.A.; Miosso, C.J.; de Andrade, M.M.; da Rocha, A.F. Motor unit action potential conduction velocity estimated from surface electromyographic signals using image processing techniques. Biomed. Eng. Online 2015, 14, 84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagg, G.M. Interpretation of EMG spectral alterations and alteration indexes at sustained contraction. J. Appl. Physiol. 1992, 73, 1211–1217. [Google Scholar] [CrossRef] [Scilit]
- Kinugasa, R.; Akima, H.; Ota, A.; Ohta, A.; Sugiura, K.; Kuno, S.-Y. Short-term creatine supplementation does not improve muscle activation or sprint performance in humans. Eur. J. Appl. Physiol. 2004, 91, 230–237. [Google Scholar] [CrossRef] [Scilit]
- Racinais, S.; Bishop, D.; Denis, R.; Lattier, G.; Mendez-Villaneuva, A.; Perrey, S. Muscle deoxygenation and neural drive to the muscle during repeated sprint cycling. Med. Sci. Sports Exerc. 2007, 39, 268–274. [Google Scholar] [CrossRef] [Scilit]
- Cockram, M.S.; Murphy, E.; Ringrose, S.; Wemelsfelder, F.; Miedema, H.M.; Sandercock, D.A. Behavioral and physiological measures following treadmill exercise as potential indicators to evaluate fatigue in sheep. Animal 2012, 6, 491–1502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bangsbo, J.; Iaia, F.M.; Krustrup, P. Metabolic response and fatigue in soccer. Int. J. Sports Physiol. Perform. 2007, 2, 111–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nozaki, S.; Tanaka, M.; Mizuno, K.; Ataka, S.; Mizuma, H.; Tahara, T.; Sugino, T.; Shirai, T.; Eguchi, A.; Okuyama, K.; et al. Mental and physical fatigue-related biochemical alterations. Nutrition 2009, 25, 51–57. [Google Scholar] [CrossRef] [Scilit]
- Hagenmaier, J.A.; Reinhardt, C.D.; Ritter, M.J.; Calvo-Lorenzo, M.S.; Vogel, G.J.; Guthrie, C.A.; Siemens, M.G.; Lechtenberg, K.F.; Rezac, D.J.; Thomson, D.U. Effects of ractopamine hydrochloride on growth performance, carcass characteristics, and physiological response to different handling techniques. J. Anim. Sci. 2017, 95, 1977–1992. [Google Scholar] [CrossRef] [Scilit]
- Daden, R.; Zarhouni, F.Z.; Chakir, J.; Piro, M.; Achaâban, M.R.; Ouassat, M.; El Allali, K. Plasmapheresis effect on hematological and biochemical parameters in athletic horses subjected to exercise. J. Equine Vet. Sci. 2019, 81, 102785. [Google Scholar] [CrossRef] [Scilit]
- Ecternkamp, S. Relationship between LH and cortisol in acutely stressed beef cows. Theriogenology 1984, 22, 305–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hespel, P.; A Richter, E. Glucose uptake and transport in contracting, perfused rat muscle with different pre-contraction glycogen concentrations. J. Physiol. 1990, 427, 347–359. [Google Scholar] [CrossRef] [Scilit]
- Jensen, J.; Aslesen, J.; Ivy, J.; Brors, O. Role of glycogen concentration and epinephrine on glucose uptake in rate epitrochlearis muscle. Am. J. Physiol. 1997, 272, 49–55. [Google Scholar] [CrossRef] [Scilit]
- Čobanović, N.; Stanković, S.D.; Dimitrijević, M.; Suvajdžić, B.; Grković, N.; Vasilev, D.; Karabasil, N. Identifying physiological stress biomarker for prediction of pork quality variation. Animal 2020, 10, 614. [Google Scholar] [CrossRef] [Scilit]
- Peeters, E.; Driessen, B.; Steegmans, R.; Henot, D.; Geers, R. Effect of supplemental tryptophan, vitamin E, and a herbal product on response by pigs to vibration. J. Anim. Sci. 2004, 82, 2410–2420. [Google Scholar] [CrossRef] [Scilit]
- Guyton, J.R.; Bays, H.E. Safety considerations with niacin therapy. Am. J. Cardiol. 2007, 99, 22C–31C. [Google Scholar] [CrossRef] [Scilit]
- Green, C.O.; Wheatley, A.O.; Mcgrowder, D.A.; Dilworth, L.L.; Asemota, H.N. Citrus peel polymethoxylated flavones extract modulates liver and heart function parameters in diet induced hypercholesterolemic rats. Food Chem. Toxicol. 2012, 51, 306–309. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Min, Z.; Yuan, J.; Zhang, B.; Guo, Y. Effects of dietary tryptophan and stocking density on the performance, meat quality, and metabolic status of broilers. J. Anim. Sci. Biotechnol. 2014, 5, 44. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.; Zhen, L.; Zhang, J.; Lian, S.; Si, H.; Guo, J.; Yang, H. Effect of feeding Rumen-protected capsule containing niacin, K2SO4, vitamin C, and gamma-aminobutyric acid on heat stress and performance of dairy cows. J. Therm. Bio. 2017, 69, 249–253. [Google Scholar] [CrossRef] [Scilit]
- Baird, M.F.; Graham, S.M.; Baker, J.S.; Bickerstaff, G.F. Creatine-kinase and exercise related muscle damage implications for muscle performance and recovery. J. Nutr. Metab. 2012, 2012, 960363. [Google Scholar] [CrossRef] [Scilit]
- Montes, J.; Dunaway, S.; Montgomery, M.J.; Sproule, D.; Kaufmann, P.; De Vivo, D.C.; Rao, A.K. Fatigue leads to gait changes in spinal muscular atrophy. Muscle Nerve 2011, 43, 485–488. [Google Scholar] [CrossRef] [Scilit]
- Kalron, A. Association between perceived fatigue and gait parameters measured by an instrumented treadmill in people with multiple sclerosis: A cross-sectional study. J. Neuroeng. Rehabil. 2015, 12, 34. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, A.A.; Küderle, A.; Gaßner, H.; Klucken, J.; Eskofier, B.M.; Kluge, F. Inertial sensor-based gait parameters reflect patient-reported fatigue in multiple sclerosis. J. Neuroeng. Rehabil. 2020, 17, 165. [Google Scholar] [CrossRef] [Scilit]
- Plotkin, D.L.; Roberts, M.D.; Haun, C.T.; Schoenfeld, B.J. Muscle fiber type transitions with exercise training: Shifting perspectives. Sports 2021, 9, 127. [Google Scholar] [CrossRef] [Scilit]
- van Wessel, T.; de Haan, A.; van der Laarse, W.J.; Jaspers, R.T. The muscle fiber type—Fiber size paradox hypertrophy or oxidative metabolism? Eur. J. Appl. Physiol. 2010, 110, 665–694. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Alcocer, H.M.; E Gravely, M.; Jackson, A.R.; Gonzalez, J.M. Effects of in ovo injection of nicotinamide riboside on high-yield broiler myogenesis. J. Anim. Sci. 2022, 100, skac203. [Google Scholar] [CrossRef] [Scilit]




| Gene | Forward Primer, 5′-3′ | Reverse Primer, 5′-3′ | Tw 1 | Amplicon Length, bp | Efficiency | GeneBank Accession |
|---|---|---|---|---|---|---|
| Beta-actin | CCCCTCCTCTCTTGCCTCTC | AAAAGTCCTAGGAAAATGGCAGAAG | 59.1 | 73 | 90 | DQ452569.1 |
| Probe | 6FAMTGCCACGCCCTTTCTCACTTGTTCTMGBNFQ | |||||
| Mitochondrial D-loop 2 | GATCGTACATAGCACATATCATGTC | GGTCCTGAAGTAAGAACCAGATG | 55.0 | 197 | 93 | OR237429.1 |
| Probe | 6FAMCCAGTCAACATGCGTATCACCACCAMGBNFQ | |||||
| Item | Treatment | ||||||
|---|---|---|---|---|---|---|---|
| CON | 15NR | 30NR | 45NR | DRE | SEM | p-Value | |
| Finishing performance | |||||||
| Initial BW, kg | 95 | 94 | 95 | 95 | 96 | 5.1 | 0.96 |
| Final BW, kg | 134 | 133 | 134 | 133 | 133 | 2.9 | 0.99 |
| Pre-supplementation 2 | |||||||
| ADG, kg | 1.01 | 1.07 | 1.01 | 0.99 | 0.95 | 0.07 | 0.60 |
| ADI, kg | 3.56 | 3.48 | 3.49 | 3.38 | 3.51 | 0.22 | 0.72 |
| G:F | 0.29 | 0.33 | 0.30 | 0.31 | 0.28 | 0.03 | 0.51 |
| D5 supplementation 3 | |||||||
| ADG, kg | 1.65 | 1.44 | 1.41 | 1.55 | 1.53 | 0.16 | 0.44 |
| ADI, kg | 3.64 | 3.41 | 3.56 | 3.52 | 3.57 | 0.23 | 0.74 |
| G:F | 0.46 | 0.46 | 0.41 | 0.46 | 0.45 | 0.06 | 0.93 |
| D10 supplementation 4 | |||||||
| ADG, kg | 2.89 | 2.41 | 2.69 | 2.51 | 2.24 | 0.31 | 0.37 |
| ADI, kg | 3.74 a | 3.68 a | 3.50 a,b,x | 3.14 b,y | 3.56 a | 0.20 | 0.05 |
| G:F | 0.25 a | 0.30 a | 0.34 ab | 0.43 b | 0.29 a | 0.05 | 0.07 |
| Treatment | p-Value | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Item | CON | 15NR | 30NR | 45NR | DRE 1 | SEM | Treatment | Time | Treatment × Time |
| Performance test 2 | |||||||||
| Average speed, m/s | 1.02 | 1.10 | 1.13 | 1.11 | 1.07 | 0.69 | 0.57 | - | - |
| Exhaustion distance, m | 415 a,x | 531 b | 485 a,b | 526 a,b,y | 588 b | 47.4 | 0.07 | - | - |
| Exhaustion time, s | 420 a | 498 a,b | 452 a | 461 a | 569 b | 42.2 | 0.04 | - | - |
| Blood parameter | |||||||||
| Serum cortisol, µg/dL | 0.85 | <0.01 | 0.99 | ||||||
| Pre 3 | 3.62 | 3.50 | 3.91 | 2.69 | 3.58 | 0.91 | |||
| Post 4 | 14.17 | 13.54 | 13.88 | 13.33 | 13.49 | 0.86 | |||
| Serum glucose, mg/dL | 0.30 | 0.94 | 0.32 | ||||||
| Pre | 86.98 | 84.89 | 87.22 | 86.93 | 86.83 | 5.51 | |||
| Post | 77.60 | 77.75 | 93.05 | 90.21 | 93.16 | 5.06 | |||
| Item | Treatment 1 | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| CON | 15NR | 30NR | 45NR | DRE | |||
| Fiber type, % | |||||||
| Biceps femoris | |||||||
| Type I | 0.15 | 0.14 | 0.17 | 0.14 | 0.14 | 0.01 | 0.36 |
| Type IIA | 0.22 | 0.27 | 0.26 | 0.27 | 0.24 | 0.02 | 0.58 |
| Type IIX | 0.11 | 0.08 | 0.07 | 0.08 | 0.09 | 0.02 | 0.66 |
| Type IIB | 0.52 | 0.51 | 0.49 | 0.50 | 0.53 | 0.02 | 0.83 |
| Semitendinosus | |||||||
| Type I | 0.07 | 0.08 | 0.08 | 0.07 | 0.12 | 0.02 | 0.22 |
| Type IIA | 0.20 | 0.19 | 0.15 | 0.24 | 0.24 | 0.03 | 0.29 |
| Type IIX | 0.16 | 0.13 | 0.16 | 0.16 | 0.11 | 0.03 | 0.46 |
| Type IIB | 0.57 | 0.60 | 0.61 | 0.53 | 0.53 | 0.03 | 0.35 |
| Tensor facia latae | |||||||
| Type I | 0.14 | 0.16 | 0.17 | 0.16 | 0.15 | 0.02 | 0.88 |
| Type IIA | 0.27 a | 0.26 a | 0.27 a | 0.20 b | 0.22 a,b | 0.03 | 0.09 |
| Type IIX | 0.12 a | 0.09 a | 0.11 a | 0.18 b | 0.13 a,b | 0.02 | 0.03 |
| Type IIB | 0.52 | 0.51 | 0.49 | 0.50 | 0.53 | 0.02 | 0.83 |
| Cross-sectional area, µm2 | |||||||
| Biceps femoris | |||||||
| Type I | 2753 | 3049 | 3019 | 3102 | 3112 | 299 | 0.90 |
| Type IIA | 3917 | 4392 | 4440 | 4575 | 4146 | 393 | 0.78 |
| Type IIX | 5148 | 5476 | 6335 | 5894 | 5674 | 558 | 0.64 |
| Type IIB | 5775 | 6524 | 6662 | 6258 | 6260 | 624 | 0.70 |
| Semitendinosus | |||||||
| Type I | 3583 | 4433 | 4252 | 4507 | 3603 | 515 | 0.47 |
| Type IIA | 4338 | 4796 | 4980 | 6098 | 4668 | 606 | 0.20 |
| Type IIX | 5264 | 6238 | 6231 | 6840 | 6589 | 759 | 0.55 |
| Type IIB | 4589 | 5801 | 5463 | 5997 | 6260 | 805 | 0.46 |
| Tensor facia latae | |||||||
| Type I | 1879 | 1698 | 2059 | 1849 | 2085 | 249 | 0.74 |
| Type IIA | 2324 | 2455 | 3243 | 2388 | 2753 | 341 | 0.31 |
| Type IIX | 3263 | 3450 | 4282 | 3459 | 3839 | 409 | 0.43 |
| Type IIB | 3890 | 3912 | 4661 | 4241 | 4367 | 394 | 0.57 |
| Item | Treatment | p-Value | |||||||
|---|---|---|---|---|---|---|---|---|---|
| CON | 15NR | 30NR | 45NR | DRE 1 | SEM | Treatment | Muscle | Treatment × Muscle | |
| Expression, fold | <0.01 | <0.01 | <0.01 | ||||||
| Semitendinosus | 0.84 | 0.65 | 0.73 | 0.76 | 0.75 | 0.240 | |||
| Tensor facia latae | 1.00 a | 0.75 a | 0.88 a | 0.91 a | 1.54 b | 0.231 | |||
| Biceps femoris | 0.96 a | 1.2 a,b | 1.64 b,d | 2.28 c | 2.09 c,d | 0.314 | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hennesy, H.M.; Gravely, M.E.; Alambarrio, D.A.; Brannen, S.R.; McDonald, J.J.; Devane, S.A.; Turner, K.K.; Stelzleni, A.M.; O’Quinn, T.G.; Gonzalez, J.M. Ability of Nicotinamide Riboside to Prevent Muscle Fatigue of Barrows Subjected to a Performance Test. Metabolites 2024, 14, 424. https://doi.org/10.3390/metabo14080424
Hennesy HM, Gravely ME, Alambarrio DA, Brannen SR, McDonald JJ, Devane SA, Turner KK, Stelzleni AM, O’Quinn TG, Gonzalez JM. Ability of Nicotinamide Riboside to Prevent Muscle Fatigue of Barrows Subjected to a Performance Test. Metabolites. 2024; 14(8):424. https://doi.org/10.3390/metabo14080424
Chicago/Turabian StyleHennesy, Hanna M., Morgan E. Gravely, Daniela A. Alambarrio, Savannah R. Brannen, Jonathan J. McDonald, Sarah A. Devane, Kari K. Turner, Alexander M. Stelzleni, Travis G. O’Quinn, and John M. Gonzalez. 2024. "Ability of Nicotinamide Riboside to Prevent Muscle Fatigue of Barrows Subjected to a Performance Test" Metabolites 14, no. 8: 424. https://doi.org/10.3390/metabo14080424
APA StyleHennesy, H. M., Gravely, M. E., Alambarrio, D. A., Brannen, S. R., McDonald, J. J., Devane, S. A., Turner, K. K., Stelzleni, A. M., O’Quinn, T. G., & Gonzalez, J. M. (2024). Ability of Nicotinamide Riboside to Prevent Muscle Fatigue of Barrows Subjected to a Performance Test. Metabolites, 14(8), 424. https://doi.org/10.3390/metabo14080424

