Next Article in Journal
Artificial Intelligence in Cosmetic Formulation: Predictive Modeling for Safety, Tolerability, and Regulatory Perspectives
Previous Article in Journal
Prospective Evaluation of a Thermogenic Topical Cream-Gel Containing Caffeine, Genistein, and Botanical Extracts for the Treatment of Moderate to Severe Cellulite
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cosmetics
Volume 12
Issue 4
10.3390/cosmetics12040156
cosmetics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Recombinant Type XVII Collagen Promotes Hair Growth by Activating the Wnt/β-Catenin and SHH/GLI Signaling Pathways

by
Yuyao Zhang
1,†,
Shiyu Yin
1,†,
Ru Xu
1,
Jiayu Xiao
1,
Rui Yi
1,
Jiahui Mao
1,
Zhiguang Duan
2,3,4,5,* and
Daidi Fan
2,3,4,5,*
1
Xi’an Juzi Biological Gene Technology Co., Ltd., Xi’an 710065, China
2
Engineering Research Center of Western Resource Innovation Medicine Green Manufacturing, Ministry of Education, School of Chemical Engineering, Northwest University, Xi’an 710127, China
3
China Shaanxi Key Laboratory of Biomaterials and Synthetic Biology, Shaanxi R&D Center of Biomaterials and Fermentation Engineering, School of Chemical Engineering, Northwest University, Xi’an 710127, China
4
Biotech & Biomed Research Institute, Northwest University, Xi’an 710127, China
5
Xi’an Innovative R&D Platform for New Biomedical Materials, School of Chemical Engineering, Northwest University, Xi’an 710127, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cosmetics 2025, 12(4), 156; https://doi.org/10.3390/cosmetics12040156
Submission received: 10 April 2025 / Revised: 7 July 2025 / Accepted: 17 July 2025 / Published: 23 July 2025
Browse Figures
Review Reports Versions Notes

Abstract

(1) Background: As society progresses, increasing numbers of individuals are experiencing hair loss, which can be attributed to factors such as unhealthy diets, insufficient sleep, stress, and hormonal imbalances. Currently available pharmacological treatments for hair loss often cause undesirable side effects, highlighting the urgent need to explore safer and more effective agents to promote hair restoration. This study investigated the role of recombinant human type XVII collagen derived from the α1 chain (rhCOL17A1) in facilitating hair growth and restoration. (2) Methods: We analyzed the impact of rhCOL17A1 on the mRNA expression of several growth factors, as well as Bcl-2 and Bax, at the cellular level. Moreover, the effects of rhCOL17A1 on the expression of key proteins in the Wnt/β-catenin and Sonic Hedgehog (SHH)/GLI signaling pathways were examined by Western blotting (WB). At the organismal level, we established a model in C57BL/6 mice through chronic subcutaneous administration of 5% testosterone propionate. We subsequently assessed the effect of rhCOL17A1 on hair regrowth via histological analysis using hematoxylin and eosin (H&E) staining and immunofluorescence staining. (3) Results: rhCOL17A1 contributes to the resistance of hair follicle dermal papilla cells (HFDPCs) to apoptosis. rhCOL17A1 activates the Wnt/β-catenin and SHH/GLI signaling pathways, and increases the expression of type XVII collagen (COLXVII), thereby creating a favorable environment for hair growth. Furthermore, rhCOL17A1 exerts a significant growth-promoting effect at the animal level. (4) Conclusions: rhCOL17 promotes hair growth by activating the Wnt/β-catenin and SHH/GLI signaling pathways and upregulating COLXVII expression.

1. Introduction

Hair loss has become a prevalent issue in contemporary society, with increasing numbers of individuals experiencing this condition. The prevalence of hair loss among individuals in modern society can be attributed to various factors, including genetic predisposition, hormonal fluctuations, increased stress levels, inadequate nutrition, environmental pollution, and exposure to chemicals. Hair loss can impact both the physical and mental well-being of affected individuals, influencing their appearance and emotional state [1,2].
Hair follicles are vital components of the integumentary system and function as sites of hair growth. The integrity of hair follicle structure and function is essential for the maintenance of hair growth. The periodic growth of hair is driven by hair follicle stem cells, which are located within hair follicles [3]. As these stem cells alternate between active and inactive states, hair undergoes cycles of anagen (proliferative phase), catagen (apoptosis-driven regression), and telogen (quiescent phase) [4]. Anagen, which is characterized by active hair production, lasts for an extended period. During the subsequent catagen, the proliferation of hair follicle cells decreases, leading to hair follicle atrophy and eventually halting hair growth. During telogen, hair follicles enter a relatively static state, during which hair growth ceases. At the end of catagen, hair falls out, and new hair is regenerated within the hair follicle, initiating a new growth cycle [5,6].
The hair growth cycle is significantly influenced by the Wnt/β-catenin signaling pathway, which plays an important role in regulating hair growth [7,8]. In particular, this pathway facilitates hair regeneration, promotes hair growth, and contributes to hair follicle morphogenesis during the initial stages of the hair growth phase. The activation of this pathway can stimulate the expression of downstream target proteins, including CyclinD1, vascular endothelial growth factor (VEGF), and various growth factors that are associated with hair growth. This regulation influences the cell growth cycle and promotes hair growth.
The most commonly used pharmacological agents that are currently available for treating hair loss include minoxidil and finasteride. Finasteride is classified as a 5α-reductase inhibitor, and it functions by blocking the conversion of the androgen testosterone into dihydrotestosterone (DHT) [9]. By inhibiting DHT production, finasteride effectively mitigates hair follicle atrophy, thereby delaying or potentially halting hair loss [10,11]. On the other hand, minoxidil functions as a peripheral vasodilator that promotes the relaxation of vascular smooth muscle, thus increasing blood circulation to the scalp and hair follicles. This vasodilatory mechanism increases the supply of essential nutrients and oxygen to hair follicles, thereby facilitating hair growth [12]. However, long-term use of these drugs can cause side effects, including itching, erythema, irritant contact dermatitis, sexual dysfunction, and depressive symptoms. Thus, some researchers have begun to focus on natural plant components and have achieved certain research results [13,14,15]. Kim, D. et al. [13] demonstrated that an aqueous extract of Justicia procumbens enhanced the proliferation of HFDPCs and exhibited preventive effects against hair loss in an androgenetic alopecia (AGA) mouse model. Jin, G.R. et al. [14] reported that Salvia plebeia extract activated HFDPCs, inducing their proliferation and promoting hair growth. Furthermore, Truong, V.L. et al. [15] found that topical application of red ginseng oil (RGO) to C57BL/6 mice effectively stimulated hair regeneration by accelerating the transition from telogen to anagen phase and significantly increasing both hair follicle density and bulb diameter. The components of plant extracts are complex, and the mechanisms of action are difficult to study. There is a need to develop natural, nontoxic materials that cause fewer side effects and effectively ameliorate hair loss [16,17].
COLXVII is a transmembrane protein that is primarily found in the basement membrane zone and is essential for the maintenance of skin structure and function. COLXVII plays a crucial role in maintaining the structural integrity of hair follicles and establishing an optimal environment for hair growth [18,19]. Liu, N. et al. demonstrated that collagen XVII (Col17) rescues skin organ aging by modulating stem cell competition to maintain skin homeostasis [18]. Hiroyuki Matsumura et al. reported that hair loss results from DNA damage-induced hydrolysis of collagen XVII (COL17A1). During the hair cycle, when hair follicle stem cells (HFSCs) experience age-related stress, they prematurely undergo terminal differentiation into epidermal keratinocytes, which are subsequently shed from the skin surface [20]. These findings highlight the essential role of COLXVII in maintaining hair follicle stem cell function and promoting hair growth. Furthermore, COLXVII may participate in various phases of the hair growth cycle. For example, during anagen, COLXVII contributes to sustaining the active growth state of hair follicles, and during catagen and telogen, it may participate in the remodeling and dormancy processes of hair follicles, respectively [21,22]. Additionally, COLXVII may interact with other factors that are associated with hair growth, potentially working synergistically with growth factors, hormones, and other regulatory elements to coregulate the process of hair growth. Thus, COLXVII shows significant potential for mitigating hair loss [5,23,24]. Epidermal growth factor receptor (EGFR) was the first member of the receptor tyrosine kinase (RTK) family to be discovered. EGFR is activated by various ligands present in the extracellular environment and transmits cellular signals to mediate various cellular activities, including cell proliferation, survival, growth, and development. Additionally, EGFR activation inhibits the proteolysis of COLXVII through the secretion of a tissue inhibitor of metalloproteinase 1 (TIMP1). TIMP-1 can specifically bind to MMP-9 to form a complex, thereby inhibiting the activity of MMP-9 and reducing collagen hydrolysis [25].
In this study, we investigated the effects of rhCOL17A1 on hair loss at both the cellular and organismal levels. At the cellular level, we employed quantitative real-time PCR to analyze the mRNA expression of apoptosis-related genes (Bcl-2 and Bax) and several cell growth factors following rhCOL17A1 treatment. Concurrently, Western blotting (WB) was utilized to assess the effects of rhCOL17A1 on the expression of key proteins in the Wnt and SHH signaling pathways. At the animal level, a model was established by 5% testosterone propionate injection, followed by rhCOL17A1 intervention. Hematoxylin and eosin (H&E) staining and immunofluorescence staining were subsequently employed to analyze the hair-growth-promoting effects of rhCOL17A1 in mice.

2. Materials and Methods

2.1. Materials

The recombinant COLXVII protein is derived from the α1 chain of human COLXVII; thus, it is named rhCOL17A1. rhCOL17A1 (≥95% purity by high-performance liquid chromatography)was provided by Xi’an Juzi Biological Gene Technology Co., Ltd. (Xi’an, China), and it was described in patent CN 118373900. As disclosed in the patent, the protein originates from the classical triple-helical G-X-Y structural domain, formed by the assembly of collagen domains across three polypeptide chains. Recombinant human COL17A1 (rhCOL17A1) was expressed in Pichia pastoris X33 as the host strain and purified using cation-exchange chromatography. Finally, a protein with purity > 95% and a molecular weight of approximately 20 kDa was obtained.
Primary rabbit antibodies against β-catenin, phosphorylated β-catenin, phosphorylated GSK-3β, LEF-1, C-Myc, CyclinD1, Sonic Hedgehog (SHH), and GLI-1 were purchased from Cell Signaling Technology (Danvers, MA, USA). Primary rabbit antibodies against GSK-3β, DKK-1, and Wnt3a and secondary goat-anti-rabbit antibodies were purchased from Proteintech Group (Chicago, IL, USA). A primary rabbit antibody against SMO was purchased from Santa Cruz (Santa Cruz, CA, USA). Human hair follicle dermal papilla cells (HFDPCs) were purchased from Fuheng Biology (Shanghai, China). The iCell Primary Endothelial Cell Culture System was purchased from iCell Bioscience, Inc. (Shanghai, China). TRIzol and the Revert Aid First Strand cDNA Synthesis Kit were purchased from Thermo Scientific (Waltham, MA, USA). FastStart Essential DNA Green Master Mix was purchased from Roche (Roche, Basel, Switzerland). RIPA lysis buffer and a bicinchoninic acid (BCA) assay kit were purchased from Solarbio (Beijing, China). Testosterone propionate for injection was purchased from CEN (Hangzhou, China). Five-week-old male C57BL/6 mice (22 ± 3 g) were purchased from Hua Chuang Sino Medical Technology Co., Ltd. (Taizhou, China; licence number: SCXK2020-0009). All experiments were approved by the Northwest University Animal Ethics Committee (NWU-AWC-20240402M, approve on 2 April 2024).

2.2. Cell Culture

Human HFDPCs were maintained in the iCell Primary Endothelial Cell Culture System, which includes 10% FBS and 1% penicillin-streptomycin. The cells were incubated at 37 °C in a humidified atmosphere of 5% CO2. The cells were plated in multiwell culture plates at a suitable density on the first day. On the second day, model establishment or drug treatment was performed, and on the third day, samples were collected for subsequent experiments.

2.3. Quantitative Real-Time PCR

Quantitative real-time PCR was performed to analyze the relative quantities of cDNA of growth factors downstream of the Wnt/β-catenin signaling pathway, including VEGF, insulin-like growth factor (IGF-1), and fibroblast growth factor 7 (FGF-7). HFDPCs were cultured in 6-well plates at a density of 2 × 105 cells/well and incubated in a cell incubator for 24 h. The cells were treated with iCell medium (NC) or various concentrations of rhCOL17A1 for 24 h. Total RNA was subsequently extracted with TRIzol, and cDNA was synthesized with a Revert Aid First Strand cDNA Synthesis Kit. Subsequently, quantitative RT-qPCR was conducted with FastStart Essential DNA Green Master Mix. The sequences of the primers used for amplification by RT-qPCR are shown in Table 1. The relative expression level of each gene was standardized and evaluated using the 2−ΔΔCT method.

2.4. Western Blotting (WB)

Proteins were extracted from HFDPCs with RIPA lysis buffer. A BCA assay kit was used to determine the protein concentrations. The concentrations of all protein samples were standardized, and the samples were subsequently mixed with loading buffer and heated for several minutes to denature the proteins. Samples containing 10 to 30 micrograms of protein were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) for electrophoresis. After the proteins were separated, they were transferred to a polyvinylidene fluoride membrane. The membranes were then immersed in a 5% buttermilk solution and washed. Subsequently, the membranes were incubated with a primary antibody overnight at 4 °C. After the membranes were washed with TBST solution six times for 30 min, secondary antibodies were added to the membranes, which were incubated for 1 h.

2.5. Immunofluorescence Assay

To investigate whether rhCOL17A1 affects the expression of target proteins in HFDPCs, HFDPCs were seeded on microscope slides and treated with various concentrations of rhCOL17A1 for 24 h. After treatment, the cells were fixed with 4% formaldehyde for 15 min. To improve cell permeability, Triton X-100, which was prepared in phosphate-buffered saline (PBS), was added, and the cells were incubated at room temperature for 20 min. The cells were then blocked with bovine serum albumin for 1 h and exposed to a primary antibody overnight at 4 °C. The primary antibody solution was subsequently removed, and the cells were washed before incubation with the secondary antibody. The samples were maintained at a temperature of 20–25 °C for 1 h. Finally, the cells were observed using a confocal laser scanning microscope.

2.6. Animal Experiments

The five-week-old male C57BL/6 mice were housed in an environment with a 12-h dark/light cycle at a controlled temperature of 25 °C and a relative humidity of 50%. The animals were provided with a standard diet.
The mice (n = 50) were divided into five groups (n = 10). All the mice except those in the control group had their dorsal fur shaved and were then continuously treated with 5% testosterone propionate (TES) to induce hair follicle cell quiescence. The dorsal fur of the mice in the control group was shaved, and the mice were treated with the placebo, namely, PBS. Beginning on the fifth day, the mice in the model group were treated with PBS. The mice in the experimental group were treated with low, medium, or high doses (0.02%, 0.1%, or 0.5% w/v, respectively) of rhCOL17A1. The degree of hair coverage on the backs of the mice was documented on days 0, 5, 8, 12, 15, and 18. The ability of rhCOL17A1 to promote hair growth was evaluated by analyzing hair coverage on the dorsal region of the mice. Finally, on Day 18, the mice in each group were sacrificed, and their skin tissues were collected.
Mouse skin tissues were fixed in a 4% formaldehyde solution for 24 h. The samples were subsequently embedded in paraffin and sectioned into slices with a thickness of 5 micrometers. To visualize the tissue structures, hematoxylin and eosin (H&E) staining was conducted. The stained sections were observed under an Olympus microscope to evaluate morphological structures.
Immunofluorescence staining was conducted on paraffin-embedded sections of mouse tissues to examine the expression of Wnt3a, LEF-1, COLXVII, SMO, and Ki67 in the dorsal skin of the mice.

3. Results

3.1. Ability of rhCOL17A1 to Prevent Cell Apoptosis

Apoptosis is a critical process that influences cell survival and hair regeneration [26]. Apoptosis can cause hair follicle atrophy, and it may also induce inflammation in the surrounding tissue, thereby disrupting the hair follicle microenvironment and exacerbating hair loss. It is believed that exposure to UV radiation has serious effects on the structure and function of the skin, for example, by inducing sunburn, inflammation, sustained immunosuppression, and apoptosis [27,28]. Therefore, we investigated whether rhCOL17A1 protects against UVB-induced apoptosis. The mRNA expression of Bcl-2 significantly decreased after UVB exposure but increased after the addition of rhCOL17A1 (Figure 1A). Moreover, rhCOL17A1 mitigated the UVB exposure-induced increase in the mRNA expression of Bax (Figure 1B). These data suggest that rhCOL17A1 protects against UVB-induced HFDPCs apoptosis.

3.2. rhCOL17A1 Increases the mRNA Expression of Growth Factors in HFDPCs

Growth factors can influence human HFDPCs, increasing their proliferation and promoting hair growth [29,30,31]. Therefore, the mRNA expression of VEGF, IGF-1, and FGF-7 was measured by RT-qPCR. Following treatment of HFDPCs with rhCOL17A1, the mRNA levels of VEGF, IGF-1, and FGF-7 were significantly upregulated, with increases of 33.02%, 42.29%, and 52.13% observed at the optimal concentration, respectively (Figure 1C–E). These results indicated that rhCOL17A1 can improve the growth of HFDPCs, helping promote hair growth.

3.3. rhCOL17A1 Activates the Wnt-β-Catenin Signaling Pathway in HFDPCs

The Wnt/β-catenin signaling pathway and its abnormal activation play key roles in the development of hair loss. Studies have shown that activating Wnt signals can stimulate hair follicles to return from quiescence to growth, thus promoting the formation of new hair [32]. HFDPCs were treated with three different concentrations (0.25, 0.5, and 1 mg/mL) of rhCOL17A1, and the expression levels of key proteins that are involved in the Wnt signaling pathway were analyzed via WB. Wnt3a, which is a member of the Wnt family, serves as a positive regulatory signal within the Wnt pathway. After treatment with rhCOL17A1, the expression level of Wnt 3a increased by up to 95.70% (Figure 2B). Moreover, treatment with rhCOL17A1 significantly increased the phosphorylation of β-catenin and GSK-3β (Figure 2C,D), causing β-catenin to accumulate in the cytoplasm, enter the nucleus, and then bind to Tcf/LEF to stimulate transcriptional activity and regulate target gene expression. Moreover, the expression of LEF-1 was also significantly upregulated by 63.99% (Figure 2E). In contrast, the expression of Dkk-1, which is a known inhibitor of β-catenin signaling [8,33], was significantly decreased by 27.30% upon rhCOL17A1 treatment (Figure 2F).

3.4. rhCOL17A1 Activates the SHH-GLI Signaling Pathway in HFDPCs

The SHH/GLI signaling pathway plays a crucial role in regulating the transition of the hair cycle. Activation of the SHH/GLI pathway induces the transition of hair follicle stem cells from telogen to anagen [34]. To investigate the mechanism by which rhCOL17A1 promotes hair regeneration, we examined the protein expression of Shh/GlI pathway-related genes in HFDPCs. As shown in Figure 2G–J, compared with vehicle-treated HFDPCs, rhCOL17A1-treated HFDPCs exhibited markedly increased protein levels of SHH/GLI pathway-related genes. The expression of SHH, SMO, and GLI-1 increased by 134.37%, 56.03%, and 84.95%, respectively. These findings suggest that COLXVII may activate the SHH/GLI pathway to promote the transition of hair follicles to the anagen phase, thus promoting hair growth.

3.5. rhCOL17A1 Regulates the Expression of Cell Cycle-Related Proteins

C-Myc and CyclinD1 are downstream target proteins of the Wnt and SHH/GLI pathways, and they are involved in cell cycle regulation [34,35]. rhCOL17A1 has been shown to increase the expression of C-Myc and CyclinD1 (Figure 2G,K,L). These findings suggest that rhCOL17A1 may prolong the duration of the growth phase and create a favorable environment for hair growth.

3.6. rhCOL17A1 Increases the Expression of COL17 in HFDPCs

COLXVII plays an important role in maintaining normal hair follicle stem cell function and hair growth. Matrix metalloproteinase 9 (MMP-9) is a type of gelatine enzyme that belongs to the matrix metalloproteinase superfamily, and it can hydrolyze collagen [36]. To investigate the growth-promoting effects of rhCOL17A1, we examined the expression of MMP-9 and COLXVII in the context of rhCOL17A1 administration. After HFDPCs were treated with rhCOL17A1, the expression of MMP-9 and COLXVII was assessed by immunofluorescence. As shown in Figure 3, HFDPCs that were treated with rhCOL17A1 exhibited significant changes in fluorescence intensity. The fluorescence intensity was positively correlated with the concentration of rhCOL17A1 administered. After 1 mg/mL rhCOL17A1 was administered, the expression of MMP-9 decreased by 23.21%, and the expression of COLXVII increased by 126.80%. These findings indicate that the administration of rhCOL17A1 can increase the expression of endogenous COLXVII and contribute to the development of coarse hair.

3.7. rhCOL17A1 Promotes Hair Follicle Growth in TES-Treated C57BL/6 Mice

To evaluate the effects of rhCOL17A1 on hair regeneration in TES-treated mice, rhCOL17A1 was administered on a daily basis after five consecutive days of TES administration to the dorsal skin of C57BL/6 mice. Hair coverage in the dorsal area of the mice was observed and recorded.
Throughout the observation period, the hair regeneration capacity of the model group was significantly lower than that of the control group. Compared with those in the control group, the mice in the experimental group that were treated with rhCOL17A1 were better able to regenerate hair, and their skin turned black sooner, which was an initial indicator of the transition of hair follicles to the anagen phase. By Day 18, a notable difference in back hair coverage was observed between the rhCOL17A1-treated mice and the model mice. Mice in the experimental group gradually entered the hair follicle growth phase after Day 8, and over the remainder of the experiment, hair growth was fastest in the mice that were treated with 0.5% rhCOL17A1. A comparison of the hair coverage of the mice in the different experimental groups revealed that the hair growth rate was positively correlated with the concentration of rhCOL17A1 administered (Figure 4). Individual mice whose hair growth significantly differed from the overall hair growth of the group were removed. Each group was given a score on the basis of the cycle in which the hair follicles were found and the extent to which the hair covered the skin on their backs (Figure 4B).
To further study hair follicle apoptosis in model mice and the therapeutic effect of Col17A, we performed staining for Ki67, which is an index that is used to evaluate cell viability, in skin tissues. The immunofluorescence results revealed that Ki67 expression in the model group was dramatically decreased, whereas Ki67 expression increased after treatment with rhCOL17A1 (Figure 4C). To explore the effect of rhCOL17A1 on the hair follicle cycle, the mice were sacrificed on Day 18, and the dorsal skin samples from each group were collected and subjected to H&E staining. Histological analysis indicated that compared with the control, TES treatment significantly delayed the transition of hair follicles in C57BL/6 mice into the growth phase, thereby inhibiting hair growth. However, the application of rhCOL17A1 mitigated the inhibitory effects of TES on hair growth. In the experimental group of mice that were treated with rhCOL17A1, H&E staining revealed visible hair follicles and some hair. The mice that were treated with 0.5% rhCOL17A1 presented the most pronounced hair regrowth, characterized by the longest and most abundant hair follicles, as determined by H&E staining (Figure 4E). These findings indicate that rhCOL17A1 can facilitate the transition of hair follicles from the telogen phase to the anagen phase, thereby contributing to the promotion of hair growth.

3.8. rhCOL17A1 Activates Wnt/β-Catenin and SHH/GLI Pathway in TES-Treated C57BL/6 Mice

We subsequently subjected animal skin tissues to immunofluorescence staining to further confirm and observe the distribution of Wnt3a, the effector protein LEF-1, and SMO within hair follicle tissues. These results further verified the effect of rhCOL17A1 on the Wnt signaling pathway in animal tissue sections. After the TES-induced model was established, the expression levels of Wnt-3a and LEF-1 in the hair follicle region of the dorsal skin of the mice were significantly decreased; however, these levels were increased by 93.51% and 115.79% after treatment with rhCOL17A1 (Figure 5). Similarly, SMO protein expression showed the same trend, which verified that rhCOL17A1 activated the SHH/GLI signaling pathway. These results suggest that the administration of rhCOL17A1 activates the Wnt/β-catenin and SHH/GLI signaling pathways, influences downstream target protein levels, and contributes to the promotion of hair growth.

3.9. rhCOL17A1 Increases the Expression of COL17 in HFDPCs

EGFR activation is essential for maintaining the stability of COLXVII and the properties of epidermal stem cells, and it plays a key role in maintaining epidermal tissue homeostasis. EGFR activation can decrease the hydrolysis of COLXVII and increase the level of COLXVII, which is helpful for establishing a microenvironment that supports hair growth. Thus, we measured the expression of EGFR and COLXVII in dorsal skin samples from the animals via immunofluorescence. rhCOL17A1 significantly increased the expression of EGFR and COLXVII by 168.55% and 250.27% in the animal tissues (Figure 6). These findings suggest that rhCOL17A1 may increase the expression of COLXVII by activating the EGFR pathway.

4. Discussion and Conclusions

Hair loss is an increasingly widespread problem that is no longer limited to particular age or gender groups. Hair goes through the phases of anagen, catagen, and telogen. When hair enters the resting period, it naturally falls out. Then, new hair grows from the hair follicle, maintaining a relative balance in the number of hairs [37,38]. Pathological hair loss occurs due to abnormal operation of the hair follicle cycle. For example, the hair follicle growth cycle is disrupted in patients with alopecia. In these patients, the hair follicle growth period is shortened, and the resting period is extended, increasing the likelihood of hair falling out. Additionally, hair follicle stem cell apoptosis affects hair growth [39,40]. Improving the growth cycle of hair follicles and inhibiting the apoptosis of hair follicle cells have become effective means for preventing hair loss [41].
Currently, minoxidil and finasteride are the drugs that are most widely used in the clinical treatment of alopecia. Nevertheless, these two drugs have been reported to have obvious side effects [42,43]. Thus, exploring potential substances that are capable of promoting hair growth is very important. Hwang, S.B. et al. [44] discovered that fish-derived collagen can enhance hair regrowth and promote the proliferation of HFDPCs in vitro. Liu, N. et al. demonstrated that maintaining COLXVII expression is critical for preserving hair follicle stem cell homeostasis and delaying hair aging [18]. Recombinant Collagen has the advantages of low immunogenicity, greater safety, and fewer side effects. Here, we used a recombinant COLXVII protein named rhCOL17A1 for efficacy studies, which is a recombinant non-full-length human collagen.
This study aimed to explore the effects of rhCOL17A1 on alopecia and the underlying mechanism involved. Based on previous studies, reduced Bax expression and increased Bcl-2 expression are recognized as effective mechanisms for inhibiting apoptosis in hair follicle cells [45,46]. Additionally, elevated mRNA levels of IGF-1, FGF-7, and VEGF have been linked to promoting hair growth [47,48]. In this study, rhCOL17A1 significantly modulated the expression of apoptosis-related genes (Bax and Bcl-2). Moreover, rhCOL17A1 significantly increased the mRNA expression of various growth factors, such as VEGF, IGF-1, and FGF-7. These findings indicate that rhCOL17A1 can prevent cell apoptosis and create favorable conditions for hair regrowth.
The Wnt/β-catenin and SHH/GLI signaling pathways have been confirmed to play important roles in the development of hair loss [34]. In this study, after HFDPCs were treated with different concentrations of rhCOL17A1, Western blotting analysis was used to measure the levels of phosphorylated β-catenin and GSK-3β, activation indicators of the Wnt/β-catenin signaling pathway. In addition, the expression of key proteins in the Wnt/β-catenin and SHH/GLI signaling pathways, such as Wnt 3a, LEF-1, SHH, SMO, and GLI-1, was significantly increased. The results of immunofluorescence staining for Wnt 3a, LEF-1, and SMO in animal tissue sections were consistent with the results of the cell experiments. C-Myc and CyclinD1, which are downstream target proteins of the Wnt/β-catenin and SHH/GLI pathways, participate in regulating the cell cycle. This study revealed that rhCOL17A1 can increase C-Myc expression, regulate HFDPCs growth, and at the same time, significantly increase CyclinD1 expression, prompting hair follicle cells to enter the anagen phase. Based on our research on the Wnt/β-catenin and SHH/GLI signaling pathways, we have cross-validated at both cellular and animal levels, confirming that rhCol17A1 indeed promotes hair growth by activating these two pathways. While the critical function of the Wnt/β-catenin pathway and the SHH/GLI pathway in hair regeneration has been well documented, the specific modulation of this pathway by COLXVII was poorly characterized. Herein, we provide experimental evidence that our engineered non-full-length recombinant type XVII collagen (rhCOL7A1) promotes hair growth by activating the Wnt signaling pathway, thereby offering mechanistic insights into collagen-mediated hair follicle regulation.
The DNA damage response in HFSCs reportedly causes proteolysis of COLXVII, a critical molecule for HFSC maintenance, to trigger HFSC aging [20]. COLXVII can be targeted by MMP9, which belongs to the matrix metalloproteinase family [36,49]. The main function of MMP9 is to degrade and reshape the dynamic balance of the extracellular matrix. After the administration of rhCOL17A1, MMP-9 expression in HFDPCs was decreased, and COLXVII expression was increased. Immunofluorescence analysis of animal tissues revealed that the administration of rhCOL17A1 increased the expression of EGFR and COLXVII. These results suggest that rhCOL17A1 can activate the EGFR pathway, inhibit the expression of MMP-9, and reduce the hydrolysis of COLXVII. Notably, we have identified expression of COLXVII in HFDPCs via immunofluorescence staining. Previous studies indicated that COLXVII is localized specifically in hair follicle stem cells, where it maintains niche integrity. COLXVII, as a transmembrane protein constituting hemidesmosomes (HD), mediates the interactions between stem cells and surrounding cells, as well as the extracellular matrix, thereby regulating skin homeostasis, aging, and wound repair [20,50]. We speculate that in HFDPCs, COLXVII may promote hair growth by facilitating cell proliferation and regulating the cellular microenvironment. This discovery provides novel insights for future hair-related research, while the specific functional mechanisms of COLXVII in HFDPCs remain to be elucidated.
To evaluate the potential therapeutic effect of rhCOL17A1 on androgenetic alopecia, we used male C57BL/6 mice as the research subjects. In accordance with the methods of previous researchers [51,52], we established a model by the subcutaneous injection of 5% testosterone propionate and then intervened with rhCOL17A1. Continuous observation of hair growth conditions in experimental C57BL/6 mice revealed that TES treatment significantly delayed the entry of hair follicles into the anagen phase and inhibited hair growth, whereas rhCOL17A1 treatment alleviated the inhibitory effect of TES. Moreover, hair coverage in the mice was positively correlated with the concentration of rhCOL17A1. In the rhCOL17A1 treatment group, H&E staining revealed visible hair follicles and hair, and the 0.5% rhCOL17A1 treatment group exhibited the most significant hair regeneration, with the longest and most abundant hair follicles. These findings indicate that rhCOL17A1 facilitates the transition of hair follicles from the telogen phase to the anagen phase, thereby promoting hair growth. The possible mechanism involves rhCOL17A1 regulating various signaling pathways and molecular events in hair follicle cells, such as the Wnt/β-catenin and SHH/GLI pathways mentioned above, as well as changes in the expression of related growth factors and target proteins. These phenomena work synergistically at the cellular and tissue levels to overcome the TES-mediated inhibition of hair follicle growth and promote hair follicle development and regeneration during the normal growth cycle; additionally, these findings provide a potential treatment strategy for overcoming the problem of hair loss caused by androgenetic alopecia.
In summary, this study presents in-depth discussions from multiple perspectives, such as those concerning apoptosis, growth factor expression, regulation of the Wnt/β-catenin and SHH/GLI signaling pathways, regulation of downstream target proteins, and impacts on the hair follicle growth cycle. The results indicate that rhCOL17A1 has significant potential for use in promoting hair regeneration and provide a solid theoretical basis and experimental evidence for the development of novel rhCOL17A1-based methods for treating hair loss. However, before rhCOL17A1 can be applied in clinical treatment, further in-depth studies on its safety, optimal dosage, and administration methods are still needed to ensure its effectiveness and safety for treating hair loss.
In addition to clinical applications, COL17A1 can be engineered into hair care products to support long-term follicular health through routine maintenance protocols. Over the past decade, botanical extracts—notably Zingiber officinale and Platycladus orientalis—have emerged as predominant functional components in anti-alopecia formulations. Pharmacological studies have revealed that ginger-derived gingerol enhances microcirculation via vasodilation and exhibits modest anti-inflammatory activity, yet supraoptimal concentrations provoke cytotoxicity in dermal papilla cells and aggravate seborrheic conditions [53,54,55]. Platycladus orientalis extracts, while demonstrating preclinical validity for incipient alopecia intervention and scalp homeostasis modulation, demonstrate marked interindividual variability in efficacy contingent upon administration regimens and pathophysiological subtypes of hair loss [56,57,58]. Collagen and polypeptides have become new research hotspots. Owing to its protective properties, rhCOL17A1 holds promise for use in hair care products to enhance follicle vitality and prevent hair loss.

Author Contributions

Y.Z.: writing—original draft, software, methodology, and conceptualization; S.Y.: writing—review and editing and methodology; R.X.: visualization, investigation, and conceptualization; J.X.: visualization, investigation, and conceptualization; R.Y.: visualization and investigation; J.M.: visualization and investigation; Z.D.: writing—review and editing, supervision, methodology, and conceptualization; and D.F.: writing—review and editing and supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Key Research and Development Program of China (2019YFA0905200).

Institutional Review Board Statement

All animals experiments were approved by the Northwest University Animal Ethics Committee (NWU-AWC-20240402M, approved on 2 April 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors will supply the relevant data in response to reasonable requests.

Acknowledgments

We are grateful for the funding from the National Key Research and Development Program of China (2019YFA0905200). We are grateful to all the people who have contributed to this project.

Conflicts of Interest

All the authors have no financial or personal relationships with other people or organizations that could inappropriately influence (bias) their work. There are no conflicts of interest associated with this study.

References

  1. Gasmi, A.; Mujawdiya, P.K.; Beley, N.; Shanaida, M.; Lysiuk, R.; Lenchyk, L.; Noor, S.; Muhammad, A.; Strus, O.; Piscopo, S.; et al. Natural Compounds Used for Treating Hair Loss. Curr. Pharm. Des. 2023, 29, 1231–1244. [Google Scholar] [CrossRef] [PubMed]
  2. Krefft-Trzciniecka, K.; Piętowska, Z.; Nowicka, D.; Szepietowski, J.C. Human Stem Cell Use in Androgenetic Alopecia: A Systematic Review. Cells 2023, 12, 951. [Google Scholar] [CrossRef] [PubMed]
  3. Lee, J.H.; Choi, S. Deciphering the molecular mechanisms of stem cell dynamics in hair follicle regeneration. Exp. Mol. Med. 2024, 56, 110–117. [Google Scholar] [CrossRef] [PubMed]
  4. Natarelli, N.; Gahoonia, N.; Sivamani, R.K. Integrative and Mechanistic Approach to the Hair Growth Cycle and Hair Loss. J. Clin. Med. 2023, 12, 893. [Google Scholar] [CrossRef]
  5. Lin, X.; Zhu, L.; He, J. Morphogenesis, Growth Cycle and Molecular Regulation of Hair Follicles. Front. Cell Dev. Biol. 2022, 10, 899095. [Google Scholar] [CrossRef]
  6. Abreu, C.M.; Marques, A.P. Recreation of a hair follicle regenerative microenvironment: Successes and pitfalls. Bioeng. Transl. Med. 2022, 7, e10235. [Google Scholar] [CrossRef]
  7. Kishimoto, J.; Burgeson, R.E.; Morgan, B.A. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 2000, 14, 1181–1185. [Google Scholar] [CrossRef]
  8. Kwack, M.H.; Sung, Y.K.; Chung, E.J.; Im, S.U.; Ahn, J.S.; Kim, M.K.; Kim, J.C. Dihydrotestosterone-inducible dickkopf 1 from balding dermal papilla cells causes apoptosis in follicular keratinocytes. J. Investig. Dermatol. 2008, 128, 262–269. [Google Scholar] [CrossRef]
  9. Lee, S.; Lee, Y.B.; Choe, S.J.; Lee, W.S. Adverse Sexual Effects of Treatment with Finasteride or Dutasteride for Male Androgenetic Alopecia: A Systematic Review and Meta-analysis. Acta Derm.-Venereol. 2019, 99, 12–17. [Google Scholar] [CrossRef]
  10. Piraccini, B.M.; Blume-Peytavi, U.; Scarci, F.; Jansat, J.M.; Falqués, M.; Otero, R.; Tamarit, M.L.; Galván, J.; Tebbs, V.; Massana, E.; et al. Efficacy and safety of topical finasteride spray solution for male androgenetic alopecia: A phase III, randomized, controlled clinical trial. J. Eur. Acad. Dermatol. Venereol. 2022, 36, 286–294. [Google Scholar] [CrossRef]
  11. Lee, S.W.; Juhasz, M.; Mobasher, P.; Ekelem, C.; Mesinkovska, N.A. A Systematic Review of Topical Finasteride in the Treatment of Androgenetic Alopecia in Men and Women. J. Drugs Dermatol. 2018, 17, 457–463. [Google Scholar] [PubMed]
  12. Gupta, A.K.; Talukder, M.; Venkataraman, M.; Bamimore, M.A. Minoxidil: A comprehensive review. J. Dermatol. Treat. 2022, 33, 1896–1906. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, D.; Lee, E.; Choi, P.G.; Kim, H.S.; Park, S.H.; Seo, H.D.; Hahm, J.H.; Ahn, J.; Jung, C.H. Justicia procumbens prevents hair loss in androgenic alopecia mice. Biomed. Pharmacother. 2024, 170, 115913. [Google Scholar] [CrossRef]
  14. Jin, G.R.; Zhang, Y.L.; Yap, J.; Boisvert, W.A.; Lee, B.H. Hair growth potential of Salvia plebeia extract and its associated mechanisms. Pharm. Biol. 2020, 58, 400–409. [Google Scholar] [CrossRef]
  15. Truong, V.L.; Keum, Y.S.; Jeong, W.S. Red ginseng oil promotes hair growth and protects skin against UVC radiation. J. Ginseng Res. 2021, 45, 498–509. [Google Scholar] [CrossRef]
  16. Rossi, A.; Cantisani, C.; Melis, L.; Iorio, A.; Scali, E.; Calvieri, S. Minoxidil use in dermatology, side effects and recent patents. Recent Pat. Inflamm. Allergy Drug Discov. 2012, 6, 130–136. [Google Scholar] [CrossRef]
  17. Kaiser, M.; Abdin, R.; Gaumond, S.I.; Issa, N.T.; Jimenez, J.J. Treatment of Androgenetic Alopecia: Current Guidance and Unmet Needs. Clin. Cosmet. Investig. Dermatol. 2023, 16, 1387–1406. [Google Scholar] [CrossRef]
  18. Liu, N.; Matsumura, H.; Kato, T.; Ichinose, S.; Takada, A.; Namiki, T.; Asakawa, K.; Morinaga, H.; Mohri, Y.; De Arcangelis, A.; et al. Stem cell competition orchestrates skin homeostasis and ageing. Nature 2019, 568, 344–350. [Google Scholar] [CrossRef]
  19. Natsuga, K.; Watanabe, M.; Nishie, W.; Shimizu, H. Life before and beyond blistering: The role of collagen XVII in epidermal physiology. Exp. Dermatol. 2019, 28, 1135–1141. [Google Scholar] [CrossRef]
  20. Matsumura, H.; Mohri, Y.; Binh, N.T.; Morinaga, H.; Fukuda, M.; Ito, M.; Kurata, S.; Hoeijmakers, J.; Nishimura, E.K. Hair follicle aging is driven by transepidermal elimination of stem cells via COL17A1 proteolysis. Science 2016, 351, aad4395. [Google Scholar] [CrossRef]
  21. Freter, R. Niche work when you can get it: Collagen XVII and the melanocyte stem cell. Pigment. Cell Melanoma Res. 2011, 24, 592–593. [Google Scholar] [CrossRef] [PubMed]
  22. Shirai, K.; Obara, K.; Tohgi, N.; Yamazaki, A.; Aki, R.; Hamada, Y.; Arakawa, N.; Singh, S.R.; Hoffman, R.M.; Amoh, Y. Expression of anti-aging type-XVII collagen (COL17A1/BP180) in hair follicle-associated pluripotent (HAP) stem cells during differentiation. Tissue Cell 2019, 59, 33–38. [Google Scholar] [CrossRef] [PubMed]
  23. Tuusa, J.; Kokkonen, N.; Tasanen, K. BP180/Collagen XVII: A Molecular View. Int. J. Mol. Sci. 2021, 22, 12233. [Google Scholar] [CrossRef] [PubMed]
  24. Watanabe, M.; Natsuga, K.; Nishie, W.; Kobayashi, Y.; Donati, G.; Suzuki, S.; Fujimura, Y.; Tsukiyama, T.; Ujiie, H.; Shinkuma, S.; et al. Type XVII collagen coordinates proliferation in the interfollicular epidermis. eLife 2017, 6, e26635. [Google Scholar] [CrossRef]
  25. Nanba, D.; Toki, F.; Asakawa, K.; Matsumura, H.; Shiraishi, K.; Sayama, K.; Matsuzaki, K.; Toki, H.; Nishimura, E.K. EGFR-mediated epidermal stem cell motility drives skin regeneration through COL17A1 proteolysis. J. Cell Biol. 2021, 220, e202012073. [Google Scholar] [CrossRef]
  26. Botchkareva, N.V.; Ahluwalia, G.; Shander, D. Apoptosis in the hair follicle. J. Investig. Dermatol. 2006, 126, 258–264. [Google Scholar] [CrossRef]
  27. Matsumura, Y.; Ananthaswamy, H.N. Toxic effects of ultraviolet radiation on the skin. Toxicol. Appl. Pharmacol. 2004, 195, 298–308. [Google Scholar] [CrossRef]
  28. D’Orazio, J.; Jarrett, S.; Amaro-Ortiz, A.; Scott, T. UV radiation and the skin. Int. J. Mol. Sci. 2013, 14, 12222–12248. [Google Scholar] [CrossRef]
  29. Xing, Z.; Zhang, X.; Zhao, C.; Zhang, L.; Qian, S.; Chu, Y.; Yang, W.; Wang, Y.; Xia, J.; Wang, J. Microenvironment-responsive recombinant collagen XVII-based composite microneedles for the treatment of androgenetic alopecia. Acta Biomater. 2025, 200, 400–415. [Google Scholar] [CrossRef]
  30. Trüeb, R.M. Further Clinical Evidence for the Effect of IGF-1 on Hair Growth and Alopecia. Ski. Appendage Disord. 2018, 4, 90–95. [Google Scholar] [CrossRef]
  31. Lee, C.Y.; Yang, C.Y.; Lin, C.C.; Yu, M.C.; Sheu, S.J.; Kuan, Y.H. Hair growth is promoted by BeauTop via expression of EGF and FGF-7. Mol. Med. Rep. 2018, 17, 8047–8052. [Google Scholar] [CrossRef]
  32. Choi, B.Y. Targeting Wnt/β-Catenin Pathway for Developing Therapies for Hair Loss. Int. J. Mol. Sci. 2020, 21, 4915. [Google Scholar] [CrossRef] [PubMed]
  33. Jiang, H.; Zhang, Z.; Yu, Y.; Chu, H.Y.; Yu, S.; Yao, S.; Zhang, G.; Zhang, B.T. Drug Discovery of DKK1 Inhibitors. Front. Pharmacol. 2022, 13, 847387. [Google Scholar] [CrossRef] [PubMed]
  34. Rishikaysh, P.; Dev, K.; Diaz, D.; Qureshi, W.M.; Filip, S.; Mokry, J. Signaling involved in hair follicle morphogenesis and development. Int. J. Mol. Sci. 2014, 15, 1647–1670. [Google Scholar] [CrossRef]
  35. Scholz, B.A.; Sumida, N.; de Lima, C.D.M.; Chachoua, I.; Martino, M.; Tzelepis, I.; Nikoshkov, A.; Zhao, H.; Mehmood, R.; Sifakis, E.G.; et al. WNT signaling and AHCTF1 promote oncogenic MYC expression through super-enhancer-mediated gene gating. Nat. Genet. 2019, 51, 1723–1731. [Google Scholar] [CrossRef] [PubMed]
  36. van Doren, S.R. Matrix metalloproteinase interactions with collagen and elastin. Matrix Biol. 2015, 44-46, 224–231. [Google Scholar] [CrossRef]
  37. Schneider, M.R.; Schmidt-Ullrich, R.; Paus, R. The hair follicle as a dynamic miniorgan. Curr. Biol. 2009, 19, R132–R142. [Google Scholar] [CrossRef]
  38. Cotsarelis, G.; Millar, S.E. Towards a molecular understanding of hair loss and its treatment. Trends Mol. Med. 2001, 7, 293–301. [Google Scholar] [CrossRef]
  39. Devjani, S.; Ezemma, O.; Kelley, K.J.; Stratton, E.; Senna, M. Androgenetic Alopecia: Therapy Update. Drugs 2023, 83, 701–715. [Google Scholar] [CrossRef]
  40. Chiu, H.W.; Chen, M.H.; Fang, W.H.; Hung, C.M.; Chen, Y.L.; Wu, M.D.; Yuan, G.F.; Wu, M.J.; Wang, Y.J. Preventive effects of Monascus on androgen-related diseases: Androgenetic alopecia, benign prostatic hyperplasia, and prostate cancer. J. Agric. Food Chem. 2013, 61, 4379–4386. [Google Scholar] [CrossRef]
  41. Gentile, P.; Garcovich, S. Advances in Regenerative Stem Cell Therapy in Androgenic Alopecia and Hair Loss: Wnt pathway, Growth-Factor, and Mesenchymal Stem Cell Signaling Impact Analysis on Cell Growth and Hair Follicle Development. Cells 2019, 8, 466. [Google Scholar] [CrossRef] [PubMed]
  42. Vañó-Galván, S.; Camacho, F. New Treatments for Hair Loss. Actas Dermo-Sifiliogr. 2017, 108, 221–228. [Google Scholar] [CrossRef] [PubMed]
  43. Randolph, M.; Tosti, A. Oral minoxidil treatment for hair loss: A review of efficacy and safety. J. Am. Acad. Dermatol. 2021, 84, 737–746. [Google Scholar] [CrossRef]
  44. Hwang, S.B.; Park, H.J.; Lee, B.H. Hair-Growth-Promoting Effects of the Fish Collagen Peptide in Human Dermal Papilla Cells and C57BL/6 Mice Modulating Wnt/β-Catenin and BMP Signaling Pathways. Int. J. Mol. Sci. 2022, 23, 11904. [Google Scholar] [CrossRef]
  45. Rastegar, H.; Ashtiani, H.A.; Aghaei, M.; Barikbin, B.; Ehsani, A. Herbal Extracts Induce Dermal Papilla Cell Proliferation of Human Hair Follicles. Ann. Dermatol. 2015, 27, 667–675. [Google Scholar] [CrossRef]
  46. Wei, W.; Zhao, G.; Li, Q.; Zhang, J.; Wei, H.; Shen, C.; Zhao, B.; Ji, Z.; Wang, L.; Guo, Y.; et al. Botulinum Toxin Type A Alleviates Androgenetic Alopecia by Inhibiting Apoptosis of Dermal Papilla Cells via Targeting circ_0135062/miR-506-3p/Bax Axis. Aesthetic Plast. Surg. 2024, 48, 1473–1486. [Google Scholar] [CrossRef]
  47. Boisvert, W.A.; Yu, M.; Choi, Y.; Jeong, G.H.; Zhang, Y.L.; Cho, S.; Choi, C.; Lee, S.; Lee, B.H. Hair growth-promoting effect of Geranium sibiricum extract in human dermal papilla cells and C57BL/6 mice. BMC Complement. Altern. Med. 2017, 17, 109. [Google Scholar] [CrossRef]
  48. Park, H.J.; Jin, G.R.; Jung, J.H.; Hwang, S.B.; Lee, S.H.; Lee, B.H. Hair Growth Promotion Effect of Nelumbinis Semen Extract with High Antioxidant Activity. Evid.-Based Complement. Altern. Med. 2021, 2021, 6661373. [Google Scholar] [CrossRef]
  49. Nishie, W. Collagen XVII Processing and Blistering Skin Diseases. Acta Derm.-Venereol. 2020, 100, adv00054. [Google Scholar] [CrossRef]
  50. Liu, Y.; Ho, C.; Wen, D.; Sun, J.; Huang, L.; Gao, Y.; Li, Q.; Zhang, Y. Targeting the stem cell niche: Role of collagen XVII in skin aging and wound repair. Theranostics 2022, 12, 6446–6454. [Google Scholar] [CrossRef]
  51. Fang, T.; Xu, R.; Sun, S.; He, Y.; Yan, Y.; Fu, H.; Luo, H.; Cao, Y.; Tao, M. Caizhixuan hair tonic regulates both apoptosis and the PI3K/Akt pathway to treat androgenetic alopecia. PLoS ONE 2023, 18, e0282427. [Google Scholar] [CrossRef]
  52. Wang, Z.D.; Feng, Y.; Sun, L.; Gan, J.; Li, X.; Ding, W.F.; Chen, X.M. Anti-androgenetic alopecia effect of policosanol from Chinese wax by regulating abnormal hormone levels to suppress premature hair follicle entry into the regression phase. Biomed. Pharmacother. 2021, 136, 111241. [Google Scholar] [CrossRef]
  53. Kotha, R.R.; Luthria, D.L. Curcumin: Biological, Pharmaceutical, Nutraceutical, and Analytical Aspects. Molecules 2019, 24, 2930. [Google Scholar] [CrossRef]
  54. Peng, Y.; Ao, M.; Dong, B.; Jiang, Y.; Yu, L.; Chen, Z.; Hu, C.; Xu, R. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug Des. Dev. Ther. 2021, 15, 4503–4525. [Google Scholar] [CrossRef] [PubMed]
  55. Yang, Y.; Wang, P.; Gong, Y.; Yu, Z.; Gan, Y.; Li, P.; Liu, W.; Wang, X. Curcumin-zinc framework encapsulated microneedle patch for promoting hair growth. Theranostics 2023, 13, 3675–3688. [Google Scholar] [CrossRef] [PubMed]
  56. Xu, C.; Dai, J.; Du, W.; Ji, H. Antioxidant Properties of Platycladus orientalis Flavonoids for Treating UV-Induced Damage in Androgenetic Alopecia Hair. Molecules 2024, 29, 2876. [Google Scholar] [CrossRef] [PubMed]
  57. Kim, J.; Joo, J.H.; Kim, J.; Rim, H.; Shin, J.Y.; Choi, Y.H.; Min, K.; Lee, S.Y.; Jun, S.H.; Kang, N.G. Platycladus orientalis Leaf Extract Promotes Hair Growth via Non-Receptor Tyrosine Kinase ACK1 Activation. Curr. Issues Mol. Biol. 2024, 46, 11207–11219. [Google Scholar] [CrossRef]
  58. Li, X.; Chen, X.; Yuan, W.; Zhang, X.; Mao, A.; Zhao, W.; Yao, N.; Deng, X.; Xu, C. Effects of Platycladus orientalis Leaf Extract on the Growth Performance, Fur-Production, Serum Parameters, and Intestinal Microbiota of Raccoon Dogs. Animals 2023, 13, 3151. [Google Scholar] [CrossRef]
Cosmetics 12 00156 g001
Figure 1. The effect of rhCOL17A1 on the mRNA expression of factors that are related to the survival of HFDPCs. The mRNA expression levels of Bax and Bcl-2 in HFDPCs were measured by RT-qPCR after UVB irradiation and rhCOL17A1 intervention. The mRNA expression levels of VEGF, IGF-1and FGF-7 were measured by RT-qPCR after treatment with different rhCOL17A1 concentrations (A) mRNA expression levels of Bcl-2 in HFDPCs; (B) mRNA expression levels of Bax in HFDPCs; (C) mRNA expression levels of VEGF in HFDPCs; (D) mRNA expression levels of IGF-1 in HFDPCs; (E) mRNA expression levels of FGF-7 in HFDPCs. ### p < 0.001. n = 3, compared with the control group in (A,B); * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3, compared with the model group in (A,B); and compared with the control group in (C–E). The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 1. The effect of rhCOL17A1 on the mRNA expression of factors that are related to the survival of HFDPCs. The mRNA expression levels of Bax and Bcl-2 in HFDPCs were measured by RT-qPCR after UVB irradiation and rhCOL17A1 intervention. The mRNA expression levels of VEGF, IGF-1and FGF-7 were measured by RT-qPCR after treatment with different rhCOL17A1 concentrations (A) mRNA expression levels of Bcl-2 in HFDPCs; (B) mRNA expression levels of Bax in HFDPCs; (C) mRNA expression levels of VEGF in HFDPCs; (D) mRNA expression levels of IGF-1 in HFDPCs; (E) mRNA expression levels of FGF-7 in HFDPCs. ### p < 0.001. n = 3, compared with the control group in (A,B); * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3, compared with the model group in (A,B); and compared with the control group in (C–E). The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g001
Cosmetics 12 00156 g002
Figure 2. Effect of rhCOL17A1 on signaling pathways in HFDPCs. HFDPCs were treated with different rhCOL17A1 concentrations. The expression levels of proteins related to the Wnt/β-catenin and SHH/GLI signaling pathways were measured by Western blotting. (A) The expression of key proteins in the Wnt signaling pathway was measured by Western blotting. (B) Expression levels of Wnt 3a were determined with ImageJ (1.46r) software (C,D) The levels of phosphorylated β-catenin and GSK-3β were determined with ImageJ (1.46r) software. (E,F) The expression levels of LEF-1 and DKK-1 were determined with ImageJ software. (G) The expression of proteins related to the SHH/GLI signaling pathway was measured by Western blotting. (H–J) Expression levels of SHH, SMO, and GLI-1 were determined with ImageJ (1.46r) software. (K,L) Expression levels of C-myc and CyclinD1 were determined with ImageJ (1.46r) software; * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3, compared with the control group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 2. Effect of rhCOL17A1 on signaling pathways in HFDPCs. HFDPCs were treated with different rhCOL17A1 concentrations. The expression levels of proteins related to the Wnt/β-catenin and SHH/GLI signaling pathways were measured by Western blotting. (A) The expression of key proteins in the Wnt signaling pathway was measured by Western blotting. (B) Expression levels of Wnt 3a were determined with ImageJ (1.46r) software (C,D) The levels of phosphorylated β-catenin and GSK-3β were determined with ImageJ (1.46r) software. (E,F) The expression levels of LEF-1 and DKK-1 were determined with ImageJ software. (G) The expression of proteins related to the SHH/GLI signaling pathway was measured by Western blotting. (H–J) Expression levels of SHH, SMO, and GLI-1 were determined with ImageJ (1.46r) software. (K,L) Expression levels of C-myc and CyclinD1 were determined with ImageJ (1.46r) software; * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3, compared with the control group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g002
Cosmetics 12 00156 g003
Figure 3. The effect of rhCOL17A1 on COLXVII in HFDPCs. (A) Laser confocal immunofluorescence image analysis of MMP-9 expression in HFDPCs and (B) quantitative analysis of MMP-9 fluorescence. (C) Laser confocal immunofluorescence image analysis of COLXVII expression in HFDPCs and (D) quantitative analysis of COLXVII fluorescence. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3/group, compared with the control group in (B,D). The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 3. The effect of rhCOL17A1 on COLXVII in HFDPCs. (A) Laser confocal immunofluorescence image analysis of MMP-9 expression in HFDPCs and (B) quantitative analysis of MMP-9 fluorescence. (C) Laser confocal immunofluorescence image analysis of COLXVII expression in HFDPCs and (D) quantitative analysis of COLXVII fluorescence. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3/group, compared with the control group in (B,D). The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g003
Cosmetics 12 00156 g004
Figure 4. Effects of rhCOL17A1 on morphology and hair follicles in TES-treated mice. C57BL/6 mice were continuously given TES to establish the model, and rhCOL17A1 treatment began on Day 5. The hair coverage on the dorsal skin of the mice was photographed every few days. (A) Records of hair coverage on the dorsal skin of the mice. (B) Scores of hair coverage on the dorsal skin of the mice. (C) Laser confocal immunofluorescence image analysis of Ki67 expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of Ki67 fluorescence. (E) Results of H&E staining of the dorsal skin of C57BL/6 mice. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001. compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 4. Effects of rhCOL17A1 on morphology and hair follicles in TES-treated mice. C57BL/6 mice were continuously given TES to establish the model, and rhCOL17A1 treatment began on Day 5. The hair coverage on the dorsal skin of the mice was photographed every few days. (A) Records of hair coverage on the dorsal skin of the mice. (B) Scores of hair coverage on the dorsal skin of the mice. (C) Laser confocal immunofluorescence image analysis of Ki67 expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of Ki67 fluorescence. (E) Results of H&E staining of the dorsal skin of C57BL/6 mice. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001. compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g004
Cosmetics 12 00156 g005
Figure 5. C57BL/6 mice were continuously treated with testosterone propionate to establish the model, and rhCOL17A1 treatment began on Day 5. On the 18th day, dorsal skin tissues were collected from the mice and subjected to immunofluorescence staining. (A) Laser confocal immunofluorescence image analysis of Wnt3a expression in the dorsal skin tissues of C57BL/6 mice and (B) quantitative analysis of Wnt3a fluorescence. (C) Laser confocal immunofluorescence image analysis of LEF-1 expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of LEF-1 fluorescence. (E) Laser confocal immunofluorescence image analysis of SMO expression in the dorsal skin tissues of C57BL/6 mice and (F) quantitative analysis of SMO fluorescence. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001 compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 5. C57BL/6 mice were continuously treated with testosterone propionate to establish the model, and rhCOL17A1 treatment began on Day 5. On the 18th day, dorsal skin tissues were collected from the mice and subjected to immunofluorescence staining. (A) Laser confocal immunofluorescence image analysis of Wnt3a expression in the dorsal skin tissues of C57BL/6 mice and (B) quantitative analysis of Wnt3a fluorescence. (C) Laser confocal immunofluorescence image analysis of LEF-1 expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of LEF-1 fluorescence. (E) Laser confocal immunofluorescence image analysis of SMO expression in the dorsal skin tissues of C57BL/6 mice and (F) quantitative analysis of SMO fluorescence. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001 compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g005
Cosmetics 12 00156 g006
Figure 6. C57BL/6 mice were continuously treated with testosterone propionate to establish the model, and rhCOL17A1 treatment began on Day 5. On the 18th day, the dorsal skin tissues were collected from the mice and subjected to immunofluorescence staining. (A) Laser confocal immunofluorescence image analysis of EGFR expression in the dorsal skin tissues of C57BL/6 mice and (B) quantitative analysis of EGFR fluorescence. (C) Laser confocal immunofluorescence image analysis of COLXVII expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of COLXVII fluorescence. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001 compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Figure 6. C57BL/6 mice were continuously treated with testosterone propionate to establish the model, and rhCOL17A1 treatment began on Day 5. On the 18th day, the dorsal skin tissues were collected from the mice and subjected to immunofluorescence staining. (A) Laser confocal immunofluorescence image analysis of EGFR expression in the dorsal skin tissues of C57BL/6 mice and (B) quantitative analysis of EGFR fluorescence. (C) Laser confocal immunofluorescence image analysis of COLXVII expression in the dorsal skin tissues of C57BL/6 mice and (D) quantitative analysis of COLXVII fluorescence. n = 3/group, ### p < 0.001 compared with the control group. *** p < 0.001 compared with the model group. The values are the means ± SDs. One-way analysis of variance (ANOVA) was used to analyze the data.
Cosmetics 12 00156 g006
Table 1. Information about the RT-qPCR primers used in this study.
Table 1. Information about the RT-qPCR primers used in this study.
Gene Primer Sequence (5′–3′)
HumanBcl-2TGTGGCCTTCTTTGAGTTCG
CATCCCAGCCTCCGTTATCC
BaxGGCCCTTTTGCTTCAGGGTT
CAGACACTCGCTCAGCTTCT
VEGFGGAGAGATGAGCTTCCTACAG
TCACCGCCTTGGCTTGTCACA
IGF-1ATGCTCTTCAGTTCGTGTGTG
GGGTCTTGGGCATGTCGGTG
FGF-7ATCCTTCCGGATGGCACA
ATAGTGAGTCCGAGGACC
β-actinCCTTCCTGGGCATGGAGTC
TGATCTTCATTGTGCTGGGTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Yin, S.; Xu, R.; Xiao, J.; Yi, R.; Mao, J.; Duan, Z.; Fan, D. Recombinant Type XVII Collagen Promotes Hair Growth by Activating the Wnt/β-Catenin and SHH/GLI Signaling Pathways. Cosmetics 2025, 12, 156. https://doi.org/10.3390/cosmetics12040156

AMA Style

Zhang Y, Yin S, Xu R, Xiao J, Yi R, Mao J, Duan Z, Fan D. Recombinant Type XVII Collagen Promotes Hair Growth by Activating the Wnt/β-Catenin and SHH/GLI Signaling Pathways. Cosmetics. 2025; 12(4):156. https://doi.org/10.3390/cosmetics12040156

Chicago/Turabian Style

Zhang, Yuyao, Shiyu Yin, Ru Xu, Jiayu Xiao, Rui Yi, Jiahui Mao, Zhiguang Duan, and Daidi Fan. 2025. "Recombinant Type XVII Collagen Promotes Hair Growth by Activating the Wnt/β-Catenin and SHH/GLI Signaling Pathways" Cosmetics 12, no. 4: 156. https://doi.org/10.3390/cosmetics12040156

APA Style

Zhang, Y., Yin, S., Xu, R., Xiao, J., Yi, R., Mao, J., Duan, Z., & Fan, D. (2025). Recombinant Type XVII Collagen Promotes Hair Growth by Activating the Wnt/β-Catenin and SHH/GLI Signaling Pathways. Cosmetics, 12(4), 156. https://doi.org/10.3390/cosmetics12040156

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop