Biochemical Association of MTHFR C677T Polymorphism with Myocardial Infarction in the Presence of Diabetes Mellitus as a Risk Factor
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Considerations
2.2. Study Design
2.3. Standards for Inclusion and Exclusion of Study Participants
2.4. Measurement of Clinical Parameters
2.5. Collection of Blood Specimen
2.6. Analysis of Biochemical Parameters
2.7. Extraction of DNA
2.8. Purification and Estimation of DNA
2.9. Genotyping of MTHFR Gene (rs1801133)
2.10. Statistical Analysis
3. Results
3.1. Clinical Profile and Anthropomorphic Characteristics
3.2. Biochemical Analysis
3.3. Results of Gel Electrophoresis
3.4. Genotype and Allelic Frequency for the Control, Myocardial Infarction, and Myocardial Infarction with Diabetes Study Group
3.5. Association of SNP among the Control, Myocardial Infarction, and Myocardial Infarction with Diabetes Mellitus among Study Groups
3.6. Clinical and Biochemical Association of MTHFR C677T (rs1801133) SNP
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roffi, M.; Patrono, C.; Collet, J.-P.; Mueller, C.; Valgimigli, M.; Andreotti, F.; Bax, J.J.; Borger, M.A.; Brotons, C.; Chew, D.P.; et al. 2015 ESC Guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation: Task Force for the Management of Acute Coronary Syndromes in Patients Presenting without Persistent ST-Segment Elevation of the European Society of Cardiology (ESC). Eur. Heart J. 2016, 37, 267–315. [Google Scholar] [PubMed]
- Alizadeh, S.; Djafarian, K.; Moradi, S.; Shab-Bidar, S. C667T and A1298C polymorphisms of methylenetetrahydrofolate reductase gene and susceptibility to myocardial infarction: A systematic review and meta-analysis. Int. J. Cardiol. 2016, 217, 99–108. [Google Scholar] [CrossRef] [Scilit]
- Wu, A.T.H.; Lawal, B.; Tzeng, Y.-M.; Shih, C.-C.; Shih, C.-M. Identification of a Novel Theranostic Signature of Metabolic and Immune-Inflammatory Dysregulation in Myocardial Infarction, and the Potential Therapeutic Properties of Ovatodiolide, a Diterpenoid Derivative. Int. J. Mol. Sci. 2022, 23, 1281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hansson, G.K. Inflammation, atherosclerosis, and coronary artery disease. N. Engl. J. Med. 2005, 352, 1685–1695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masud, R.; Qureshi, I.Z. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease. Mol Cell Biochem. 2011, 355, 289–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaidi, Y.; Aguilar, E.G.; Troncoso, M.; Ilatovskaya, D.V.; DeLeon-Pennell, K.Y. Immune regulation of cardiac fibrosis post myocardial infarction. Cell. Signal. 2021, 77, 109837. [Google Scholar] [CrossRef] [Scilit]
- Hayward, S.L.; Bautista-Lopez, N.; Suzuki, K.; Atrazhev, A.; Dickie, P.; Elliott, J.F. CD4 T Cells Play Major Effector Role and CD8 T Cells Initiating Role in Spontaneous Autoimmune Myocarditis of HLA-DQ8 Transgenic IAb Knockout Nonobese Diabetic Mice1. J. Immunol. 2006, 176, 7715–7725. [Google Scholar] [PubMed]
- Kumar, V.; Prabhu, S.; Bansal, S. CD4(+) T-lymphocytes exhibit biphasic kinetics post-myocardial infarction. Front. Cardiovasc. Med. 2022, 9, 992653. [Google Scholar]
- Lu, Y.; Xia, N.; Cheng, X. Regulatory T Cells in Chronic Heart Failure. Front. Immunol. 2021, 12, 732794. [Google Scholar]
- Rosenzweig, R.; Kumar, V.; Gupta, S.; Bermeo-Blanco, O.; Stratton, M.S.; Gumina, R.J.; Bansal, S.S. Estrogen Receptor-β Agonists Modulate T-Lymphocyte Activation and Ameliorate Left Ventricular Remodeling During Chronic Heart Failure. Circ. Heart Fail. 2022, 15, e008997. [Google Scholar]
- Rosenzweig, R.; Gupta, S.; Kumar, V.; Gumina, R.J.; Bansal, S.S. Estrogenic bias in T-Lymphocyte biology: Implications for cardiovascular disease. Pharmacol. Res. 2021, 170, 105606. [Google Scholar]
- Dogra, R.K.; Das, R.; Ahluwalia, J.; Kumar, R.M.; Talwar, K.K. Prothrombotic gene polymorphisms and plasma factors in young North Indian survivors of acute myocardial infarction. J. Thromb. Thrombolysis 2012, 34, 276–282. [Google Scholar] [PubMed]
- Onrat, S.T.; Akci, O.; Söylemez, Z.; Onrat, E.; Avşar, A. Prevalence of myocardial infarction polymorphisms in Afyonkarahisar, Western Turkey. Mol. Biol. Rep. 2012, 39, 9257–9264. [Google Scholar] [PubMed]
- Nicoll, R.; Howard, J.; Henein, M. Cardiovascular calcification and bone: A comparison of the effects of dietary and serum antioxidants. Int. Cardiovasc. Res. J. 2015, 2, 8–15. [Google Scholar]
- Isordia-Salas, I.; Trejo-Aguilar, A.; Valadés-Mejía, M.G.; Santiago-Germán, D.; Leaños-Miranda, A.; Mendoza-Valdéz, L.; Jáuregui-Aguilar, R.; Borrayo-Sánchez, G.; Majluf-Cruz, A. C677T polymorphism of the 5,10 MTHFR gene in young Mexican subjects with ST-elevation myocardial infarction. Arch. Med. Res. 2010, 41, 246–250. [Google Scholar]
- Leon, B.M.; Maddox, T.M. Diabetes and cardiovascular disease: Epidemiology, biological mechanisms, treatment recommendations and future research. World J. Diabetes 2015, 6, 1246–1258. [Google Scholar]
- Matheus, A.S.D.M.; Tannus, L.R.M.; Cobas, R.A.; Palma, C.C.S.; Negrato, C.A.; Gomes, M.D.B. Impact of diabetes on cardiovascular disease: An update. Int. J. Hypertens. 2013, 2013, 653789. [Google Scholar] [CrossRef] [Scilit]
- Matheus, A.S.D.M.; Tannus, L.R.M.; Cobas, R.A.; Palma, C.C.S.; Negrato, C.A.; Gomes, M.D.B.; Zhong, Z.; Zhang, H.; Xu, T.; Hao, J.; et al. Identification and verification of immune-related biomarkers and immune infiltration in diabetic heart failure. Front. Cardiovasc. Med. 2022, 9, 931066. [Google Scholar]
- Gülec, S.; Aras, O.; Akar, E.; Tutar, E.; Omürlü, K.; Avci, F.; Dinçer, I.; Akar, N.; Oral, D. Methylenetetrahydrofolate reductase gene polymorphism and risk of premature myocardial infarction. Clin. Cardiol. 2001, 24, 281–284. [Google Scholar] [CrossRef] [Scilit]
- Slama, D.B.B.; Mrissa, N.F.; Haggui, A.; Nsiri, B.; Haouala, H.; Gritli, N. Association of methylenetetrahydrofolate reductase C677T and A1298C polymorphisms with myocardial infarction in Tunisian young patients. Comp. Clin. Pathol. 2013, 23, 1633–1638. [Google Scholar]
- Patti, G.; Fossati, C.; Nusca, A.; Mega, S.; Pasceri, V.; D’Ambrosio, A.; Giannetti, B.; Annibali, O.; Avvisati, G.; Di Sciascio, G. Methylenetetrahydrofolate reductase (MTHFR) C677T genetic polymorphism and late infarct-related coronary artery patency after thrombolysis. J. Thromb. Thrombolysis 2009, 27, 413–420. [Google Scholar] [PubMed]
- Qin, X.; Peng, Q.; Chen, Z.; Deng, Y.; Huang, S.; Xu, J.; Li, H.; Li, S.; Zhao, J. The association between MTHFR gene polymorphisms and hepatocellular carcinoma risk: A meta-analysis. PLoS ONE 2013, 8, e56070. [Google Scholar]
- Oztuzcu, S.; Ergün, S.; Ulaşlı, M.; Nacarkahya, G.; Igci, Y.Z.; Iğci, M.; Bayraktar, R.; Tamer, A.; Cakmak, E.A.; Arslan, A. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey. Mol. Biol. Rep. 2014, 41, 3671–3676. [Google Scholar] [PubMed]
- Dayakar, S.; Goud, K.I.; Reddy, T.P.K.; Rao, S.P.; Sesikeran, S.B.; Sadhnani, M. Sequence variation of the methylene tetrahydrofolate reductase gene (677C>T and 1298 A>C) and traditional risk factors in a South Indian population. Genet. Test Mol. Biomark. 2011, 15, 765–769. [Google Scholar]
- El-Sammak, M.; Kandil, M.; El-Hifni, S.; Hosni, R.; Ragab, M. Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects. Int. J. Med. Sci. 2004, 1, 181–192. [Google Scholar] [CrossRef] [Scilit]
- Alam, M.A.; Husain, S.A.; Narang, R.; Chauhan, S.S.; Kabra, M.; Vasisht, S. Association of polymorphism in the thermolabile 5, 10-methylene tetrahydrofolate reductase gene and hyperhomocysteinemia with coronary artery disease. Mol. Cell Biochem. 2008, 310, 111–117. [Google Scholar] [CrossRef] [Scilit]
- Lloyd-Jones, D.; Adams, R.J.; Brown, T.M.; Carnethon, M.; Dai, S.; De Simone, G.; Ferguson, T.B.; Ford, E.; Furie, K.; Gillespie, C.; et al. Heart disease and stroke statistics—2010 update: A report from the American Heart Association. Circulation 2010, 121, e46–e215. [Google Scholar]
- Kelly, M.; Semsarian, C. Multiple mutations in genetic cardiovascular disease: A marker of disease severity? Circ. Cardiovasc. Genet. 2009, 2, 182–190. [Google Scholar] [CrossRef] [Scilit]
- Luepker, R.V. Careers in cardiovascular disease epidemiology and prevention. Circulation 2009, 120, 533–538. [Google Scholar]
- Kerkeni, M.; Addad, F.; Chauffert, M.; Myara, A.; Gerhardt, M.; Chevenne, D.; Trivin, F.; Ben Farhat, M.; Miled, A.; Maaroufi, K. Hyperhomocysteinaemia, methylenetetrahydrofolate reductase polymorphism and risk of coronary artery disease. Ann. Clin. Biochem. 2006, 43, 200–206. [Google Scholar]
- Milani, R.V.; Lavie, C.J. Homocysteine: The Rubik’s cube of cardiovascular risk factors. In Mayo Clinic Proceedings; Elsevier: Amsterdam, The Netherlands, 2008. [Google Scholar]
- Chua, S.; Wu, C.-J.; Chang, H.-W.; Chen, C.-J.; Yang, C.-H.; Yip, H.-K. Impact of elevated plasma total homocysteine concentration on coronary atherosclerosis in Chinese patients with acute myocardial infarction undergoing primary coronary intervention. Int. Heart J. 2005, 46, 181–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frosst, P.; Blom, H.J.; Milos, R.; Goyette, P.; Sheppard, C.A.; Matthews, R.G.; Boers, G.J.H.; den Heijer, M.; Kluijtmans, L.A.J.; van den Heuve, L.P.; et al. A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolate reductase. Nat. Genet. 1995, 10, 111–113. [Google Scholar] [PubMed]
- Lohmueller, K.E.; Pearce, C.L.; Pike, M.; Lander, E.S.; Hirschhorn, J.N. Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. Nat. Genet. 2003, 33, 177–182. [Google Scholar] [PubMed]
- Xuan, C.; Bai, X.-Y.; Gao, G.; Yang, Q.; He, G.-W. Association between polymorphism of methylenetetrahydrofolate reductase (MTHFR) C677T and risk of myocardial infarction: A meta-analysis for 8140 cases and 10,522 controls. Arch. Med. Res. 2011, 42, 677–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huh, H.J.; Chi, H.S.; Shim, E.H.; Jang, S.; Park, C.J. Gene-Nutrition interactions in coronary artery disease: Correlation between the MTHFR C677T polymorphism and folate and homocysteine status in a Korean population. Thromb. Res. 2006, 117, 501–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klerk, M.; Verhoef, P.; Clarke, R.; Blom, H.J.; Kok, F.J.; Schouten, E.G.; MTHFR Studies Collaboration Group. MTHFR 677C→T Polymorphism and Risk of Coronary Heart Disease: A Meta-analysis. JAMA 2002, 288, 2023–2031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raghubeer, S.; Matsha, T.E. Methylenetetrahydrofolate (MTHFR), the One-Carbon Cycle, and Cardiovascular Risks. Nutrients 2021, 13, 4562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sadewa, A.H.; Sunarti; Sutomo, R.; Hayashi, C.; Lee, M.J.; Ayaki, H.; Sofro, A.S.M.; Matsuo, M.; Nishio, H. The C677T mutation in the methylenetetrahydrofolate reductase gene among the Indonesian Javanese population. Kobe J. Med. Sci. 2002, 48, 137–144. [Google Scholar]
- Benrahma, H.; Abidi, O.; Melouk, L.; Ajjemami, M.; Rouba, H.; Chadli, A.; Oudghiri, M.; Farouqui, A.; Barakat, A. Association of the C677T polymorphism in the human methylenetetrahydrofolate reductase (MTHFR) gene with the genetic predisposition for type 2 diabetes mellitus in a Moroccan population. Genet. Test Mol. Biomark. 2012, 16, 383–387. [Google Scholar]
- Movva, S.; Alluri, R.V.; Venkatasubramanian, S.; Vedicherla, B.; Vattam, K.K.; Ahuja, Y.R.; Hasan, Q. Association of methylene tetrahydrofolate reductase C677T genotype with type 2 diabetes mellitus patients with and without renal complications. Genet Test Mol Biomark. 2011, 15, 257–261. [Google Scholar]
- Eftychiou, C.; Antoniades, L.; Makri, L.; Koumas, L.; Costeas, P.A.; Kyriakou, E.; Nicolaides, E.; Papadogiannis, D. Homocysteine levels and MTHFR polymorphisms in young patients with acute myocardial infarction: A case control study. Hellenic. J. Cardiol. 2012, 53, 189–194. [Google Scholar] [PubMed]
- Gedeon, G.S.; Baban, N.K.; Jubrael, J.M.S.; Al-Allawi, N.A.S. Thrombophilic mutations in blood donors in Duhok-Iraq. Duhok Med. J. 2009, 3, 25–32. [Google Scholar]
- Chen, Z.-F.; Young, L.; Yu, C.H.; Shiao, S.P.K. A Meta-Prediction of Methylenetetrahydrofolate-Reductase Polymorphisms and Air Pollution Increased the Risk of Ischemic Heart Diseases Worldwide. Int. J. Environ. Res. Public Health 2018, 15, 1453. [Google Scholar] [PubMed]
- Isordia-Salas, I.; Barinagarrementería-Aldatz, F.; Leaños-Miranda, A.; Borrayo-Sánchez, G.; Vela-Ojeda, J.; García-Chávez, J.; Ibarra-González, I.; Majluf-Cruz, A. The C677T polymorphism of the methylenetetrahydrofolate reductase gene is associated with idiopathic ischemic stroke in the young Mexican-Mestizo population. Cerebrovasc. Dis. 2010, 29, 454–459. [Google Scholar]
- Uçar, F.; Çelik, S.; Yücel, B.; Sönmez, M.; Celep, F.; Erkut, N. MTHFR C677T Polymorphism and Its Relationship to Myocardial Infarction in the Eastern Black Sea Region of Turkey. Arch. Med. Res. 2011, 42, 709–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atherosclerosis, Thrombosis, and Vascular Biology Italian Study Group. No Evidence of Association Between Prothrombotic Gene Polymorphisms and the Development of Acute Myocardial Infarction at a Young Age. Circulation 2003, 107, 1117–1122. [Google Scholar]
- Matsuo, H.; Segawa, T.; Watanabe, S.; Kato, K.; Hibino, T.; Yokoi, K.; Ichihara, S.; Metoki, N.; Yoshida, H.; Satoh, K.; et al. Assessment of genetic risk for myocardial infarction. Thromb. Haemost. 2006, 96, 220–227. [Google Scholar] [CrossRef] [Scilit]
- Tomaiuolo, R.; Bellia, C.; Caruso, A.; Di Fiore, R.; Quaranta, S.; Noto, D.; Cefalù, A.B.; Di Micco, P.; Zarrilli, F.; Castaldo, G.; et al. Prothrombotic gene variants as risk factors of acute myocardial infarction in young women. J. Transl. Med. 2012, 10, 5. [Google Scholar]
- Mehlig, K.; Leander, K.; De Faire, U.; Nyberg, F.; Berg, C.; Rosengren, A.; Björck, L.; Zetterberg, H.; Blennow, K.; Tognon, G.; et al. The association between plasma homocysteine and coronary heart disease is modified by the MTHFR 677C>T polymorphism. Heart 2013, 99, 1761–1765. [Google Scholar] [CrossRef] [Scilit]
- Khare, A.; Ghosh, K.; Shetty, S.; Kulkarni, B.; Mohanty, D. Combination of thrombophilia markers in acute myocardial infarction of the young. Indian J. Med. Sci. 2004, 58, 381–388. [Google Scholar]
- Celik, M.; Altintas, A.; Celik, Y.; Karabulut, A.; Ayyildiz, O. Thrombophilia in young patients with acute myocardial infarction. Saudi Med. J. 2008, 29, 48–54. [Google Scholar]
- Söderström, E.; Eliasson, M.; Johnson, O.; Hallmans, G.; Weinehall, L.; Jansson, J.-H.; Hultdin, J. Plasma folate, but not homocysteine, is associated with Apolipoprotein A1 levels in a non-fortified population. Lipids Health Dis. 2013, 12, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alkhiary, W.; Azzam, H.; Yossof, M.; Aref, S.; Othman, M.; El-Sharawy, S. Association of hemostatic gene polymorphisms with early-onset ischemic heart disease in Egyptian patients. Clin. Appl. Thromb. Hemost. 2016, 22, 535–542. [Google Scholar] [PubMed]
- Senol, S.; Es, M.U.; Gokmen, G.; Ercin, O.; Tuylu, B.A.; Kargun, K. Genetic polymorphisms in preoperative myocardial infarction. Asian Cardiovasc. Thorac. Ann. 2015, 23, 389–393. [Google Scholar] [PubMed]
- Long, Y.; Zhao, X.-T.; Liu, C.; Sun, Y.-Y.; Ma, Y.-T.; Liu, X.-Y.; Liu, J.-X. A Case-Control Study of the Association of the Polymorphisms of MTHFR and APOE with Risk Factors and the Severity of Coronary Artery Disease. Cardiology 2019, 142, 149–157. [Google Scholar] [CrossRef] [Scilit]
- Bouzidi, N.; Hassine, M.; Fodha, H.; Ben Messaoud, M.; Maatouk, F.; Gamra, H.; Ferchichi, S. Association of the methylene-tetrahydrofolate reductase gene rs1801133 C677T variant with serum homocysteine levels, and the severity of coronary artery disease. Sci. Rep. 2020, 10, 10064. [Google Scholar]
- Golestani, A.; Rahimi, A.; Moridi, N.; Anani-Sarab, G.; Salmani, F.; Dastjerdi, K.; Azdaki, N.; Sajjadi, S.M. Association of factor V Leiden R506Q, FXIIIVal34Leu, and MTHFR C677T polymorphisms with acute myocardial infarction. Egypt. J. Med. Hum. Genet. 2022, 23, 118. [Google Scholar] [CrossRef] [Scilit]



| Gene Primers | Primer Sequence |
|---|---|
| Forward inner primer | 5′GAAGGAGAAGGTGTCTGCGGGAAT3′ |
| Forward outer primer | 5′CCGAAGCAGGGAGCTTTGAGG3′ |
| Reverse inner primer | 5′CCCTCACCTGGATGGGAAAGAT3′ |
| Reverse outer primer | 5′AGCAAAGCTGCGTGATGATGAAATAGG3′ |
| Characteristics | Control | MI | MI-DM | p-Value |
|---|---|---|---|---|
| No. of participants | 100 | 100 | 100 | |
| Age (Years) | ||||
| Age | 46.94 ± 8.71 | 52.2 ± 9.484 | 52.26 ± 9.76 | <0.0001 |
| Blood pressure (mmHg) | ||||
| Systolic Blood Pressure | 114.2 ±12.41 | 146.4 ± 22.72 | 174.6 ± 48.46 | <0.0001 |
| Diastolic Blood Pressure | 74.74 ± 9.88 | 94.6 ± 10.86 | 108.2 ± 16.29 | <0.0001 |
| Gender wise distribution (sex) | ||||
| Males | 30 | 33 | 49 | <0.0001 |
| Female | 70 | 67 | 51 | <0.0001 |
| Smoking status | ||||
| Smoker | 12 | 67 | 75 | <0.0001 |
| Non smoker | 88 | 33 | 25 | <0.0001 |
| Physical activity | ||||
| Bad | 14 | 56 | 51 | <0.0001 |
| Good | 86 | 44 | 49 | <0.0001 |
| Biochemical Test | Control (n = 100) | MI (n = 100) | MI-DM (n = 100) | p-Value |
|---|---|---|---|---|
| Random blood sugar | 94.24 ± 11.09 | 245.2 ± 119.5 | 304.1 ± 108.7 | <0.05 |
| Hemoglobin A1C | 4.724 ± 0.4901 | 5.464 ± 1.151 | 7.892 ± 0.6675 | <0.05 |
| Troponin i | 0.202± 0.770 | 2.610 ± 1.371 | 3.637 ± 1.323 | <0.05 |
| Creatinine kinase MB | 21.96 ± 2.238 | 42.10 ± 14.75 | 44.82 ± 18.55 | <0.05 |
| Lactate dehydrogenase | 372.0 ± 50.69 | 482.6 ± 100.9 | 518.4 ± 53.48 | <0.05 |
| Creatinine phosphokinase | 128.1 ± 35.77 | 261.6± 91.96 | 287.6± 87.81 | <0.05 |
| Alanine transaminase | 18.78 ± 6.137 | 36.12 ± 7.299 | 45.58 ± 8.924 | <0.05 |
| Aspartate aminotransferase | 26.10 ± 9.745 | 38.42 ± 13.99 | 51.76 ± 11.05 | <0.05 |
| Urea | 30.72 ± 6.523 | 40.42 ± 11.65 | 49.28 ± 25.28 | <0.05 |
| Creatinine | 0.8400 ± 0.147 | 1.846 ± 0.6193 | 2.208 ± 0.954 | <0.05 |
| Triglycerides | 90.76 ± 21.98 | 157.5 ± 4.945 | 164.6 ± 10.80 | <0.05 |
| Homocysteine | 8.200 ± 2.636 | 49.80 ± 14.18 | 81.80 ± 13.99 | <0.05 |
| Folate | 29.64 ± 6.928 | 8.240 ± 2.760 | 4.240 ± 1.615 | <0.05 |
| Groups | Allele | Genotype | p-Value | |||
|---|---|---|---|---|---|---|
| T | C | C/C | C/T | T/T | -- | |
| Control | 141 | 59 | 71 | 270 | 2 | 0.0001 |
| MI | 147 | 53 | 53 | 25 | 22 | |
| MI-DM | 146 | 54 | 59 | 23 | 18 | |
| Genetic Model | Genotype | Control (n = 100) | MI (n = 100) | OR (95% CI) | p-Value |
|---|---|---|---|---|---|
| Codominance | C/C | 53(53%) | 61 (61%) | 1.00 | 0.04 |
| C/T | 40(40%) | 25 (25%) | 0.54 (0.29–1.01) | ||
| T/T | 7 (7%) | 14 (14%) | 1.74 (0.65–4.63) | ||
| Dominance | C/C | 53(53%) | 61 (61%) | 1.00 | 0.25 |
| C/T -T/T | 47(47%) | 39 (39%) | 0.72 (0.41–1.26) | ||
| Recessive | C/T -C/T | 93(93%) | 86 (86%) | 1.00 | 0.1 |
| T/T | 7 (7%) | 14 (14%) | 2.16 (0.83–5.61) | ||
| Overdominance | C/C -C/T | 60(60%) | 75 (75%) | 1.0 | 0.023 |
| T/T | 40(40%) | 25 (25%) | 0.50 (0.27–0.91) |
| Genetic Model | Genotype | Control (n = 100) | MI-DM (n = 100) | OR (95% CI) | p-Value |
|---|---|---|---|---|---|
| Codominance | C/C | 53 (53%) | 59 (59%) | 1.00 | 0.006 |
| C/T | 40 (40%) | 23 (23%) | 2.31 (0.89–5.96) | ||
| T/T | 7 (7%) | 18 (18%) | 0.52 (0.27–0.97) | ||
| Dominance | C/C | 53 (53%) | 59 (59%) | 1.00 | 0.39 |
| C/T-T/T | 47 (47%) | 41 (41%) | 0.78 (0.45–1.37) | ||
| Recessive | C/C-C/T | 93 (93%) | 82 (82%) | 1.00 | 0.17 |
| T/T | 7(7%) | 18 (18%) | 2.92 (1.16–7.33) | ||
| Overdominance | C/C-C/T | 60(60%) | 77 (77%) | 1.00 | 0.009 |
| T/T | 40(40%) | 23 (23%) | 0.45 (0.24–0.83) |
| Genetic Model | Genotype | MI (n = 100) | MI-DM (n = 100) | OR (95% CI) | p-Value |
|---|---|---|---|---|---|
| Codominance | C/C | 61 (61%) | 59 (5%) | 1.00 | 0.04 |
| C/T | 38 (38%) | 34 (34%) | 0.86 (0.471.57) | ||
| T/T | 10 (10%) | 12 (12%) | 0.65 (0.46–2.90) | ||
| Dominance | C/C | 61 (61%) | 59 (59%) | 1.00 | 0.77 |
| C/T-T/T | 39 (39%) | 41 (41%) | 1.92 (0.62–1.91) | ||
| Recessive | C/C-C/T | 86 (86%) | 82 (82%) | 1.00 | 0.44 |
| T/T | 14 (14%) | 18 (18%) | 1.35 (0.63–2.89) | ||
| Overdominance | C/C-C/T | 75(75%) | 77 (77%) | 1.00 | 0.74 |
| T/T | 25 (25%) | 23 (23%) | 0.90 (0.47–1.50) |
| Genetic Model | Genotype | Control (n = 100) | MI with and without DM (n = 200) | OR (95% CI) | p-Value |
|---|---|---|---|---|---|
| Codominance | C/C | 53 (53%) | 120 (60%) | 1.00 | 0.004 |
| C/T | 40 (40%) | 48 (24%) | 2.02 (0.84–4.86) | ||
| T/T | 7 (7%) | 32 (16%) | 0.53 (0.31–0.90) | ||
| Dominance | C/C | 53 (53%) | 120 (60%) | 1.00 | 0.25 |
| C/T-T/T | 47 (47%) | 80 (40%) | 0.89 (0.55–1.43) | ||
| Recessive | C/C-C/T | 93 (93%) | 168 (84%) | 1.00 | 0.096 |
| T/T | 7 (7%) | 32 (16%) | 2.53 (1.07–5.96) | ||
| Overdominance | C/C-C/T | 60(54%) | 152 (76%) | 1.00 | 0.0046 |
| T/T | 40 (46%) | 48 (24%) | 0.47 (0.28–0.79) |
| Parameters | Control (n = 100) | MI (n = 100) | MI-DM (n = 100) | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C/C | C/T | T/T | C/C | C/T | T/T | ||
| Clinical | ||||||||||
| Systolic BP | 114.2 ± 12.47 | 113.5 ± 12.33 | 122.5 ± 12.58 | 144.0 ± 22.51 | 147.6 ± 25.41 | 146.0 ± 11.74 | 176.3 ± 49.80 | 166.5 ± 44.71 | 190.0 ± 52.05 | <0.05 |
| Diastolic BP | 74.40 ± 9.930 | 73.48 ± 9.711 | 85.00 ± 5.774 | 94.23 ± 10.91 | 94.74 ± 11.56 | 96.00 ± 8.433 | 110.0 ± 17.80 | 104.7 ± 14.82 | 110.0 ± 12.06 | <0.05 |
| Biochemical | ||||||||||
| RBS | 94.06 ± 11.11 | 95.04 ± 11.41 | 87.50 ± 4.509 | 241.0 ± 119.6 | 238.1 ± 117.7 | 294.1 ± 126.4 | 303.4 ± 115.8 | 292.4 ± 103.0 | 340.7 ± 89.43 | <0.05 |
| HbA1c | 4.724 ± 0.492 | 4.743 ± 0.5027 | 4.500 ± 0.316 | 5.431 ± 1.152 | 5.687 ± 1.228 | 4.790 ± 0.354 | 7.863 ± 0.682 | 7.838 ± 0.655 | 8.175 ± 0.613 | <0.05 |
| Troponin i | 0.0224 ± 0.0118 | 0.0230 ± 0.011 | 0.0125 ± 0.005 | 2.570 ± 1.367 | 2.728 ± 1.435 | 2.373 ± 1.221 | 3.598 ± 1.332 | 3.526 ± 1.329 | 4.128 ± 1.258 | <0.05 |
| CK-MB | 21.96 ± 2.249 | 22.17 ± 2.122 | 19.50 ± 2.517 | 41.85 ± 14.71 | 41.26 ± 14.19 | 46.60 ± 17.69 | 44.02 ± 18.40 | 44.82 ± 18.47 | 48.42 ± 20.60 | <0.05 |
| LDH | 372.0 ± 50.95 | 375.2 ± 51.54 | 335.0 ± 23.80 | 487.1 ± 103.1 | 477.6 ± 100.6 | 478.5 ± 99.15 | 516.4 ± 52.39 | 515.4 ± 48.48 | 535.8 ± 71.28 | <0.05 |
| CPK | 128.5 ± 36.23 | 130.4 ± 34.16 | 96.25 ± 43.47 | 259.8 ± 91.66 | 264.9 ± 99.86 | 257.9 ± 65.86 | 293.7 ± 90.14 | 281.6 ± 89.79 | 276.7 ± 75.12 | <0.05 |
| ALT | 18.78 ± 6.169 | 18.72 ± 5.935 | 19.50 ± 9.609 | 35.48 ± 7.932 | 36.74 ± 7.028 | 37.10 ± 4.630 | 44.26 ± 9.961 | 47.09 ± 8.083 | 47.23 ± 5.246 | <0.05 |
| AST | 26.31 ± 9.786 | 25.72 ± 9.960 | 28.00 ± 8.524 | 38.13 ± 13.86 | 37.97 ± 13.72 | 41.60 ± 16.65 | 51.46 ± 10.75 | 50.68 ± 12.28 | 56.17 ± 8.032 | <0.05 |
| Urea | 30.72 ± 6.556 | 30.74 ± 6.794 | 30.50 ± 3.109 | 40.23 ± 11.52 | 41.13 ± 12.56 | 38.70 ± 9.238 | 49.33 ± 26.19 | 52.65 ± 27.20 | 39.50 ± 9.463 | <0.05 |
| Creatinine | 0.840 ± 0.1485 | 0.991 ± 0.055 | 1.000 ± 0.01 | 1.817 ± 0.627 | 1.832 ± 0.620 | 2.050 ± 0.594 | 2.193 ± 0.953 | 2.286 ± 1.058 | 2.058 ± 0.644 | <0.05 |
| Triglycerides | 90.76 ± 22.09 | 91.17 ± 22.88 | 86.00 ± 9.201 | 157.4 ± 4.956 | 157.2 ± 4.600 | 159.4 ± 6.204 | 164.6 ± 10.64 | 164.6 ± 11.65 | 164.6 ± 9.867 | <0.05 |
| Homocysteine | 8.200 ± 2.650 | 8.065 ± 2.703 | 9.750 ± 1.258 | 49.33 ± 14.18 | 49.47 ± 14.37 | 53.50 ± 14.35 | 81.76 ± 13.57 | 80.59 ± 14.76 | 85.42 ± 14.22 | <0.05 |
| Folate | 29.64 ± 9.963 | 29.17 ± 7.012 | 35.00 ± 3.559 | 8.327 ± 2.756 | 8.342 ± 2.989 | 7.400 ± 1.776 | 4.241 ± 1.577 | 4.441 ± 1.691 | 3.667 ± 1.557 | <0.05 |
| Country | Control | MI | Genotype Frequency Control | Genotype Frequency in MI | p Value | Ref. | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| CC | CT | TT | CC | CT | TT | |||||
| Turkey | 242 | 231 | 123 | 111 | 8 | 119 | 89 | 23 | 0.004 | [46] |
| Italy | 1210 | 1210 | 363 | 317 | 230 | 371 | 547 | 292 | 0.026 | [47] |
| Japan | 2291 | 1192 | 804 | 1134 | 353 | 375 | 579 | 247 | 0.152 | [48] |
| Italy | 909 | 1626 | 311 | 436 | 162 | 574 | 754 | 298 | 0.84 | [49] |
| Sweden | 971 | 514 | 489 | 392 | 90 | 265 | 205 | 44 | 0.37 | [50] |
| India | 120 | 100 | 41 | 10 | 1 | 17 | 3 | 0 | 0.451 | [51] |
| Egypt | 50 | 50 | 22 | 22 | 6 | 22 | 24 | 4 | 0.466 | [25] |
| Turkey | 129 | 107 | 72 | 47 | 10 | 66 | 34 | 7 | 0.369 | [52] |
| Sweden | 514 | 971 | 574 | 754 | 298 | 311 | 436 | 162 | 0.66 | [53] |
| Egypt | 31 | 20 | 14 | 16 | 1 | 3 | 15 | 0 | 0.07 | [54] |
| Mexican | 167 | 167 | 42 | 78 | 47 | 38 | 75 | 54 | 0.69 | [15] |
| Turkey | 70 | 70 | 46 | 16 | 8 | 50 | 12 | 8 | 0.58 | [55] |
| China | 231 | 406 | 88 | 95 | 48 | 80 | 172 | 154 | 0.007 | [56] |
| Tunisia | 207 | 310 | 123 | 78 | 6 | 131 | 121 | 58 | 0.039 | [57] |
| Iran | 150 | 150 | 88 | 55 | 7 | 69 | 74 | 7 | 0.66 | [58] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mallhi, T.H.; Shahid, M.; Rehman, K.; Khan, Y.H.; Alanazi, A.S.; Alotaibi, N.H.; Akash, M.S.H.; Butt, M.H. Biochemical Association of MTHFR C677T Polymorphism with Myocardial Infarction in the Presence of Diabetes Mellitus as a Risk Factor. Metabolites 2023, 13, 251. https://doi.org/10.3390/metabo13020251
Mallhi TH, Shahid M, Rehman K, Khan YH, Alanazi AS, Alotaibi NH, Akash MSH, Butt MH. Biochemical Association of MTHFR C677T Polymorphism with Myocardial Infarction in the Presence of Diabetes Mellitus as a Risk Factor. Metabolites. 2023; 13(2):251. https://doi.org/10.3390/metabo13020251
Chicago/Turabian StyleMallhi, Tauqeer Hussain, Momina Shahid, Kanwal Rehman, Yusra Habib Khan, Abdullah Salah Alanazi, Nasser Hadal Alotaibi, Muhammad Sajid Hamid Akash, and Muhammad Hammad Butt. 2023. "Biochemical Association of MTHFR C677T Polymorphism with Myocardial Infarction in the Presence of Diabetes Mellitus as a Risk Factor" Metabolites 13, no. 2: 251. https://doi.org/10.3390/metabo13020251
APA StyleMallhi, T. H., Shahid, M., Rehman, K., Khan, Y. H., Alanazi, A. S., Alotaibi, N. H., Akash, M. S. H., & Butt, M. H. (2023). Biochemical Association of MTHFR C677T Polymorphism with Myocardial Infarction in the Presence of Diabetes Mellitus as a Risk Factor. Metabolites, 13(2), 251. https://doi.org/10.3390/metabo13020251

