Evidence for the Link Between KK-42 and the DH-PBAN Gene in Two Silkmoth Species, with Impacts on Developmental Traits
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Chemicals and Application
2.3. SG Collection
2.4. RNA Isolation
2.5. RNA-Seq
2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.7. Sequence Comparison and Phylogenetic Analysis
3. Results
3.1. Structure Change of DH-PBAN Genes in Insects
3.2. Effect of KK-42 on DH-PBAN Gene in A. pernyi Diapause Pupae
3.3. KK-42 Upregulates DH-PBAN Gene in the Embryonic Diapause Model B. mori
3.4. Effect of KK-42 on DH-PBAN Gene in B. mori Larvae
3.5. RNA-Seq Analysis
3.6. Gene Screen and Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yamashita, O. Diapause hormone of the silkworm, Bombyx mori: Structure, gene expression and function. J. Insect Physiol. 1996, 42, 669–679. [Google Scholar] [CrossRef] [Scilit]
- Imai, F.; Konno, T.; Nakazawa, Y.; Komiya, T.; Yamashita, O. Isolation and structure of diapause hormone of the silkworm, Bombyx mori. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 1991, 67, 98–101. [Google Scholar] [CrossRef] [Scilit]
- Shiomi, K.; Takasu, Y.; Kunii, M.; Tsuchiya, R.; Mukaida, M.; Kobayashi, M. Disruption of diapause induction by TALEN-based gene mutagenesis in relation to a unique neuropeptide signaling pathway in Bombyx. Sci. Rep. 2015, 5, 15566. [Google Scholar] [CrossRef] [Scilit]
- Kamei, Y.; Hasegawa, Y.; Niimi, T.; Yamashita, O.; Yaginuma, T. Trehalase-2 protein contributes to trehalase activity enhanced by diapause hormone in developing ovaries of the silkworm, Bombyx mori. J. Insect Physiol. 2011, 57, 608–613. [Google Scholar] [CrossRef] [Scilit]
- Sato, Y.; Oguchi, M.; Menjo, N.; Imai, K.; Saito, H.; Ikeda, M. Precursor polyprotein for multiple neuropeptides secreted from the suboesophageal ganglion of the silkworm Bombyx mori: Characterization of the cDNA encoding the diapause hormone precursor and identification of additional peptides. Proc. Natl. Acad. Sci. USA 1993, 90, 3251–3255. [Google Scholar] [CrossRef] [Scilit]
- Denlinger, D.L.; Yocum, G.D.; Rinehart, J.P.; Gilbert, L.I. (Eds.) Hormonal control of diapause. In Insect Endocrinology; Academic Press: San Diego, CA, USA, 2012; Volume 8, pp. 430–463. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.H.; Denlinger, D.L. Molecular characterization of prothoracicotropic hormone and diapause hormone in Heliothis virescens during diapause, and a new role for diapause hormone. Insect Mol. Biol. 2010, 12, 509–516. [Google Scholar] [CrossRef] [Scilit]
- Subta, P.; Suang, S.; Chantawannakul, P. Diapause hormone terminates larval diapause in the bamboo borer, Omphisa fuscidentalis (Hampson). J. Asia Pac. Entomol. 2017, 20, 1014–1018. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.H.; Sato, Y.; Ikeda, M.; Yamashita, O. Stage-dependent and temperature-controlled expression of the gene encoding the precursor protein of diapause hormone and pheromone biosynthesis activating neuropeptide in the silkworm, Bombyx mori. J. Biol. Chem. 1995, 270, 3804–3808. [Google Scholar] [CrossRef] [Scilit]
- Wei, Z.J.; Hong, G.Y.; Jiang, S.T.; Tong, Z.X.; Lu, C. Characters and expression of the gene encoding DH, PBAN and other FXPRLamide family neuropeptides in Antheraea pernyi. J. Appl. Entomol. 2010, 132, 59–67. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.R.; Nachman, R.J.; Denlinger, D.L. Diapause hormone in the Helicoverpa/Heliothis complex: A review of gene expression, peptide structure and activity, analog and antagonist development, and the receptor. Peptides 2015, 72, 196–201. [Google Scholar] [CrossRef] [Scilit]
- Berghiche, H.; Houamria, M.; Smagghe, G.; Soltani, N. Activity of kk-42 in combinated treatment with rh-0345 or 20-hydroxyecdysone on morphometric measurements and free ecdysteroid in eggs of mealworms. Commun. Agric. Appl. Biol. Sci. 2005, 70, 837–841. [Google Scholar]
- Kuwano, E.; Takeya, R.; Eto, M. Synthesis and anti-juvenile hormone activity of 1-substituted-5-[(e)-2,6-dimethyl-1,5-heptadienyl] imidazoles. Agric. Biol. Chem. 1985, 49, 483–486. [Google Scholar] [CrossRef] [Scilit]
- Darvas, B.; Kuwano, E.; Eto, M. Lethal disturbances in pre-ecdysial processes of Sarcophaga bullata caused by imidazole containing KK-42. Agric. Biol. Chem. 1989, 53, 859–861. [Google Scholar]
- Gelman, D.B.; Bell, R.A.; DeMilo, A.B.; Kochansky, J.P. Effect of KK-42 on growth, development, molting, and metamorphosis of the European corn borer, Ostrinia nubilalis (Hübner). Arch. Insect Biochem. Physiol. 2010, 28, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Roussel, J.P.; Mojtahed-zadeh, K.; Lanot, R.; Kuwano, E.; Akai, O.H. Effects of an imidazole derivative (KK-42) on development and ecdysteroid production in Locusta migratoria (Insecta, Orthoptera). Arch. Int. Physiol. Biochim. 1989, 97, 511–520. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Schnal, F. Effects of the imidazole derivative KK-42 on the female and embryos of Schistocerca gregaria. Entomol. Sci. 2001, 4, 387–392. [Google Scholar]
- Kirane-Amrani, L.; Touiker, S.Y.; Soltani-Mazouni, N. Effect of imidazole derivative KK-42 on in vivo development and ecdysteroid levels in pupal stage of meal-worms. Fresen. Environ. Bull. 2015, 24, 1856–1861. [Google Scholar]
- Suzuki, K.; Fujisawa, T.; Kurihara, M.; Abe, S.; Kuwano, E.; Akai, H.; Wu, Z.S. (Eds.) Artificial hatching in the silkworm, Antheraea yamamai: Application of KK-42 and its analogs. In Wild Silkmoths’ 8-Proceedings of the Workshop in XVIII International Congress of Entomology; International Society for Wild Silkmoths: Tokyo, Japan, 1989; pp. 79–84. [Google Scholar]
- Kuwano, E.; Fujisawa, T.; Suzuki, K. Termination of egg diapause by imidazoles in the silkmoth, Antheraea yamamai. Agric. Biol. Chem. 1991, 55, 1185–1186. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, K.; Nakamura, T.; Yanbe, T.; Kurihara, M.; Kuwano, E. Termination of diapause in pharate first-instar larvae of the gypsy moth Lymantria dispar japonica by an imidazole derivative KK-42. J. Insect Physiol. 1993, 39, 107–110. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.Y.; Denlinger, D.L. Diapause-regulated proteins in the gut of pharate first instar larvae of the gypsy moth, Lymantria dispar, and the effect of KK-42 and neck ligation on expression. J. Insect Physiol. 1996, 42, 423–431. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.C.; Suzuki, K.; Kuwano, E. Induction of non-diapause eggs by imidazole derivative KK-42 in the diapause type of Bombyx mori silkworm. Biosci. Biotechnol. Biochem. 1996, 60, 1201–1203. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Zhang, Q.; Denlinger, D.L. Imidazole derivative KK-42 boosts pupal diapause incidence and delays diapause termination in several insect species. J. Insect Physiol. 2015, 74, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Chen, M.; Li, Q.; Li, Y.P.; Xu, L.; Wang, H. Characterization of a gene encoding KK-42-binding protein in Antheraea pernyi (Lepidoptera: Saturniidae). Ann. Entomol. Soc. Am. 2012, 105, 718–725. [Google Scholar] [CrossRef] [Scilit]
- Bolger, A.M.; Marc, L.; Bjoern, U. Trimmomatic: A flexible trimmer for illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wang, S.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [Google Scholar] [CrossRef] [Scilit]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Cherry, J.M. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 1999, 27, 27–30. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, C.Y.; Zeng, W.H.; Zhang, T.Y.; Liu, R.P.; Ai, J.W.; Xiang, Z.H. Effects of transgenic overexpression of diapause hormone and diapause hormone receptor genes on non-diapause silkworm. Transgenic Res. 2017, 26, 807–815. [Google Scholar] [CrossRef] [Scilit]
- Cui, W.Z.; Qiu, J.F.; Dai, T.M.; Chen, Z.; Li, J.L.; Liu, K. Circadian clock gene period contributes to diapause via GABAeric-diapause hormone pathway in Bombyx mori. Biology 2021, 10, 842. [Google Scholar] [CrossRef] [Scilit]
- Mei, Y.; Jing, D.; Tang, S.Y.; Chen, X.; Chen, H.; Li, F. InsectBase 2.0: A comprehensive gene resource for insects. Nucleic Acids Res. 2021, 50, D1040–D1045. [Google Scholar] [CrossRef] [Scilit]
- Farris, S.M. Insect PRXamides: Evolutionary divergence, novelty, and loss in a conserved neuropeptide system. J. Insect Sci. 2023, 23, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Sudhir, K.; Glen, S.; Michael, L.; Christina, K.; Koichiro, T. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Choi, M.Y.; Estep, A.; Sanscrainte, N.; Becnel, J.; Vander Meer, R.K. Identification and expression of PBAN/diapause hormone and GPCRs from Aedes aegypti. Mol. Cell. Endocrinol. 2013, 375, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Hao, K.; Tu, X.; Ullah, H.; Mcneill, M.R.; Zhang, Z. Novel Lom-dh genes play potential role in promoting egg diapause of Locusta migratoria L. Front. Physiol. 2019, 10, 767. [Google Scholar] [CrossRef] [Scilit]
- Gu, S.H.; Lin, F.J.; Chow, Y.S. Effect of Imidazole on Developmental Determination of the Silkworm (Lepidoptera: Bombycidae). Ann. Entomol. Soc. Am. 1992, 85, 298–303. [Google Scholar] [CrossRef] [Scilit]
- Chang, J.C.; Ramasamy, S. Identification and expression analysis of diapause hormone and pheromone biostnthesis activating neuropeptide (DH-PBAN) in the legume pod borer Maruca vitrata Fabricius. PLoS ONE 2014, 9, e84916. [Google Scholar] [CrossRef] [Scilit]
- Bian, H.X.; Chen, D.B.; Li, Y.P.; Tan, E.G.; Sun, X.; Huang, J.C.; Su, J.F.; Liu, Y.Q. Transcriptomic analysis of Bombyx mori corpora allata with comparison to prothoracic glands in the final instar larvae. Gene 2022, 813, 146095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuchiya, R.; Kaneshima, A.; Kobayashi, M.; Yamazaki, M.; Takasu, Y.; Sezutsu, H.; Tanaka, Y.; Mizoguchi, A.; Shiomi, K. Maternal GABAergic and GnRH/corazonin pathway modulates egg diapause phenotype of the silkworm Bombyx mori. Proc. Natl. Acad. Sci. USA 2021, 118, e2020028118. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Genes | Sequences (5′-3′) | Length | References |
|---|---|---|---|
| BmDH | GCTTTGGCATTGTTCAGTATTT | [34] | |
| GGCTTCATTGATCGCTTCC | [34] | ||
| ApDH | GGTAGAAGCATCGGTGACATT | [10] | |
| CTTTGGGAGTAGCTGGCATATC | [10] | ||
| BmGAD | CATGATCGGGTGGAAGACTG | 72 bp | This study |
| AGGAAAGCGTAGAGATTGGAC | This study | ||
| BmTim | TCAACACCAAATCTCGTAGCG | 113 bp | This study |
| TGGAGTTTTATGAGACAGCCC | This study | ||
| BmCycle | AAACGGAAACCATCGTCCTA | [35] | |
| TTTGTTTCTTGTCGGGAGTG | [35] | ||
| Bmrp49 | GGGTCAATACTTGATGCCCAA | This study | |
| TCGTCACTCTGATGCTGAGC | This study | ||
| Aprp49 | GGGACAGTATCTGATGCCAAA | This study | |
| TGGTGACCCTGATGCTTAAC | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Bian, H.; Lin, Y.; Li, Y.; Sun, J.; Liu, Y. Evidence for the Link Between KK-42 and the DH-PBAN Gene in Two Silkmoth Species, with Impacts on Developmental Traits. Biology 2026, 15, 542. https://doi.org/10.3390/biology15070542
Bian H, Lin Y, Li Y, Sun J, Liu Y. Evidence for the Link Between KK-42 and the DH-PBAN Gene in Two Silkmoth Species, with Impacts on Developmental Traits. Biology. 2026; 15(7):542. https://doi.org/10.3390/biology15070542
Chicago/Turabian StyleBian, Haixu, Yufeng Lin, Yuping Li, Jingchen Sun, and Yanqun Liu. 2026. "Evidence for the Link Between KK-42 and the DH-PBAN Gene in Two Silkmoth Species, with Impacts on Developmental Traits" Biology 15, no. 7: 542. https://doi.org/10.3390/biology15070542
APA StyleBian, H., Lin, Y., Li, Y., Sun, J., & Liu, Y. (2026). Evidence for the Link Between KK-42 and the DH-PBAN Gene in Two Silkmoth Species, with Impacts on Developmental Traits. Biology, 15(7), 542. https://doi.org/10.3390/biology15070542

